A fungus, fungal agent, method and application

Abstract

This invention belongs to the field of biotechnology, specifically relating to the microbial degradation of low-rank coal, and specifically to a strain of *Talaromyces funiculosus*, its inoculum, methods, and applications. This invention provides a strain of *Talaromyces funiculosus* HG14, with accession number CGMCC No. 41631. The *Talaromyces funiculosus* HG14 provided by this invention can efficiently degrade low-rank coal to produce humic acid. The obtained humic acid has a high yield and a high content of oxygen-containing groups. In agriculture, the obtained humic acid has a good effect on promoting growth and increasing yield in corn, while also adsorbing greenhouse gases and reducing their emissions. The *Talaromyces funiculosus* HG14 of this invention can be used to extract humic acid from low-rank coal and has good application prospects.

Description

Technical Field

[0001] This invention relates to the field of microbial degradation of low-rank coal, specifically to a rope-shaped basket bacterium, a bacterial agent, a method, and its application. Background Technology

[0002] my country possesses abundant coal reserves, with low-rank coals such as lignite, weathered coal, and sub-bituminous coal accounting for over 50%. According to international coal classification standards, coal with a vitrinite random reflectance (R) below 0.5% and a water-containing, ash-free, high calorific value below 24 MJ / kg is defined as low-rank coal. Low-rank coal is characterized by high moisture content, low calorific value, and high volatile matter. Traditional direct combustion or gasification methods for its utilization are inefficient and generate significant pollutants and carbon emissions, placing considerable pressure on the environment. However, low-rank coal is rich in organic matter, particularly containing numerous aromatic compounds, important precursors to humic acid, as well as oxygen-containing functional groups such as carboxyl, hydroxyl, and carbonyl groups. This offers potential for its high-value utilization. Humic acid has attracted considerable attention due to its broad application prospects in various fields. In agriculture, it can be used as a biostimulant, soil conditioner, and fertilizer / pesticide synergist to effectively promote crop growth and development, and improve soil fertility and fertilizer utilization. In industry, it can serve as a wastewater treatment agent, drilling mud stabilizer, and concrete / ceramic additive, leveraging its unique physicochemical properties. In the environmental field, it can be used as a soil remediation agent and harmful gas adsorbent, contributing to the restoration and improvement of the ecological environment. In the pharmaceutical field, it can serve as a drug carrier and raw material for health products, demonstrating certain medicinal value. In the energy field, it can also be used as a catalyst for biodiesel production and an additive for fuel cell electrode materials, providing new ideas for the development of the energy industry. Therefore, converting the organic matter in low-rank coal into humic acid has become a key approach to achieving the clean and efficient utilization of low-rank coal.

[0003] Currently, the main methods for extracting humic acid from low-rank coal include chemical activation, microbial transformation, and pyrolysis activation. While chemical activation offers advantages such as simplicity and high efficiency, the extracted humic acid has low purity, poor bioactivity in agricultural applications, and is prone to environmental pollution during production. Pyrolysis activation suffers from drawbacks such as high equipment costs, high energy consumption, and stringent reaction conditions, limiting its large-scale application. In contrast, microbial transformation, with its simple equipment, low energy consumption, mild reaction conditions, and high bioactivity of the produced humic acid, is gradually becoming a research hotspot in the field of coal degradation, transformation, and resource utilization.

[0004] In studies on the microbial degradation of low-rank coal, various microorganisms have been found capable of degrading it. These include bacteria such as *Pseudomonas*, *Bacillus*, and *Sphingomonas*; actinomycetes represented by *Streptomyces*; and fungi encompassing white-rot fungi (such as *Phanerochaete chrysosporium* and *Agromycetes velutipes*), deuteromycetes (such as *Aspergillus terreus* and *Penicillium*), ascomycetes (such as *Neurospora crassa*), zygospores (such as *Clostridium chrysogenum*), and yeast-like fungi (such as *Candida*). However, there are no reports in existing technologies on the degradation and conversion of low-rank coal into humic acid using *Basilella cordifolia*. Summary of the Invention

[0005] This invention aims to solve the aforementioned problems in existing technologies for converting low-rank coal into humic acid, and provides a strain of *Hylocereus undatus*, a fungal agent, a method, and applications. *Hylocereus undatus* HG14 can simultaneously and efficiently degrade and convert low-rank coal into humic acid, opening up new avenues for the clean and efficient utilization of low-rank coal.

[0006] To address the aforementioned technical problems, the following technical solutions are proposed:

[0007] This invention provides a strain of *Talaromyces funiculosus* HG14, with accession number CGMCC No. 41631.

[0008] The present invention provides a microbial agent comprising the above-described fungal fungus HG14.

[0009] This invention provides the application of the above-described fungal fungus HG14 or the above-described fungal agent in the following 1) to 4);

[0010] 1) Degradation of low-rank coal;

[0011] 2) Degrading low-rank coal to produce humic acid;

[0012] 3) Improve the yield of humic acid produced by degrading low-rank coal;

[0013] 4) Prepare humic acid products with high bioactivity.

[0014] Preferably, the degradation method includes liquid fermentation, during which a carbon source and inorganic salts are added.

[0015] Preferably, the carbon source includes sucrose;

[0016] The inorganic salts include KNO3, K2HPO4, KH2PO4, MgSO4·7H2O and CaCl2·2H2O;

[0017] Add 1.5–2.0 g of sucrose, 0.3–0.5 g of KNO3, 0.03–0.05 g of K2HPO4, 0.1–0.15 g of KH2PO4, 0.03–0.05 g of MgSO4·7H2O, 0.001–0.003 g of CaCl2·2H2O, and 95 mL of water to every 1 g of coal.

[0018] Preferably, the low-rank coal includes one or more of bituminous coal, lignite, and weathered coal; the low-rank coal also undergoes photo-oxidation before degradation.

[0019] This invention provides a method for preparing humic acid or for degrading low-rank coal, comprising: mixing the *HG14* fungus or the bacterial agent described in the above technical solution with low-rank coal to degrade or prepare humic acid.

