Preparation and instantaneous conversion method of butterfly orchid petal protoplast

Abstract

The invention belongs to the technical field of biology, and particularly relates to a preparation and instantaneous conversion method of butterfly orchid petal protoplast. Specifically, the invention provides a preparation method of the petal protoplast of the Phalaenopsis orchid, and the petal protoplast of the Phalaenopsis orchid can be used for preparing the petal protoplast of the Phalaenopsis orchid. The activity of the protoplast prepared by the invention can reach 95.67 + / -0.7%, the transformation efficiency of the protoplast can reach 69.48 + / -6.5%, and the protoplast has important basis and significance for subsequent gene function research and genetic character improvement research of phalaenopsis amabilis.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for preparing and instantaneously transforming protoplasts of Phalaenopsis petals. Background Art

[0002] Phalaenopsis orchid is a perennial plant belonging to the genus Phalaenopsis in the orchid family. Due to its beautiful flower shape and high ornamental value, it has become one of the most popular fresh cut flowers and potted flowers in the world. Phalaenopsis breeding currently relies mainly on traditional hybrid breeding, focusing on the improvement of flower shape, flower color and flower fragrance. At present, although some strains with excellent traits have been selected, in some successful hybrid breeding cases, due to factors such as the incompatibility of hybridization of fragrant and odorless species, the smell of their offspring is diluted or loses its smell. In recent years, with the development of Phalaenopsis functional genomics, molecular breeding has great development potential because it can improve a certain trait in a targeted manner. However, the genetic transformation system of Phalaenopsis is not yet mature, and the genetic transformation cycle is long, which greatly restricts the research progress of its related gene functions.

[0003] Plant protoplasts are cells wrapped in plasma membranes obtained by decomposing plant cell walls. Protoplasts can directly absorb exogenous DNA, and transient expression technology using protoplasts has been widely used in studies such as protein localization, protein interaction, gene editing, and gene function identification. However, since the protoplast preparation methods and conditions vary depending on the species and material type, the separation and transformation methods need to be optimized and redeveloped for specific species. However, there is currently a lack of efficient separation and transformation methods for Phalaenopsis protoplasts.

[0004] Therefore, it is urgent to establish a new and efficient method system for isolating and transforming Phalaenopsis petal protoplasts, which will provide an efficient technical means for verifying the gene function and expression regulation related to Phalaenopsis fragrance and color, and provide a stable platform for establishing Phalaenopsis gene editing technology. Summary of the invention

[0005] In order to solve the problems existing in the prior art, the purpose of the present application is to provide a method for preparing and transiently transforming Phalaenopsis petal protoplasts.

[0006] In order to achieve the above purpose, this application adopts the following specific scheme:

[0007] In one aspect, the present disclosure provides a method for preparing protoplasts of Phalaenopsis orchid petals, comprising the following steps:

[0008] (1) Take Phalaenopsis orchid petals, clean and disinfect them;

[0009] (2) Cut the petals after disinfection into thin strips and soak them in a mannitol solution away from light;

[0010] (3) transferring the filaments soaked in step (2) into the enzymatic solution and placing them in a vacuum desiccator away from light for permeation;

[0011] (4) taking the infiltrated filaments from step (3) and placing them in a low-speed shaking table away from light to continue enzymatic hydrolysis, thereby obtaining an enzymatic hydrolyzate containing petal protoplasts;

[0012] (5) The enzymatic hydrolyzate obtained in step (4) was diluted with W5 solution, filtered, and the filtrate was centrifuged at low speed, the supernatant was discarded, and the protoplast pellet was resuspended with W5 solution. After low speed centrifugation again, the supernatant was discarded, and the protoplast pellet was resuspended with MMG solution.

[0013] On the other hand, the present disclosure provides a method for transforming Phalaenopsis petal protoplasts, characterized in that the protoplasts prepared by the aforementioned method include the following steps:

[0014] The plasmid and protoplast cells were mixed, PEG solution was added, and incubated at room temperature in the dark;

[0015] After incubation, W5 solution was added to the solution, and the PEG solution was removed by centrifugation;

[0016] The centrifuged solution was resuspended by adding WI solution, placed horizontally in an incubator, kept away from light for 16-24 hours, and the protoplasts were collected by centrifugation.

