Salt-tolerant debaryomyces hansenii for producing HDMF

Abstract

The invention discloses a salt-tolerant debaryomyces hansenii strain for producing HDMF, and belongs to the technical field of microorganisms. The debaryomyces hansenii JLFsz001 provided by the invention is a safe strain, can tolerate relatively high salt concentration, and can be used for fermentation production of HDMF under the conditions of no salt stress and salt stress. The debaryomyces hansenii JLFsz001 is applied to simulated soy sauce fermentation to produce the HDMF, the content of the HDMF in a fermentation system can be increased by 34.44%, and the debaryomyces hansenii JLFsz001 has huge application potential in the aspect of aroma enhancement of fermented food or seasonings.

Description

Technical Field

[0001] The invention relates to a salt-tolerant Debaryomyces hansenii strain producing HDMF, belonging to the technical field of microorganisms. Background Art

[0002] 4-Hydroxy-2,5-dimethyl-3 (2H)-furanone (HDMF or DMHF), trade name furaneol, also known as pineapple ketone or strawberry ketone, has a molecular formula of C6H8O3. HDMF combines the unique structural characteristics of furan and ketone and is a natural flavor ingredient with a strong caramel-like smell. It is widely distributed in fruits such as strawberries, pineapples, mangoes and raspberries. In addition, HDMF has been found in many products such as wine, coffee, beer, liquor, soy sauce and cheese. In addition, HDMF can also be isolated from certain insects and bacteria. HDMF is widely used in various industries such as food, beverages, tobacco, and cosmetics due to its low odor threshold of 160 μg / L and strong flavor enhancement properties.

[0003] Although HDMF is widely present in natural products, the natural extraction method is not suitable for mass production of HDMF due to its low content and high separation and extraction costs. Most of the HDMF sold on the market now are chemically synthesized, but the chemical synthesis of HDMF has a complex path, the product has an impure aroma, low yield, and a large amount of solvent residue, so it is not suitable for use in food, beverages and other products. In contrast, biosynthesis is widely used in food production. Compared with chemically synthesized HDMF, biosynthesized HDMF has a pure and strong aroma and is irreplaceable. Therefore, the production of natural HDMF using microbial fermentation has broad prospects.

[0004] Current studies have shown that most microorganisms that produce HDMF are Saccharomyces rouxii, while there are few studies on the use of Debaryomyces hansenii to produce HDMF, which limits the application of Debaryomyces hansenii in aroma production. Summary of the invention

[0005] The present invention provides a strain of Debaryomyces hansenii ( Debaryomyces Hansenii )JLFsz001, was deposited in Guangdong Provincial Microbiological Culture Collection Center on October 25, 2024, with the deposit number GDMCC No: 65351.

[0006] In one embodiment, the Debaryomyces hansenii JLFsz001 was isolated from a fermented soybean paste sample from a factory in Guangdong. The strain Debaryomyces hansenii was identified based on colony appearance, 26S rDNA sequencing results and biochemical identification and was named Debaryomyces hansenii JLFsz001.

[0007] The present invention also provides a microbial preparation containing the Debaryomyces hansenii JLFsz001.

[0008] In one embodiment, the microbial preparation contains living cells of Debaryomyces hansenii JLFsz001.

[0009] The present invention also provides a method for producing HDMF by fermentation using the Debaryomyces hansenii JLFsz001, wherein the Debaryomyces hansenii JLFsz001 is inoculated into a culture medium and fermented at 28-30°C.

[0010] In one embodiment, the culture medium further contains fructose.

[0011] In one embodiment, the culture medium further contains sodium chloride.

[0012] In one embodiment, the concentration of sodium chloride in the culture medium is 60 g / L to 180 g / L of sodium chloride.

[0013] In one embodiment, the method comprises: inoculating the activated Debaryomyces hansenii JLFsz001 into a seed culture medium for culture to obtain a seed liquid, and then transferring the seed liquid into a fermentation culture medium at a volume ratio of 5% for fermentation culture.

[0014] In one embodiment, the seed culture medium contains: 5 g yeast extract, 5 g tryptone, 10 g glucose, 5 g MgSO4·7 H2O, and 4 g KH2PO4.

[0015] In one embodiment, the culture conditions of the seed solution are: culture at 28-30° C. and 150-250 rpm.