[0020] Preferably, the application form of the fungus HG14 includes a single-spore suspension; the viable count of the single-spore suspension is (1-5) × 10⁻⁶. 8 The degradation method includes liquid fermentation; during liquid fermentation, the inoculum amount of *HG14* spores is 3% to 7% of the volume of the liquid fermentation system.

[0021] The present invention provides humic acid obtained by the method described in the above technical solution.

[0022] This invention provides the application of humic acid, as described in the above technical solution, in promoting plant growth and / or reducing greenhouse gas emissions.

[0023] The beneficial effects of the present invention are as follows: The cordiform bacterium HG14 of the present invention has unique properties, which can simultaneously and efficiently degrade and transform lignite and sub-bituminous coal in low-rank coal into humic acid. This fills the gap in existing research on cordiform bacterium degradation of low-rank coal to produce humic acid, and opens up a new way for the clean and efficient utilization of low-rank coal.

[0024] The rope-shaped basket bacterium HG14 of the present invention has the following significant advantages:

[0025] (1) Wide substrate adaptability: Unlike other reported microorganisms, HG14 of the Fibrostomum can not only effectively degrade and transform lignite, but also has excellent degradation ability for sub-bituminous coal with a high degree of coalification, which greatly expands the range of available coal resources.

[0026] (2) Mild reaction conditions: Under conventional microbial culture conditions, such as suitable temperature, pH value and nutrient environment, the degradation and transformation of low-rank coal can be achieved without the need for harsh reaction conditions such as high temperature and high pressure, which reduces energy consumption and equipment requirements.

[0027] (3) Highly bioactive humic acid products: Humic acid produced by the conversion of lignite and bituminous coal by the fungus HG14 has high bioactivity and can play a more significant role in applications in agriculture, environment and other fields. In agriculture, it can more effectively promote plant growth and increase crop yield as a biostimulant. In the environmental field, it can more effectively adsorb greenhouse gases (N2O and CO2).

[0028] In summary, the present invention aims to provide a cord-shaped basket bacterium, a bacterial agent, a method, and applications. The cord-shaped basket bacterium HG14 provided by the present invention can simultaneously degrade bituminous coal and lignite to produce humic acid, and has good application prospects. Attached Figure Description

[0029] Figure 1 Image showing the coal liquefaction effect of HG14 fungus on PDA solid medium plates;

[0030] Figure 2 This image shows the growth of *HG14*, a fungus known as the rope basket bacterium, on a PDA solid medium plate.

[0031] Figure 3 Phylogenetic tree of HG14, a fungus known as the cordiformes bacterium;

[0032] Figure 4 For MHA and CHA 13 C NMR spectrum analysis.

[0033] Biological Preservation Instructions

[0034] Talaromyces funiculosus HG14 was deposited on November 18, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41631. The address of the depository is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. Detailed Implementation

[0035] This invention provides a strain of *Talaromyces funiculosus* HG14, with accession number CGMCC No. 41631.

[0036] The fungus *Talaromyces funiculosus* HG14 of this invention is isolated and screened from sub-bituminous coal samples. It grows well on Bengal red and PDA media, and colonies are visible after 2-3 days of incubation at 28°C. The colonies are green, irregularly shaped, with a hairy surface, readily produce spores, and have a loose texture that is easily picked up. This invention utilizes the ITS sequence of *Talaromyces funiculosus* HG14 for BLAST homology sequence search in NCBI to confirm that strain HG14 is *Talaromyces funiculosus*. The ITS gene sequence of *Talaromyces funiculosus* HG14 is shown in SEQ ID NO. 1.

[0037] The rope-shaped basket bacterium HG14 of the present invention can convert lignite and bituminous coal to produce humic acid, and can simultaneously degrade and convert lignite and bituminous coal.

[0038] The present invention provides a microbial agent comprising the above-described fungal fungus HG14.

[0039] As an optional embodiment, the application form of the rope-shaped basket fungus HG14 of the present invention includes an HG14 single-spore suspension. As an optional embodiment, the preparation method of the HG14 single-spore suspension includes the following steps:

[0040] HG14 *Hymenopterus xanthipes* was inoculated onto a solid culture medium for activation culture to obtain mature spores. The activation culture temperature was 27–29°C, preferably 28°C. In specific embodiments of the present invention, the culture temperature was 27, 28, or 29°C. The activation culture time was 3–5 days, and in specific embodiments of the present invention, the activation culture time was 4 or 5 days. The activation culture was performed in the dark.

[0041] As an optional embodiment, the present invention utilizes a solution to elute spores and then shakes to obtain a single-spore suspension. As an optional embodiment, the solution used for spore elution comprises 0.1% sterile physiological saline. In a specific embodiment of the present invention, spores are eluted into an Erlenmeyer flask using the 0.1% sterile physiological saline, and then shaken to obtain a single-spore suspension.

[0042] As an optional implementation, the culture medium used for activation culture application in this invention includes liquid potato glucose medium, i.e., PDA medium.

[0043] As an optional implementation, the oscillation time is 28 to 32 minutes, more preferably 30 minutes.

[0044] As an optional implementation, the viable count of the single-spore fungal suspension is (1–5) × 10⁻⁶. 8 The concentration per mL can also be (3-4) × 10⁻⁶.8 per mL.

[0045] This invention provides the application of the above-described *Bacillus ligustus* HG14 in the degradation of low-rank coal.

[0046] As an optional implementation, the low-rank coal described in this invention includes one or more of bituminous coal, lignite, and weathered coal. In a specific embodiment of this invention, lignite and bituminous coal taken from the Yima City coal mine area in Sanmenxia were used for experimental verification.

[0047] As an optional implementation, the low-rank coal of the present invention undergoes photo-oxidation pretreatment before degradation. This photo-oxidation pretreatment increases the oxygen content of the low-rank coal, which is beneficial for improving the degradation rate of the low-rank coal by microorganisms. As an optional implementation, the photo-oxidation pretreatment is performed using a photoreactor. In a specific embodiment of the present invention, the parameters for the photo-oxidation of sub-bituminous coal are: an oxygen flow rate of 10–40 mL / min, a UV lamp power of 160–200 W, and an oxidation reaction time of 24–48 h.