[0017] The beneficial effects of this application are at least as follows:

[0018] The present invention establishes an efficient and convenient method for isolating Phalaenopsis petal protoplasts for the first time by adjusting and optimizing the osmotic pressure, enzyme hydrolysate concentration, and the ratio of enzyme hydrolysate to petal mass. The experimental results show that the yield of protoplasts prepared by the present invention is 9.0±1.5(10 5 / g FW), the vitality can reach 95.67±0.7%, and the protoplast transformation efficiency can reach 69.48±6.5%. The performance of protoplasts has been greatly improved, which has important foundation and significance for the subsequent gene function research and genetic trait improvement research of Phalaenopsis. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the process of isolating protoplasts from Phalaenopsis petals. Figure 1 A is the petal selected as the experimental material; Figure 1 B is petals cut into thin strips; Figure 1 C is to put the petal filaments into the enzymatic solution and then evacuate; Figure 1 D is the petal filament that can release protoplasts after 4 h of enzymatic hydrolysis; Figure 1E is the enzymatic hydrolysate collected after filtration to remove undigested petal tissue; Figure 1 F is the protoplast precipitate collected by centrifugation; Figure 1 G is the protoplasts suspended in MMG solution examined under white light.

[0020] Figure 2 The FDA-stained protoplasts observed under a fluorescence microscope in Example 1.

[0021] Figure 3 These are the fluorescence detection results of protoplasts transformed with 5 μg, 10 μg and 15 μg of pUC57_ZmUbi:GFP plasmid in Example 2, respectively.

[0022] Figure 4 This is the result of RT-PCR detection of the transformed CRISPR transcription activation element reporter system in Example 3. Figure 4 A is a schematic diagram of the components of the CRISPR transcription activation element reporter system; Figure 4 B is the expression of GFP transcript after transcriptional activation detected by RT-PCR. DETAILED DESCRIPTION

[0023] I. Terminology

[0024] In order to make the present disclosure more easily understood, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meaning commonly understood by those skilled in the art to which the present disclosure belongs.

[0025] As used herein, the articles "a" and "an" refer to one or more than one (ie, at least one) of the grammatical object to which the article refers. For example, "an element" means one element or more than one element.

[0026] The term "and / or" should be understood to mean either or both of the alternatives.

[0027] The terms “comprising” or “including” generally imply the inclusion of explicitly stated features, but not the exclusion of other elements.

[0028] The term "about" generally refers to a variation within a range of 0.5%-10% above or below a specified value, for example, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below a specified value.

[0029] As used herein, the expressions "cell," "cell line," and "cell culture" are used interchangeably, and all such names include progeny thereof. Thus, the words "transformants" and "transformed cells" include the primary subject cell and cultures derived therefrom, without regard to the number of transfers. It should also be understood that all progeny may not be exactly identical in terms of DNA content, due to intentional or unintentional mutations. Mutant progeny having the same function or biological activity as screened for in the originally transformed cell are included. Where different names are intended, this is clear from the context.

[0030] "Optional" or "optionally" means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and where it does not occur.

[0031] As used herein, the term "plant" includes the whole plant and any offspring, cells, tissues, or parts of the plant. The term "plant part" includes any part of a plant, including, for example but not limited to: seeds (including mature seeds, immature embryos without seed coats, and immature seeds); plant cuttings; plant cells; plant cell cultures; plant organs (e.g., pollen, embryos, flowers, fruits, buds, leaves, roots, stems, and related explants). Plant tissues or plant organs can be seeds, callus, or any other plant cell colonies organized into structural or functional units. Plant cells or tissue cultures can regenerate plants with the physiological and morphological characteristics of the plant from which the cell or tissue is derived, and can regenerate plants with substantially the same genotype as the plant. In contrast, some plant cells can no longer produce plants. The regenerable cells in plant cell or tissue culture can be embryos, protoplasts, meristems, callus, pollen, leaves, anthers, roots, root tips, silk, flowers, kernels, ears, cobs, husks, or stems.