[0016] In one embodiment, the fermentation medium contains: 15 g / L casein peptone, 120 g / L fructose, 5 g / L MgSO4·7 H2O, and 4 g / L KH2PO4.

[0017] In one embodiment, the culture conditions of the fermentation medium are 30° C., 150 rpm for 11 days.

[0018] In one embodiment, the fermentation medium is supplemented with D-fructose at a content of 120 g / L.

[0019] The present invention also provides the use of the Debaryomyces hansenii JLFsz001 or the microbial agent in preparing fermented seasonings.

[0020] In one embodiment, the condiment includes but is not limited to soy sauce.

[0021] The present invention also provides the use of the Debaryomyces hansenii JLFsz001 or the microbial agent in the preparation of 4-hydroxy-2,5-dimethyl-3(2H)-furanone (HDMF) or a product containing HDMF.

[0022] In one embodiment, the product includes, but is not limited to, a food additive.

[0023] Beneficial effects: (1) The present invention screened and obtained a strain of Debaryomyces hansenii JLFsz001, which does not produce hemolysis and is a strain that meets food safety requirements.

[0024] (2) The Debaryomyces hansenii JLFsz001 provided by the present invention has strong salt tolerance and can tolerate a salt concentration of 18%, and can be used for the fermentation of condiments in a salty environment.

[0025] (3) The Debaryomyces hansenii JLFsz001 provided by the present invention has the ability to produce HDMF. The HDMF yield under no salt stress conditions is 25.56±0.33 mg / L; the HDMF yields under 6%, 12%, and 18% salt stress conditions are 20.2±0.51 mg / L, 24.0±0.54 mg / L, and 20.57±0.3 mg / L, respectively.

[0026] (4) The Debaryomyces hansenii JLFsz001 provided by the present invention can effectively adapt to the fermentation environment of soy sauce mash and increase the HDMF content in the soy sauce mash. In a simulated soy sauce fermentation system, the HDMF content in the fermentation system can be increased by 34.44%.

[0027] Biomaterial Deposit Debaryomyces hansenii ( Debaryomyces Hansenii )JLFsz001, taxonomic name is Debaryomyces Hansenii , was deposited in the Guangdong Provincial Microbiological Culture Collection Center on October 25, 2024, with the deposit number GDMCC No: 65351, and the deposit address is Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the colony morphology of Debaryomyces hansenii JLFsz001.

[0029] Figure 2 This is a microscopic morphological picture of Debaryomyces hansenii JLFsz001.

[0030] Figure 3 This is the phylogenetic tree of Debaryomyces hansenii JLFsz001.

[0031] Figure 4 This is the result of the hemolysis experiment of Debaryomyces hansenii JLFsz001.

[0032] Figure 5 This is the extreme salt tolerance result of Debaryomyces hansenii JLFsz001.

[0033] Figure 6 This is the liquid chromatogram of HDMF standard.

[0034] Figure 7 is the standard curve of HDMF.

[0035] Figure 8 This is a liquid chromatogram of HDMF production by Debaryomyces hansenii JLFsz001.

[0036] Fig. 9 This is the liquid chromatogram of HDMF produced by Debaryomyces hansenii JLFsz001 under salt stress conditions.

[0037] Fig.10 The figure shows the production results of HDMF produced by Debaryomyces hansenii JFsz001 under different fermentation time and salt concentration conditions; different lowercase letters represent the difference of HDMF content in each group under different fermentation time, and different uppercase letters represent the difference of HDMF content under different salt concentrations at the same time; different letters represent significant difference in HDME content ( p <0.05).

[0038] Fig.11 This is the result of HDMF production by Debaryomyces hansenii JLFsz001 in a simulated soy sauce fermentation environment. DETAILED DESCRIPTION

[0039] Culture medium: Potato dextrose agar (PDA) medium: 300.0 g potato, 20.0 g glucose, 15.0 g agar, 0.1 g chloramphenicol, add 1 L sterile water, stir and heat to boil until completely dissolved, and autoclave at 121°C for 15 min.

[0040] YPD / YEPD medium: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose; if making solid culture medium, add 2% agar powder and autoclave at 121°C for 15 min.

[0041] Seed culture medium: 5 g yeast extract, 5 g tryptone, 10 g glucose, 5 g MgSO4·7H2O, 4 g KH2PO4, 1 L distilled water; autoclave at 121°C for 15 min.