[0048] As an optional embodiment, the *HG14* fungal agent degrades low-rank coal via liquid fermentation. As an optional embodiment, a carbon source and inorganic salts are added during the liquid fermentation process. As an optional embodiment, the carbon source includes sucrose. The inorganic salts include KNO3, K2HPO4, KH2PO4, MgSO4·7H2O, and CaCl2·2H2O.

[0049] As an optional implementation, 1.5–2.0 g of sucrose, 0.3–0.5 g of KNO3, 0.03–0.05 g of K2HPO4, 0.1–0.15 g of KH2PO4, 0.03–0.05 g of MgSO4·7H2O, 0.001–0.003 g of CaCl2·2H2O, and 95 mL of water are added per 1 g of coal. Preferably, 1.5 g of sucrose, 0.3 g of KNO3, 0.05 g of K2HPO4, 0.1 g of KH2PO4, 0.05 g of MgSO4·7H2O, 0.002 g of CaCl2·2H2O, and 95 mL of water are added per 1 g of coal. As an optional implementation, the coal is coal pretreated by photo-oxidation. This invention involves liquid fermentation of a mixture of coal, carbon source, and inorganic salts. As an optional implementation, the mixture of coal after photo-oxidation with the carbon source, inorganic salt components, and water is considered the culture medium. The *HG14* fungus is inoculated into this medium for liquid fermentation to degrade the coal. As another optional implementation, the inoculation form of *HG14* fungus includes a suspension of HG14 monospores. The preparation method of the HG14 monospore suspension has been discussed above and will not be repeated here. The total volume is defined as the volume of the HG14 monospore suspension and water. The inoculation amount of the HG14 monospore suspension is preferably 3%–7% of the total volume, or 4%–6%, more preferably 5%. The viable count of the monospore suspension is (1–5) × 10⁻⁶. 8 The concentration per mL can also be (3-4) × 10⁻⁶. 8 The number of spores / mL in the liquid fermentation system after inoculation with HG14 monosporus suspension during the liquid fermentation process described in this invention is ≥1×10⁻⁶. 6 per mL.

[0050] As an optional implementation, the temperature of the liquid fermentation is 25℃~30℃, or 26~29℃; in specific embodiments of the present invention, the temperature of the liquid fermentation is 25, 26, 27, 28, 29, or 30℃. The liquid fermentation time of the present invention is 6~8 days, more preferably 7 days. In specific embodiments of the present invention, the liquid fermentation time is 6, 7, or 8 days. As an optional implementation, the rotation speed of the liquid fermentation is 120~160 rpm, or 140~150 rpm. During the liquid fermentation process, the liquid fermentation is considered complete when the concentration of humic acid, the coal-soluble product, no longer changes.

[0051] This invention provides the application of the above-described fungal bacteria HG14 or the above-described bacterial agent in the degradation of low-rank coal to produce humic acid.

[0052] The types of coal, the temperature, time, rotation speed, method, and the carbon source and inorganic salts added during liquid fermentation described in this invention have been discussed above and will not be repeated here. As an optional implementation, after the liquid fermentation is completed, a culture medium is obtained; after filtering and acid precipitation of the culture medium, humic acid is obtained.

[0053] This invention does not specifically limit the filtration method; conventional methods are acceptable. As an optional embodiment, the filtrate is subjected to acid precipitation and centrifugation to obtain humic acid. The acid precipitation method of this invention includes: adjusting the pH of the filtrate with HCl solution before carrying out the precipitation reaction. The molar concentration of the HCl solution in this invention is 6.0 M, the pH of the adjusted filtrate is 1.8, and the precipitation reaction time is 12–24 h. As an optional embodiment, the centrifugation speed is 10,000 rpm, and the centrifugation time is 10 min. The liquid fermentation and extraction process of this invention does not use chemical solvents and does not generate secondary waste that pollutes the environment.

[0054] This invention provides the application of the above-described fungal bacteria HG14 or the above-described bacterial agent in improving the yield of humic acid production from low-rank coal.

[0055] The types of low-rank coal, the temperature, time, rotation speed, method, carbon source and inorganic salt composition added during liquid fermentation, and the extraction parameters of humic acid produced from the degradation of low-rank coal described in this invention have been discussed above and will not be repeated here.

[0056] The *H. 14* strain of this invention can degrade low-rank coal to produce humic acid, and the yield and purity of humic acid are significantly improved compared with chemical methods. After biodegradation by strain HG14, the humic acid yield of lignite increased from 43.32% to 66.41%, and the ash content in the humic acid decreased from 15.06% to 9.45%. After biodegradation by strain HG14, the humic acid yield of bituminous coal increased from 2.99% to 41.47%, and the ash content in the humic acid decreased from 8.64% to 5.22%. Compared with humic acid (CHA) extracted from lignite and bituminous coal by chemical methods, the humic acid (MHA) obtained by HG14 degradation of lignite and bituminous coal has increased esterification, decreased aromaticity, and increased oxygen / nitrogen group content.

[0057] This invention provides the application of the above-described fungal fungus HG14 or the above-described fungal agent in the preparation of highly bioactive humic acid products.

[0058] The types of low-rank coal, the temperature, time, rotation speed, method, carbon source and inorganic salt composition added during liquid fermentation, and the extraction parameters of humic acid produced from the degradation of low-rank coal described in this invention have been discussed above and will not be repeated here.

[0059] As an optional implementation method, the high bioactivity of this invention refers to an enhanced growth-promoting effect of humic acid. Compared to humic acid prepared by chemical methods, the growth-promoting effect of producing humic acid by degrading low-rank coal using *H. coli* fungus HG14 is superior.

[0060] This invention provides a method for preparing humic acid or for degrading low-rank coal, comprising: mixing the *HG14* fungus or the bacterial agent described in the above technical solution with low-rank coal for degradation.