[0032] Plant parts include harvestable parts and parts that can be used to propagate offspring plants. Plant parts that can be used for propagation include, for example, but are not limited to: seeds; fruits; cuttings; seedlings; tubers; and stock. The harvestable parts of a plant can be any useful part of a plant, including, for example, but not limited to: flowers; pollen; seedlings; tubers; leaves; stems; fruits; seeds; and roots.

[0033] Plant cell is the structural and physiological unit of plant.As used herein, plant cell comprises protoplast and protoplast with part cell wall.Plant cell can be in the form of single cell or cell aggregate (for example, loose callus and cultured cell) of separation, and can be a part of higher organization unit (for example, plant tissue, plant organ and plant).Therefore, plant cell can be protoplast, produce gamete cell, or can be regenerated into the cell of complete plant or the collection of cell.Therefore, in the embodiment of this paper, the seed that comprises a plurality of plant cells and can be regenerated into whole plant is considered as a kind of " plant part ".

[0034] The term "protoplast" refers to a plant cell whose cell wall has been completely or partially removed, exposing its lipid bilayer membrane. Typically, a protoplast is an isolated plant cell without a cell wall that has the potential to regenerate into a cell culture or a whole plant.

[0035] The term "promoter" refers to a nucleic acid fragment that can control the transcription of another nucleic acid fragment. In some embodiments of the present invention, the promoter is a promoter that can control the transcription of a gene in a plant cell, whether or not it is derived from a plant cell. The promoter can be a constitutive promoter or a tissue-specific promoter or a developmentally regulated promoter or an inducible promoter.

[0036] "Constitutive promoter" refers to a promoter that will generally cause a gene to be expressed in most cell types under most circumstances. "Tissue-specific promoter" and "tissue-preferred promoter" are used interchangeably and refer to a promoter that is expressed primarily, but not necessarily exclusively, in one tissue or organ, and may also be expressed in one specific cell or cell type. "Developmentally regulated promoter" refers to a promoter whose activity is determined by developmental events. "Inducible promoter" selectively expresses an operably linked DNA sequence in response to endogenous or exogenous stimuli (environmental, hormonal, chemical signals, etc.).

[0037] As used herein, the term "operably linked" refers to the connection of a regulatory element (e.g., but not limited to, a promoter sequence, a transcription termination sequence, etc.) to a nucleic acid sequence (e.g., a coding sequence or an open reading frame) such that transcription of the nucleotide sequence is controlled and regulated by the transcription regulatory element. Techniques for operably linking a regulatory element region to a nucleic acid molecule are known in the art.

[0038] "Introducing" a nucleic acid molecule (e.g., a plasmid, a linear nucleic acid fragment, RNA, etc.) or a protein into a plant refers to transforming a plant cell with the nucleic acid or protein so that the nucleic acid or protein can function in the plant cell. "Transformation" as used in the present invention includes stable transformation and transient transformation.

[0039] The term "stable transformation" refers to the introduction of an exogenous nucleotide sequence into a plant genome, resulting in stable inheritance of the exogenous gene. Once stably transformed, the exogenous nucleic acid sequence is stably integrated into the genome of the plant and any successive generations thereof.

[0040] The term "transient transformation" refers to the introduction of a nucleic acid molecule or protein into a plant cell to perform a function without the foreign gene being stably inherited. In transient transformation, the foreign nucleic acid sequence is not integrated into the plant genome.

[0041] The term "genome" refers to the entire complement of genetic material (genes and non-coding sequences) present in every cell or virus or organelle of an organism, and / or the complete set of chromosomes inherited as a unit (haploid) from one parent.

[0042] The term "gene editing" refers to strategies and techniques for targeted specific modification of any genetic information or genome of a living organism. Therefore, the term includes editing of gene coding regions, but also includes editing of regions other than gene coding regions of the genome. It also includes editing or modifying the nucleus (if present) and other genetic information of the cell.

[0043] The term "CRISPR" refers to a technology for sequence-specific genetic manipulation that relies on the Clustered Regularly Interspaced Short Palindromic Repeats pathway, which is distinct from RNA interference in regulating gene expression at the transcriptional level.