[0042] Fermentation medium: casein peptone 15 g, fructose 120 g, MgSO4·7H2O 5 g, KH2PO4 4 g, sodium chloride, distilled water 1 L; autoclave at 121°C for 15 min.

[0043] Example 1: Isolation, purification and identification of strains 1. Isolation of strains: (1) Sample source: The mash samples were collected from a soy sauce brewery in Guangdong. After collection, the samples were sealed in sterile sampling bottles and refrigerated at 4°C for later use.

[0044] (2) Sample enrichment culture: Weigh 10 g of the mash sample into a sterilized conical flask, add 90 mL of sterile saline, and shake on a shaker for 30 min.

[0045] (3) Dilution and coating: Use sterile saline to dilute the enriched mash sample at different gradient concentrations, with the concentration gradient set at 10 -1 -10 -7 , isolate and culture yeast. Take 0.1 mL of diluted bacterial solution and spread it evenly on the surface of PDA solid culture medium, use sterile distilled water as blank, and culture at 30℃ for 48-72 h. Set up three parallels for each sample.

[0046] (4) Purification of strains: After obvious colonies have grown on the plate, observe the colony morphology and color on the plate, and mark and record the single colonies with typical yeast characteristics. Then use an inoculation loop to pick a single colony and streak it on the plate for 3-5 consecutive subcultures until a pure single colony is obtained. The colony morphology of strain JLFsz001 is shown in Figure 1 .

[0047] 2. Identification of strains: The purified strains were identified in terms of morphological characteristics, physiological and biochemical characteristics, and molecular biology.

[0048] The strain was spread on PDA agar medium and the morphological characteristics of the colonies were observed after 3 days of culture. The purified colonies were picked and prepared for slides. The slides were stained with Lu's alkaline methylene blue stain (1%). After about 3 minutes, the morphology and budding of the strains were observed with a low-power microscope and then with a high-power microscope, and the dead and live cells were distinguished by color. After 0.5 h of staining, the staining was repeated to observe whether the number of dead cells increased. The microscopic examination results of strain JLFsz001 are shown in Figure 2 .

[0049] 3. Molecular biology identification: (1) According to the growth characteristics and origin of the strain, 26S rRNA was used for identification. The primers were: NL 1:GCATATCAATAAGCGGAGGAAAAG; NL 4: GGTCCGTGTTTCAAGACGG.

[0050] The PCR reaction system (20 μL in total) includes: 1 μL bacterial solution; 10 μL enzyme; 1 μL NL 1 primer; 1 μL NL 4 primer; 7 μL ddH2O.

[0051] (2) Add the above amplification system into the PCR tube in sequence, centrifuge to mix, place in the PCR instrument, and amplify according to the following procedure: Pre-denaturation at 98°C for 10 min, denaturation at 98°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 20 s, 30 cycles; extension at 72°C for 20 min; end at 12°C ∞; (3) Gel electrophoresis verification: After PCR amplification, 3 μL of PCR product was thoroughly mixed with 1 μL of 6× Loading Buffer, loaded onto a 1% agarose gel, and electrophoresed at a constant voltage of 150 V for 30 min. Using 2 K Marker as a reference, the yeast 26S rDNA target fragment was considered successful if its length was about 300 bp.

[0052] (4) Sequencing: The refrigerated PCR products were sent to Shanghai Bioengineering Co., Ltd. for sequencing.

[0053] The sequencing results were compared with the National Center for Biotechnology Information (NCBI) database using BLAST. According to the comparison results, the 26S rDNA sequences of the relevant model strains were downloaded from NCBI, and the MEGA 11 software was used to align them and construct the strain phylogenetic tree, as shown in Figure 1. Figure 3 As shown, the strain obtained by screening was identified as Debaryomyces hansenii ( Debaryomyces hansenii ), named Debaryomyces hansenii JLFsz001.

[0054] Example 2: Safety evaluation of strain JLFsz001 Spread the bacterial solution stored at -20℃ on YPD liquid medium and invert it at 30℃ for 48 hours. When selectable colonies grow on the plate, use an inoculation loop to pick the colonies and draw lines on Columbia blood agar plates. Incubate at 30℃ for 48 hours. Use Staphylococcus aureus as a positive control to observe whether strain JLFsz001 has hemolysis.