[0061] As an optional implementation, the present invention performs photo-oxidation on the coal before degradation or preparation of humic acid; the parameters of the photo-oxidation have been discussed above and will not be repeated here.

[0062] As an optional embodiment, the present invention adds inorganic salts, carbon sources, and water to the coal before degradation. As another optional embodiment, the present invention adds inorganic salts, carbon sources, and water to the low-rank coal after photo-oxidation before degradation. As an optional embodiment, the types and amounts of the inorganic salts and carbon sources have been discussed above and will not be repeated here.

[0063] As an optional implementation, the application form of the rope basket fungus HG14 includes HG14 monospore suspension; as an optional implementation, the degradation method includes liquid fermentation; the volume of the HG14 monospore suspension and water in this invention is recorded as the total volume, and the inoculation amount of the HG14 monospore suspension is preferably 3% to 7% of the total volume, or 4% to 6%, more preferably 5%.

[0064] This invention provides humic acid prepared by the method described in the above technical solution. The humic acid of this invention has an increased aliphatic carbon content; the aliphatic carbons of this invention include C. Alk-H,R C Alk-O,N C Alk-O and C Alk-di-O One or more of the following; the aromatic carbon content of the humic acid described in this invention is reduced; the aromatic carbon includes C Ar-H,R and / or C Ar-O,N .

[0065] The present invention utilizes the fungus HG14 to degrade lignite to prepare humic acid MHA-L, thereby increasing the aliphatic carbon content. The resulting humic acid MHA-L has a C2 value of [missing information]. Alk-H,R Content is 33%–34%, C Alk-O,N The content is 12% to 13%, C Alk-O The content is 16%–17%; MHA-L reduces the aromatic carbon content, and the resulting humic acid MHA-L has a C content of 16%–17%. Ar-H,RThe content is 15%–16%; the C of the obtained humic acid MHA-L Ar-O,N The content is 5% to 6%.

[0066] The present invention utilizes the *H. 14* fungus to degrade sub-bituminous coal to prepare humic acid MHA-S, thereby increasing the aliphatic carbon content and improving the carbon content of the resulting humic acid MHA-S. Alk-di-O Content is 5.5%–6.0%, C Alk-O,N Content is 5%–6%, C Alk-O The content is 8%–9%; MHA-S reduces the aromatic carbon content, and the resulting humic acid MHA-S has a C content of 8%–9%. Ar-HR The content is 34%–35%; the C of the obtained humic acid MHA-L Ar-ON The content is 13% to 13.8%.

[0067] Changes in the structure and functional groups of humic acid have significant effects on soil and plants. When aliphatic carbon increases and aromatic carbon decreases, the molecular structure and functional group composition of humic acid facilitate binding to receptors on plant cell surfaces, activating physiological and biochemical reactions within the plant, promoting root growth and development, improving water and nutrient absorption efficiency, and enhancing stress resistance. Simultaneously, increased aliphatic carbon enhances its flexibility, allowing it to penetrate between soil particles and bind them together through physical and chemical processes; decreased aromatic carbon reduces rigidity, facilitating adsorption and bridging on soil particle surfaces, jointly promoting soil aggregate formation and improving porosity and aeration. Furthermore, increased oxygen-containing groups in humic acid enhance its hydrophilicity, solubility, ion exchange capacity, and chemical reactivity, improving soil structure, regulating pH, promoting microbial activity, and also promoting plant nutrient absorption, stimulating growth, enhancing stress resistance, and increasing crop yield and quality. Increased oxygen-containing groups enhance the ion exchange capacity of humic acid, affecting the form and transformation of nitrogen in the soil. Ammonium nitrogen is adsorbed and fixed, reducing its conversion to nitrate nitrogen, inhibiting denitrification, and lowering nitrous oxide emissions. Simultaneously, changes in soil aeration alter the activity of nitrifying and denitrifying microorganisms, affecting nitrous oxide production. The decrease in aromatic carbon in humic acid indicates that the strains degraded low-rank coal, opening aromatic rings and increasing aliphatic chains.

[0068] The humic acid of the present invention has an increased content of oxygen / nitrogen functional groups, and the H / C, N / C and O / C ratios are all increased to varying degrees.

[0069] This invention provides the application of humic acid as described in the above technical solution in promoting plant growth.

[0070] As an alternative implementation, the plant includes corn.

[0071] As an optional implementation, the growth promoter includes one or more of the following: 1) to 4).

[0072] 1) Number of grains per spike; 2) Thousand-grain weight; 3) Dry matter content of aboveground parts of the plant; 4) Plant yield.

[0073] As an optional implementation, the amount of humic acid added is 28–32 kg / hm² based on the mass of the cultivation soil sample. 2 More preferably 30 kg / hm 2 As an optional implementation, the humic acid can be applied as a base fertilizer, or simultaneously with a nitrogen-phosphorus-potassium compound fertilizer.

[0074] This invention provides the application of humic acid as described in the above technical solution in reducing greenhouse gas emissions.

[0075] As an optional implementation, the greenhouse gas includes N2O and / or CO2.

[0076] This experiment used a field plot experiment to verify the effects of humic acid (CHA, MHA) extracted by two extraction methods on maize growth and greenhouse gas emissions. CHA (CHA-L, CHA-S) is humic acid extracted from lignite and bituminous coal by applying alkali dissolution and acid precipitation method, while MHA (MHA-L, MHA-S) is humic acid converted from lignite and bituminous coal by applying strain HG14 to degrade lignite and bituminous coal. Compared with the control (CK), the addition of HA significantly increased the aboveground dry matter, number of grains per ear, thousand-grain weight, and yield of maize. The increases were even greater with MHA-L and MHA-S compared to CHA-L and CHA-S. Furthermore, the cumulative emissions of N2O and CO2 significantly decreased after HA addition, indicating that HA effectively reduces soil N2O and CO2 emissions. Compared with the control, MHA-L and MHA-S showed superior emission reduction effects, decreasing N2O by 41.04% and 47.35%, respectively, and CO2 by 40.63% and 46.88%, respectively. Therefore, HA promotes maize growth and increases yield while reducing soil N2O and CO2 emissions. Moreover, the application of MHA-L and MHA-S, derived from the degradation of low-rank coal by strain HG14, achieves even greater yield increases and reduces agricultural greenhouse gas emissions.