[0044] The terms "guide RNA" and "gRNA" are used interchangeably herein to refer to a guide RNA sequence for targeting a specific gene for correction using CRISPR technology, usually composed of crRNA and tracrRNA molecules that are partially complementary to form a complex, wherein crRNA contains a sequence that is sufficiently complementary to the target sequence to hybridize with the target sequence and guide the CRISPR complex (Cas9+crRNA+tracrRNA) to specifically bind to the target sequence. However, it is known in the art that a single guide RNA (sgRNA) can be designed that contains the features of both crRNA and tracrRNA.

[0045] The terms "single guide RNA" and "sgRNA" are used interchangeably herein and refer to the synthetic fusion of two RNA molecules, wherein a crRNA (CRISPR RNA) containing a variable targeting domain (connected to a tracr pairing sequence that hybridizes to the tracrRNA) is fused to a tracrRNA (trans-activating CRISPR RNA). The sgRNA may comprise a crRNA or crRNA fragment of a type II CRISPR / Cas system that can form a complex with a type II Cas endonuclease and a tracrRNA or tracrRNA fragment, wherein the guide RNA / Cas endonuclease complex can guide the Cas endonuclease to a DNA target site, such that the Cas endonuclease can recognize, optionally bind to, and optionally nick or cut (introduce single-strand or double-strand breaks) the DNA target site.

[0046] The term "Cellulase R10" is Cellulase R10.

[0047] The term "Macerozyme R10" is pectinase R10.

[0048] The term "MES" is the abbreviation of 2-(N-Morpholino)ethanesulfonic acid, which contains a morpholine ring and an ethanesulfonic acid group, and its molecular formula is C6H 13 NO4S.

[0049] The term "W5 solution" is a solution commonly used for culturing plant protoplasts, and the formula of the W5 solution used in the present disclosure is 154 mM NaCl, 125 mM CaCl2, 5 mM KCl, and 2 mM MES.

[0050] The term "MMG solution" is also a solution commonly used in protoplast-related experiments, which is mainly prepared by mixing mannitol, magnesium chloride (MgCl2) and 2-(N-morpholino)ethanesulfonic acid (MES) in a certain proportion. The formula of the MMG solution used in the present disclosure is 0.4M mannitol, 15mM MgCl2, 4mM MES, and the pH is adjusted to 5.7.

[0051] The term "WI solution" is also a solution commonly used in protoplast transformation experiments. The formula of the WI solution used in the present disclosure is 0.5 M mannitol, 20 mM KCl, 4 mM MES, and the pH is 5.7.

[0052] II. Detailed description of specific implementation scheme

[0053] In one aspect, the present disclosure provides a method for preparing protoplasts of Phalaenopsis orchid petals, comprising the following steps:

[0054] (1) Take Phalaenopsis orchid petals, clean and disinfect them;

[0055] (2) Cut the petals after disinfection into thin strips and soak them in a mannitol solution away from light;

[0056] (3) transferring the filaments soaked in step (2) into the enzymatic solution and placing them in a vacuum desiccator away from light for permeation;

[0057] (4) taking the infiltrated filaments from step (3) and placing them in a low-speed shaking table away from light to continue enzymatic hydrolysis, thereby obtaining an enzymatic hydrolyzate containing petal protoplasts;

[0058] (5) The enzymatic hydrolyzate obtained in step (4) was diluted with W5 solution, filtered, and the filtrate was centrifuged at low speed, the supernatant was discarded, and the protoplast pellet was resuspended with W5 solution. After low speed centrifugation again, the supernatant was discarded, and the protoplast pellet was resuspended with MMG solution.

[0059] In some embodiments, the Phalaenopsis orchid petals are selected from petals in good condition during the blooming period, or sepals in good condition during the blooming period. The petals in the present disclosure include corolla and sepal.

[0060] In some embodiments, the specific process of cleaning and disinfection in step (1) is: rinse the petals with water, then soak the petals in 70% alcohol for 30 seconds, soak the petals in 0.1% mercuric chloride for 5-6 minutes, rinse the petals with sterile water and absorb the moisture.