[0055] The results are as follows Figure 4 As shown, the screened strain JLFsz001 grew normally on the Columbia blood agar plate culture medium, and the agar around the strain did not show green and no transparent circle appeared, indicating that no hemolysis occurred; while the positive control strain grew normally on the Columbia blood agar plate culture medium, and the agar around the strain showed green and a transparent circle appeared, indicating that the control strain had hemolysis; the safety experiment results showed that the screened strain JLFsz001 was not a hemolytic strain.

[0056] Example 3: Study on the physiological and biochemical characteristics of strain JLFsz001 Take the activated strain in the logarithmic growth phase and inoculate it into YPD liquid medium with a salt content of 12% to make the OD 600 nm = 0.6~0.8, shake culture at 30℃ for 48 h, measure OD 600 nm The absorbance value at . The growth efficiency of the strain was used as the ordinate and the salt concentration as the abscissa. The salt tolerance growth efficiency of the strain was calculated according to the formula. Three parallel experiments were set up. The calculation formula is as follows: Growth efficiency (%) = (absorbance value of 12% salt concentration bacterial solution - absorbance value of blank) / (absorbance value of salt-free culture medium - absorbance value of blank) × 100.

[0057] The growth efficiency of Debaryomyces hansenii JLFsz001 = (2.87-0.1) / (4.49-0.1) = 63.05±1.69%.

[0058] Example 4: Study on the extreme salt tolerance concentration of strain JLFsz001 This experiment uses the solid plate method to explore the extreme salt tolerance concentration of strain JLFsz001. With reference to the literature, appropriate modifications were made to explore the extreme salt tolerance of Debaryomyces hansenii JLFsz001, which has a certain tolerance under 18% salt concentration. YPD solid medium with a salt concentration of 190 g / L~360 g / L and a concentration gradient of 30 g / L was prepared. The Debaryomyces hansenii JLFsz001 culture liquid activated to the logarithmic phase was evenly spread on the medium and cultured at 30°C. The maximum salt concentration and appearance time of colonies cultured by each strain were recorded to approximately obtain the extreme salt tolerance concentration of the strain. The experiment was set up in three parallels.

[0059] The results show that ( Figure 5 ), the strain was able to grow on plates with a salt concentration of 240 g / L.

[0060] Example 5: Detection of HDMF and establishment of standard curve Accurately weigh 0.01 g of HDMF standard and dilute it with methanol in a 5 mL volumetric flask to prepare a 2 mg / L concentration solution. Accurately measure an appropriate amount of the above solution and dilute it to prepare 1, 2, 4, 8, 10, 20, and 40 mg / L HDMF standard solutions, and draw a standard curve between HDMF concentration and peak area.

[0061] Liquid chromatography conditions: analytical high pressure liquid; UV detector; C18 liquid chromatography column (250 mm×4.6 mm, 5 μm); detection wavelength 285 nm; injection volume 20 μL; flow rate 1.0 mL / min.

[0062] The HPLC results of HDMF standard are shown in Figure 6 , the standard curve of HDMF is shown in Figure 7 .

[0063] Example 6: Fermentation of HDMF by strain JLFsz001 Fermentation was carried out as follows: (1) Activation of bacterial strains and seed culture: The strain JLFsz001 stored in a -80°C refrigerator was inoculated into a YPD liquid culture tube and cultured at 30°C and 150 r / min for 48 h to obtain the OD 600 nm = 0.6~0.8, and then transfer it to a seed culture medium with a liquid volume of 30 mL, and culture it at 30℃ and 150 r / min for 24 h to obtain the seed solution.

[0064] (2) Fermentation culture: Take the activated strain in the logarithmic growth phase and transfer the seed liquid to the fermentation medium at a 5% inoculation rate so that the OD after inoculation is 600 nm =0.6~0.8, culture at 30℃, 150 r / min for 11 d, and the liquid volume was 100 mL.

[0065] (3) Fermentation broth pretreatment: Take 2 mL of fermentation broth and place it in a centrifuge tube. Centrifuge it at 8000 r / min and 4°C for 10 min. Then filter the supernatant through a 0.45 μm filter membrane and analyze it on an analyzer.

[0066] The HPLC results of HDMF produced by strain JLFsz001 are shown in Figure 8 The results showed that the HDMF production of strain JLFsz001 after 23 days of fermentation was 34.09±0.2 mg / L.