[0077] In summary, the humic acid of the present invention can play a more significant role in applications in agriculture, environment and other fields. For example, in agriculture, it can more effectively promote corn growth as a biostimulant, thereby increasing corn yield. In the environmental field, it can more effectively adsorb greenhouse gases and reduce the release of N2O and CO2 from agricultural soil into the atmosphere.

[0078] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0079] The Bengal Red agar medium consists of: 5g peptone, 10g glucose, 1g potassium dihydrogen phosphate, 0.5g magnesium sulfate (MgSO4·7H2O), 20g agar, 0.03g Bengal Red, 0.1g chloramphenicol, and 1000mL distilled water. Preparation method: Dissolve all the above components in distilled water, then add the Bengal Red solution. Add the solution to the medium, dispense into containers, and sterilize at 121℃ for 20min.

[0080] The composition of potato glucose medium (PD) is: 200g potato, 20g glucose and 1000mL distilled water; the composition of potato glucose agar medium (PDA) is: 20g / L agar powder added to PD medium.

[0081] Example 1: Isolation of low-rank coal-degrading bacteria

[0082] 1. The coal samples in this experiment were taken from the coal mining area of ​​Yima City, Sanmenxia. Industrial analysis (moisture, ash, volatile matter, fixed carbon), elemental analysis, calorific value and vitrinite reflectance were performed on coal samples A and B. According to the results, coal sample A was lignite and coal sample B was sub-bituminous coal. The results are shown in Table 1.

[0083] Table 1. Results of industrial analysis, elemental analysis, calorific value, and vitrinite reflectance analysis of coal samples.

[0084]

[0085] 2. Fungi were isolated, screened, and cultured from Yima lignite and sub-bituminous coal samples to obtain a batch of microbial strains for use as degradable Yima low-rank coal. The specific steps are as follows:

[0086] Take 1g of coal sample with a particle size of 0.150mm, add sterile water, shake and mix for 2h, then use an inoculation loop to streak a loop onto Bengal Red agar medium, and then place it in a constant temperature incubator at 28℃ for static culture. After the colonies grow, select colonies of different morphologies and inoculate them onto PDA solid medium plates for purification. A total of 36 strains were isolated.

[0087] Further screening of the obtained strains revealed a strain, HG14, capable of dissolving solid low-rank coal into a black liquid. The specific steps were as follows: 36 strains were inoculated onto PDA solid medium plates and incubated at 28℃ for 3–5 days. After the strains had completely covered the medium, a layer of high-temperature sterilized Yima lignite powder was evenly added, and the culture continued for 48–72 hours. Black droplets were observed on the surface of the colonies of one strain. This strain was then cultured again, and high-temperature sterilized bituminous coal powder was evenly sprinkled on top. Similarly, black droplets appeared on the surface of the colonies. This demonstrates that the strain can degrade lignite and weathered coal, with effective results. Figure 1 After multiple experiments, its degradation effect was verified to be relatively stable, and the strain was named HG14.

[0088] Example 2: DNA extraction and strain identification of *H. 14*, a fungus known as the rope basket bacterium.

[0089] 1. Colony morphology

[0090] Strain HG14 was inoculated onto PDA solid medium plates and cultured at 28°C for 4 days. Colony characteristics included irregular green colonies with a fuzzy surface, readily producing spores, and a loose texture that was easily picked up. (See [link to other documentation]). Figure 2 .

[0091] 2. PCR amplification and sequencing of the ITS sequence.

[0092] The strain HG14 obtained in Example 1 was inoculated onto PDA medium plates and cultured at 28°C for 4 days to obtain hyphae. The obtained hyphae were scraped off, flash-frozen in liquid nitrogen, and then pulverized in a high-speed tissue homogenizer. Fungal DNA (Solepro product number D2300) was extracted according to the kit method and stored at -80°C for later use. The ITS sequence of the strain was amplified by PCR using primers ITS1 (SEQ ID NO.2: TCCGTAGGTGAACCTGCGG) and ITS4 (SEQ ID NO.3: TCGMCCGCTTATTGATATGC). The PCR reaction system (25 μL) consisted of: 12.5 μL of 2×F5 TaqPCR MasterMix (Beijing Zhuangmeng International Biotechnology Co., Ltd.), 1 μL of DNA template, 11 μL of ITS, 11 μL of ITS4, and 9.5 μL of ddH2O. The PCR amplification conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, and 72℃ extension for 1 min, with the denaturation, annealing, and extension stages repeated 35 times, and a final extension at 72℃ for 10 min.

[0093] The obtained PCR amplification products were detected by 1% agarose gel electrophoresis and then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The ITS sequence sequencing results are shown in SEQ ID NO.1:

[0094] SEQ ID NO.1: AGACGTAGCTTCGTAGGTGACCTGCGGAGGATCATTAC CGAGTGCGGGCCCTCGCGGCCCCAACGMCCCACCCTTGTCTCTCTACACCT GTTGCTTTGGCGGGCCCACTGGGGCTCCCTGGTCGCCGGGGGACACCCGTCCCCGGGCCCGCGCCCGCCGAAGCGCTTCGTGAACCCTGATGAAGAAGGGCTGTCTGAGTACTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAGAACGCAGCA.

[0095] The obtained ITS sequences were used for BLAST homology sequence retrieval in GenBank. A phylogenetic tree of the ITS sequences was constructed using the Neighbor-Joining Tree method in MEGA software, with repeated sampling 1000 times. The results are shown in [Figure number missing]. Figure 3 .according to Figure 3 It can be seen that strain HG14 and MW724155.1 *Talaromyces funiculosus* isolate220MAR belong to the same evolutionary branch, indicating that the two strains are most closely related. Furthermore, based on morphological observation and physiological and biochemical characteristic analysis, strain HG14 was identified as *Talaromyces funiculosus*, specifically *Talaromyces funiculosus* HG14.