[0061] In some embodiments, the concentration of mannitol in step (2) is 0.1-1 M. In some embodiments, the concentration of mannitol can be 0.1M, 0.2M, 0.3M, 0.4M, 0.5M, 0.6M, 0.7M, 0.8M, 0.9M, 1M.

[0062] In some embodiments, the concentration of mannitol in step (2) is 0.2-0.6M.

[0063] In some embodiments, the concentration of mannitol in step (2) is 0.4M.

[0064] In some embodiments, the light-proof immersion time in step (2) is 15-45 minutes.

[0065] In some embodiments, the light-proof immersion time in step (2) is 30 minutes.

[0066] In some embodiments, the preparation method of the enzymatic hydrolysis solution is: 1%-5% (w / v) Cellulase R10, 0.1%-1% (w / v) Macerozyme R10, 0.1-1M mannitol, 10-30mM MES (pH=5.7) and 5-15mM KCl are mixed, in a 55°C water bath for 10 minutes, cooled to room temperature, and 5-15mM CaCl2, 0.1%-0.5% (w / v) BSA, and 1-5mM β-mercaptoethanol are added to obtain the enzymatic hydrolysis solution.

[0067] In some embodiments, the preparation method of the enzymatic hydrolysate is: 1%-3% (w / v) Cellulase R10, 0.5%-1% (w / v) Macerozyme R10, 0.5-1M mannitol, 15-25mM MES (pH=5.7) and 7-13mM KCl are mixed, in a 55°C water bath for 10 minutes, cooled to room temperature, and 7-13mM CaCl2, 0.1% (w / v) BSA, and 3mM β-mercaptoethanol are added to obtain the enzymatic hydrolysate.

[0068] In some embodiments, the preparation method of the enzymatic hydrolysis solution is: mix 1% (w / v) Cellulase R10, 0.7% (w / v) Macerozyme R10, 0.6M mannitol, 20mM MES (pH=5.7) and 10mM KCl, place in a 55°C water bath for 10 minutes, cool to room temperature, and add 10mM CaCl2, 0.1% (w / v) BSA, and 3mM β-mercaptoethanol to obtain the enzymatic hydrolysis solution.

[0069] In some embodiments, the weight / volume ratio of petals to enzymatic hydrolysate in step (3) is 1:(5-15).

[0070] In some embodiments, the weight / volume ratio of the petals to the enzymatic hydrolysate in step (3) can be 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14 or 1:15. In some embodiments, the weight / volume ratio of the petals to the enzymatic hydrolysate in step (3) is 1:10.

[0071] In some embodiments, the specific process of step (3) is: transferring the filaments soaked in step (2) into the enzymatic hydrolysis solution, the weight / volume ratio of the filaments and the enzymatic hydrolysis solution is 1:10, placing the enzymatic hydrolysis solution containing the filaments in a vacuum dryer, setting the pressure to -0.06Mpa, and infiltrating for 1 hour under dark conditions.

[0072] In some embodiments, the enzymatic hydrolysis time in step (4) is 2-6 hours.

[0073] In some embodiments, the enzymolysis time in step (4) can be 2h, 3h, 4h, 5h, 6h. In some embodiments, the enzymolysis time in step (4) is 4h.

[0074] In some embodiments, the rotation speed of the horizontal shaker in step (4) is 20-80 rpm.

[0075] In some embodiments, the rotation speed of the horizontal shaking table in step (4) can be 20 rpm, 30 rpm, 40 rpm, 50 rpm, 60 rpm, 70 rpm, 80 rpm. In some embodiments, the rotation speed of the horizontal shaking table in step (4) is 50 rpm.

[0076] In some embodiments, the formula of W5 solution in step (5) is: 100-200mM NaCl, 100-150mM CaCl2, 3-7mM KCl and 1-3mM MES. In some embodiments, the concentration of NaCl can be 100mM, 110mM, 120mM, 130mM, 140mM, 150mM, 160mM, 170mM, 180mM, 190mM, 200mM. In some embodiments, the concentration of CaCl2 can be 100mM, 110mM, 120mM, 130mM, 140mM, 150mM. In some embodiments, the concentration of KCl can be 4mM, 5mM, 6mM. In some embodiments, the concentration of MES can be 1mM, 2mM, 3mM.