[0067] Example 6: Fermentation production of HDMF under salt stress conditions Fermentation was carried out as follows: (1) Activation of bacterial strains and seed culture: The strain JLFsz001 stored in a -80°C refrigerator was inoculated into a YPD liquid culture tube and cultured at 30°C and 150 r / min for 48 h to obtain the OD 600 nm = 0.6~0.8, transfer it to the seed culture medium, culture at 30℃, 150 r / min for 24 h, and the liquid volume is 30 mL.

[0068] (2) Fermentation culture: Take the activated strain in the logarithmic growth phase from the seed culture medium, inoculate the seed liquid into 100 mL of fermentation medium with salt contents of 0%, 60 g / L, 120 g / L, and 180 g / L respectively according to the inoculation amount of 5%, and make the OD after inoculation 600 nm =0.6~0.8, 30℃, 150 r / min shaking culture. During the culture period, sampling pretreatment was performed at 2 d, 5 d, 8 d, 11 d, 14 d, 17 d, and 23 d, and the samples were tested on the machine. Three parallel experiments were set up.

[0069] (3) Detection of HDMF content in fermentation broth: Take 2 mL of fermentation broth and place it in a centrifuge tube. Centrifuge it at 8000 r / min for 10 min. Then filter the supernatant through a 0.45 μm filter membrane and detect it on an analyzer.

[0070] The HPLC results of HDMF production by strain JLFsz001 under salt stress are shown in Fig. 9 The results of HDMF production by strain JLFsz001 under different fermentation times and salt stress conditions are shown in Fig.10 The results showed that the HDMF production of strain JLFsz001 was 29.6±1.2 mg / L after 8 days of fermentation in a medium with a salt concentration of 60 g / L; the HDMF production was 28.27±0.35 mg / L after 11 days of fermentation in a medium with a salt concentration of 120 g / L; and the HDMF production was 29.34±0.55 mg / L after 23 days of fermentation in a medium with a salt concentration of 180 g / L.

[0071] Example 8: Fermentation of strains to produce HDMF in a simulated soy sauce fermentation system The production of HDMF in actual soy sauce brewing was studied by using the soy sauce mash simulation strain JLFsz001 which was preserved and fermented for 30 days in the laboratory.

[0072] Preparation of simulated soy sauce fermentation system: The simulated fermented soy sauce system was prepared by adding 18% brine and 120 g / L fructose in a volume ratio of 1:1 to the fermented soy sauce mash stored in the laboratory for 30 days.

[0073] The strain JLFsz001 was inoculated into a simulated soy sauce fermentation system containing 120 g / L fructose and fermented at 30°C for 23 days. The same amount of pure culture medium was inoculated into a simulated soy sauce fermentation system containing 120 g / L fructose as a control. The HDMF content at 23 days of fermentation was detected, and the results showed that ( Fig.11 ), strain JLFsz001 can increase the HDMF content in the fermentation system by 34.44%.

[0074] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. Debaryomyces hansenii ( Debaryomyces Hansenii )JLFsz001, was deposited in Guangdong Provincial Microbiological Culture Collection Center on October 25, 2024, with the deposit number GDMCC No: 65351.

2. A microbial preparation containing the Debaryomyces hansenii JLFsz001 according to claim 1.

3. The microbial preparation according to claim 2, characterized in that The microbial preparation contains living cells of the Debaryomyces hansenii JLFsz001.

4. A method for preparing 4-hydroxy-2,5-dimethyl-3(2H)-furanone by fermentation, characterized in that: The Debaryomyces hansenii JLFsz001 of claim 1 is inoculated into a culture medium and fermented at 28-30°C.

5. The method according to claim 4, characterized in that The medium also contained D-fructose.

6. The method according to claim 4 or 5, characterized in that: The medium also contained sodium chloride.

7. Use of the Debaryomyces hansenii JLFsz001 according to claim 1 or the microbial preparation according to any one of claims 2 to 3 in the preparation of fermented seasonings.

8. The use according to claim 7, characterized in that: The condiment includes soy sauce.

9. Use of the Debaryomyces hansenii JLFsz001 according to claim 1 or the microbial preparation according to any one of claims 2 to 3 in the preparation of 4-hydroxy-2,5-dimethyl-3(2H)-furanone or a product containing 4-hydroxy-2,5-dimethyl-3(2H)-furanone.

10. The use according to claim 9, characterized in that: The product comprises a food additive.

Images