[0096] Example 3: Degradation of low-rank coal by coal-solubilizing bacteria HG14

[0097] 1. Coal sample processing

[0098] The coal samples used in the experiment were bituminous coal (denoted as YMS) and lignite (denoted as YML) from Yima City, Sanmenxia, ​​Henan Province. After grinding and sieving, the coal samples were pulverized to obtain coal powder with a particle size range of 0.075 mm to 0.150 mm. The coal powder was then vacuum-dried at 105℃ for 2 hours and placed in a photoreactor for photo-oxidation pretreatment. The oxidation conditions were controlled as follows: 20 g of coal sample, oxygen flow rate of 10–40 mL / min to maintain oxygen saturation, UV lamp power of 160 W, and oxidation reaction time of 48 hours. The resulting bituminous coal (denoted as GYMS) and lignite (denoted as GYML) were obtained after photo-oxidation. Photo-oxidation pretreatment of low-rank coal can increase its oxygen content, which is beneficial for improving the degradation rate of coal by microorganisms.

[0099] 2. Preparation of single-spore fungal suspension

[0100] HG14 culture stored at 4℃ was transferred to PDA medium and incubated in the dark at 28℃ for 5 days to obtain mature spores. Under aseptic conditions, the spores were washed away with 0.1% sterile physiological saline and poured into a sterile Erlenmeyer flask containing glass beads, and shaken thoroughly for 30 minutes. After the spores were fully dispersed, they were counted using a hemocytometer to prepare a concentration of 1×10⁻⁶. 8 A suspension of single spores per mL.

[0101] 3. Microbial fermentation

[0102] Liquid coal soluble culture medium: (1) 1.5g sucrose, 0.3g KNO3, 0.05g K2HPO4, 0.1g KH2PO4, 0.05g MgSO4·7H2O, 0.002g CaCl2·2H2O, 1g photo-oxidative bituminous coal and 95mL deionized water, pH 6.5~7.0, is called bituminous coal culture medium. The volume of the culture medium prepared by the above substances is based on the volume of deionized water, that is, 95mL bituminous coal culture medium is obtained.

[0103] (2) 1.5g sucrose, 0.3g KNO3, 0.05g K2HPO4, 0.1g KH2PO4, 0.05g MgSO4·7H2O, 0.002g CaCl2·2H2O, 1g photo-oxidative lignite, and 95mL deionized water, with a pH of 6.5-7.0, is called lignite culture medium. The volume of the culture medium prepared by the above substances is based on the volume of deionized water, which gives 95mL of bituminous coal culture medium.

[0104] Under aseptic conditions, 5 mL of HG14 monosporus suspension was added to 95 mL of bituminous coal culture medium, shaken immediately, and placed in a shaker at 28°C with a rotation speed of 150 rpm for 7 days to obtain bituminous coal culture medium.

[0105] Under aseptic conditions, 5 mL of HG14 monosporin suspension was added to 95 mL of lignite culture medium, shaken immediately, and placed in a shaker at 28°C with a rotation speed of 150 rpm for 7 days to obtain lignite culture medium.

[0106] 4. Humic acid extraction

[0107] After the culture in step 3 is completed, the culture broth of bituminous coal and lignite are filtered to obtain water-soluble humic acid filtrate. The pH of the filtrate is adjusted to 1.8 with 6.0M HCl solution, and after standing for precipitation for 24 hours, it is centrifuged at 10,000 rpm for 10 minutes to collect the precipitated humic acid. It is washed three times with distilled water, dried at 60℃ to constant weight, and stored at 4℃. These are the humic acid converted from lignite by microbial degradation (i.e., MHA-L) and the humic acid converted from bituminous coal by microbial degradation (i.e., MHA-S).

[0108] Humic acid extracted by the alkaline dissolution and acid precipitation method was used as a control group. The specific steps were as follows: 1g of YMS and YML coal powder with a particle size of 0.075mm–0.150mm, dried to constant weight, was added to 100mL of 0.1M NaOH solution. The mixture was shaken continuously on a shaker at 30℃ and 160rpm for 24h. The resulting solution was centrifuged at 8000rpm for 10min and filtered. The pH of the filtrate was adjusted to 1.8 with 6.0M HCl, and after standing for 24h to precipitate, it was centrifuged at 10000rpm for 10min. The precipitated sub-bituminous coal humic acid (CHA-S) and lignite humic acid (CHA-L) were collected separately, washed three times with distilled water, and dried to constant weight at 60℃. The yield of humic acid was determined using the Eq method according to the following formula:

[0109] η=(m1 / m0)×100%(1);

[0110] In formula (1), η is the humic acid yield (%); m0 is the initial mass of the coal sample (g); and m1 is the mass of humic acid (g).

[0111] 5. Analysis of MHA-L, MHA-S, CHA-L, and CHA-S products

[0112] (1) Yield of humic acid and analysis of organic elements

[0113] The yield of humic acid and the analysis of organic elements showed (Table 2) that after biodegradation by strain HG14, the yield of humic acid in lignite increased from 43.32% to 66.41%, and the ash content in humic acid MHA-L decreased from 15.06% to 9.45%. After biodegradation by strain HG14, the yield of humic acid MHA-S in sub-bituminous coal increased from 2.99% to 41.47%, and the ash content decreased from 8.64% to 5.22%. After degradation by strain HG14, the yields of MHA-L and MHA-S in lignite and sub-bituminous coal increased significantly. The significant decrease in ash content indicates that the microbial degradation method yields humic acid with fewer impurities and higher purity than the chemical method. Elemental analysis shows that compared to CHA-L extracted from lignite using chemical methods, MHA-L obtained from lignite using the microbial method exhibits increased H% (H%), N% (N%), and O% (O%), as well as higher hydrogen-to-carbon (H / C), nitrogen-to-carbon (N / C), and oxygen-to-carbon (O / C) ratios. The C% (C%) ratio shows less change, while the S% (S%) ratio decreases slightly. Compared to CHA-S extracted from sub-bituminous coal using chemical methods, MHA-S obtained from sub-bituminous coal using the microbial method shows significantly increased H%, N%, and O%, as well as higher H / C, N / C, and O / C ratios. Conversely, C% decreases significantly, while S% increases slightly. A higher H / C ratio indicates lower aromatization, and O / C and N / C values ​​reflect the content of oxygen / nitrogen functional groups in the HA structure. Compared to humic acid (CHA) extracted from lignite and sub-bituminous coal using chemical methods, the H / C, N / C, and O / C ratios of humic acids (MHA-L and MHA-S) extracted from both coals by microbial methods all increased to varying degrees. This indicates that after degradation by HG14, the aromaticity of humic acid decreased, while the content of oxygen / nitrogen functional groups increased. The biotransformation of humic acid by strain HG14 significantly improved the yield compared to chemical extraction, with a 12.87-fold increase in humic acid yield from sub-bituminous coal and a 53.30% increase from lignite.

[0114] Table 2. Elemental composition (organic), atomic ratio and yield of two types of humic acid

[0115]

[0116] (2) Humic acid 13 C NMR spectroscopy analysis

[0117] 13 12C NMR spectroscopy can provide important basic information on the macromolecular structure of humic acid. Peak signals at different chemical shifts can be used to infer the structure of humic acid. This analysis shows that ( Figure 4 Table 3): Compared to CHA-L extracted from lignite by chemical methods, MHA-L obtained from lignite by microbial methods contains more aliphatic carbon (C). Alk-H,R CAlk-O,N C Alk-O The increase in aromatic carbon (C) resulted in a 25.39% higher degree of esterification compared to CHA-L, while the increase in aromatic carbon (C) Ar-H,R C Ar-O,N The aroma content of MHA-L is significantly reduced, resulting in a 43.24% decrease compared to CHA-L. Furthermore, compared to CHA-L, MHA-L contains significantly fewer oxygen / nitrogen groups (C...). Alk-O,N C Alk-O C COO-H,R C C＝O The concentration of aliphatic carbon (C6H6) in MHA-S obtained from sub-bituminous coal has also increased compared to that obtained chemically. Alk-O,N C Alk-O C Alk-di-O The increase in aromatic carbon (C) resulted in a 20.93% higher degree of esterification compared to CHA-S, while the increase in aromatic carbon (C) Ar-H,R C Ar-O,N The aroma content of MHA-S is significantly reduced, resulting in a 15.79% decrease compared to CHA-S. Furthermore, compared to CHA-S, MHA-S contains significantly fewer oxygen / nitrogen groups (C...). Alk-O,N C Alk-O C Alk-di-O C COO-H,R C C＝O The degradation rate of lignite was also improved. Compared to sub-bituminous coal, strain HG14 exhibited a higher degree of degradation and a greater degree of alteration to its humic acid structure.

[0118] Table 3 Solid State CP / MAS 13 Carbon distribution in CHA and MHA determined by C NRM spectroscopy

[0119] Carbon distribution (C%) ppm CHA-L MHA-L CHA-S MHA-S <![CDATA[C Alk-H,R ]]> 0-45 28.2 33.2 23.4 21.0 <![CDATA[C Alk-O,N ]]> 45-60 7.1 12.2 4.1 5.2 <![CDATA[C Alk-O ]]> 60-91 10.0 16.3 3.8 8.3 <![CDATA[C Alk-di-O ]]> 91-110 5.0 3.1 5.2 5.5 <![CDATA[C Ar-H,R ]]> 110-142 26.1 15.6 43.0 34.5 <![CDATA[C Ar-O,N ]]> 142-156 11.3 5.1 14.1 13.8 <![CDATA[C COO-H,R ]]> 156-186 11.1 12.2 5.5 10.3 <![CDATA[C C＝O ]]> 186-230 1.1 2.4 1.0 1.4 <![CDATA[ a Aromaticity - 0.37 0.21 0.57 0.48 <![CDATA[ b Degree of lipidation - 0.63 0.79 0.43 0.52

[0120] a Aromaness = [C Ar-H,R (110-142ppm)+C Ar-O,N (142-156ppm)] / C(0-230ppm).

[0121] b Degree of lipidation = 1 - Aromaticity.

[0122] Example 4: Verification of the effects of different treatments on the conversion of low-rank coal into humic acid (CHA, MHA)

[0123] 1. Experimental Objective: This experiment used a field plot experiment to verify the effects of humic acid (CHA, MHA) extracted by two methods on maize growth and greenhouse gas emissions. CHA (CHA-L, CHA-S) is humic acid extracted from lignite and bituminous coal by alkaline dissolution and acid precipitation, while MHA (MHA-L, MHA-S) is humic acid converted from lignite and bituminous coal by the degradation of lignite and bituminous coal by strain HG14.

[0124] 2. Experimental Design: The experiment was conducted at the Henan Provincial Field Scientific Observation and Research Station for Grain Crop Nutrition and Fertilization in Suqiao Town, Xuchang City, Henan Province. The maize variety used was Zhengdan 958. A randomized block design was adopted, with 5 treatments: conventional fertilization without humic acid HA (CK) and conventional fertilization with the addition of CHA-L, MHA-L, CHA-S, and MHA-S. The plot area was 24 m². 2 (3*8m), each treatment was replicated 3 times, with a 1m isolation zone between replicates. Nitrogen, phosphorus, and potassium fertilizers were applied as base fertilizer in a single application, and humic acid was evenly spread into the soil along with the base fertilizer in a single application. The application rate of humic acid was 30 kg / hm. 2 The fertilizer used in the experiment was a compound fertilizer with a nitrogen-phosphorus-potassium formula of 30-5-5, and the application rate was 750 kg / hm². 2 The management of irrigation, weeding, and pest and disease control in the field plots is the same as the local high-yield management measures.

[0125] 3. Evaluation Indicators:

[0126] After the corn harvest, 30 corn plants were selected from each plot and dried at 60℃ to constant weight. The weight was then measured and the aboveground dry matter mass was calculated. At the same time, the number of kernels per ear, the thousand-kernel weight, and the yield were calculated.

[0127] Greenhouse gas collection and determination in soil: Gas samples were collected using a sealed static chamber. The chamber and its base frame were made of stainless steel, with the sampling port located in the center of the top. The base frame, approximately 15 cm deep, was placed before the application of basal fertilizer to the corn plant and contained corn stalks. Field sampling began after fertilization (July 2, 2024) and ended at crop harvest (September 30, 2024). Sampling was generally conducted once a week. Sampling time was from 9:00 AM to 10:00 AM. For each sampling, a 50 mL syringe was used to pump the gas back and forth eight times to ensure uniform gas distribution. 50 mL of the mixed gas was extracted from the chamber at 0, 10, 20, and 30 minutes to determine N2O and CO2 content. Simultaneously, the temperature and humidity of the top 0–10 cm soil layer were recorded. The concentration of the analyte gas was calculated using the peak areas of the standard gas and the analyte gas.

[0128] Greenhouse gas emission flux calculation:

[0129] F=ρ×H×Δc / Δt×273 / (273+T)------------Formula(1)

[0130] Where: F is the emission flux of N2O [mg / (m³)] 2 ·h)], where ρ is the gas density under standard conditions (ρ N2O =1.964kg / m 3 , ρ CO2 =1.997kg / m 3 H is the height of the sampling chamber (m); Δc is the gas concentration difference; Δt is the time interval (h); Δc / Δt is the slope of the four sampling time points; T is the temperature inside the chamber (°C) during sampling.

[0131] Soil greenhouse gas emissions (ANE) determination: N2O and CO2 emissions (Formula 2) are time-weighted by the average gas production rate over time according to the emission flux formula (Formula 1).

[0132]

[0133] In the formula: ANE represents the cumulative emissions of N2O and CO2, expressed in kg·hm². -2 ;F i and F i+1 The emission fluxes at the i-th and (i+1)-th measurements are respectively; t i+1 -t i Let d be the number of days between the i-th sampling and the (i+1)-th sampling.

[0134] 4. Test Results

[0135] Table 4. Effects of HA application on maize growth and greenhouse gas emissions.

[0136]

[0137]

[0138] Note: Different lowercase letters indicate significant differences between treatments (p<0.05).

[0139] The experimental results (Table 4) show that, compared with the control (CK) treatment, the addition of HA significantly increased the aboveground dry matter, number of grains per ear, thousand-grain weight, and yield of maize. The increases were greater with MHA-L and MHA-S compared to CHA-L and CHA-S. Conversely, the addition of HA significantly reduced the cumulative emissions of N2O and CO2. Compared with the CK treatment, the CHA-L and CHA-S treatments reduced N2O by 22.29% and 20.10%, respectively, and CO2 by 16.15% and 8.85%, respectively. The MHA-L and MHA-S treatments reduced N2O by 41.04% and 47.35%, respectively, and CO2 by 40.63% and 46.88%, respectively. This indicates that the addition of HA effectively reduces N2O and CO2 emissions from the soil, with MHA-L and MHA-S showing superior reduction effects. Therefore, it can be seen that HA can promote maize growth and increase maize yield, while reducing soil N2O and CO2 emissions. Moreover, the application of strain HG14 to degrade low-rank coal into MHA-L and MHA-S can achieve the effects of increasing yield and reducing agricultural greenhouse gas emissions.

[0140] In summary, this invention has isolated and cultured a rope-shaped basket bacterium, HG14, from low-rank coal in Yima. This bacterium can degrade low-rank coal, increase the yield and bioactivity of humic acid, and its product, humic acid, can significantly promote corn growth and reduce greenhouse gas emissions in the soil.

[0141] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A rope-shaped basket fungus ( Talaromyces funiculosus HG14, with accession number CGMCC No. 41631.

2. A microbial agent, characterized in that, Includes the cord-shaped basket bacterium HG14 as described in claim 1.

3. The application of the *H. 14* fungus of claim 1 or the fungal agent of claim 2 in the following 1) to 3); 1) Degradation of low-rank coal; 2) Degrading low-rank coal to produce humic acid; 3) Improve the yield of humic acid produced from the degradation of low-rank coal; The low-rank coal is bituminous coal and / or lignite.

4. The application according to claim 3, characterized in that, The degradation method includes liquid fermentation, during which a carbon source and inorganic salts are added.

5. The application according to claim 4, characterized in that, The carbon source includes sucrose; The inorganic salts include KNO3, K2HPO4, KH2PO4, MgSO4·7H2O and CaCl2·2H2O; Add 1.5~2.0g of sucrose, 0.3~0.5g of KNO3, 0.03~0.05g of K2HPO4, 0.1~0.15g of KH2PO4, 0.03~0.05g of MgSO4·7H2O, 0.001~0.003g of CaCl2·2H2O and 95mL of water to every 1g of coal.

6. The application according to claim 3, characterized in that, The low-rank coal also undergoes photo-oxidation before degradation.

7. A method for preparing humic acid, characterized in that, include: Humic acid is prepared by mixing the fungus HG14 as described in claim 1 or the inoculum as described in claim 2 with low-rank coal; wherein the low-rank coal is bituminous coal and / or lignite.

8. A method for degrading low-rank coal, characterized in that, include: The *H. 14* fungus of claim 1 or the inoculum of claim 2 is mixed with low-rank coal for degradation; the low-rank coal is bituminous coal and / or lignite.

9. The method according to claim 7 or 8, characterized in that, The application form of the rope-shaped basket fungus HG14 includes a single-spore suspension; the viable count of the single-spore suspension is (1~5)×10⁻⁶. 8 per mL.

10. The method according to claim 8, characterized in that, The degradation method includes liquid fermentation; during liquid fermentation, the inoculum amount of *HG14* spores is 3% to 7% of the volume of the liquid fermentation system.

11. Humic acid obtained by the method of claim 7.

12. The application of the humic acid of claim 11 in promoting maize growth and / or reducing greenhouse gas emissions during maize growth.

Images