[0077] In some embodiments, the formula of W5 solution in step (5) is: 120-180 mM NaCl, 120-130 mM CaCl2, 4-6 mM KCl and 1-3 mM MES.

[0078] In some embodiments, the formula of W5 solution in step (5) is: 154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 2 mM MES.

[0079] In some embodiments, the formula of the MMG solution in step (5) is: 0.2-0.6 M mannitol, 10-20 mM MgCl2, 2-6 mM MES, and the pH is adjusted to 5-6.

[0080] In some embodiments, the formula of the MMG solution in step (5) is: 0.3-0.5 M mannitol, 12-18 mM MgCl2, 3-5 mM MES, and the pH is adjusted to 5-6.

[0081] In some embodiments, the formula of the MMG solution in step (5) is: 0.4 M mannitol, 15 mM MgCl2, 4 mM MES, and the pH is adjusted to 5.7.

[0082] In some embodiments, the method comprises the following steps:

[0083] (1) Rinse the petals with water, soak them in 70% alcohol for 30 seconds, soak them in 0.1% mercuric chloride for 5-6 minutes, rinse them with sterile water for 3 times and dry them;

[0084] (2) Cut the petals into uniform filaments of about 1 mm after disinfection and soak them in 0.4 M mannitol solution in the dark for 30 min;

[0085] (3) transferring the filaments soaked in step (2) into the enzymatic hydrolysis solution, wherein the weight / volume ratio of the filaments to the enzymatic hydrolysis solution is 1:10, placing the enzymatic hydrolysis solution containing the filaments in a vacuum desiccator, setting the pressure to -0.06 MPa, and infiltrating for 1 hour under dark conditions;

[0086] (4) taking the infiltrated filaments and the enzymatic hydrolysate obtained in step (3) and placing them in a shaking table at 50 rpm in the dark and continuing the enzymatic hydrolysis for 4 h to obtain an enzymatic hydrolysate containing petal protoplasts;

[0087] (5) The enzymatic hydrolyzate obtained in step (4) was diluted with an equal volume of W5 solution, filtered through a cell sieve, and the petal residue was rinsed with an equal volume of W5 solution, all liquid was collected, and protoplasts were collected by centrifugation at 150 × g for 5 min. The protoplasts were resuspended in 10 mL of W5 solution, and the protoplasts were collected by centrifugation at 150 × g for 5 min. The supernatant was discarded, and the protoplast pellet was resuspended with MMG solution;

[0088] The formula of the enzymatic solution is as follows: 1% (w / v) Cellulase R10, 0.7% (w / v) Macerozyme R10, 0.6M mannitol, 20mM MES (pH=5.7) and 10mM KCl are mixed, placed in a 55°C water bath for 10 minutes, cooled to room temperature, and 10mM CaCl2, 0.1% (w / v) BSA, and 3mM β-mercaptoethanol are added to obtain the enzymatic solution;

[0089] The formula of W5 solution is: 154mM NaCl, 125mM CaCl2, 5mM KCl, 2mM MES;

[0090] The formula of MMG solution is: 0.4M mannitol, 15mM MgCl2, 4mM MES, and the pH is adjusted to 5.7.

[0091] On the other hand, the present disclosure provides a method for transforming Phalaenopsis orchid petal protoplasts, characterized in that the protoplasts prepared by the above method include the following steps:

[0092] The plasmid and protoplast cells were mixed, PEG solution was added, and incubated at room temperature in the dark;

[0093] After incubation, W5 solution was added to the solution, and the PEG solution was removed by centrifugation;

[0094] The centrifuged solution was resuspended by adding WI solution, placed horizontally in an incubator, kept away from light for 16-24 hours, and the protoplasts were collected by centrifugation.

[0095] In some embodiments, the weight / volume ratio of the plasmid and protoplasts is (1-5):20.

[0096] In some embodiments, the weight / volume ratio of the plasmid to protoplasts can be 1:20, 2:20, 3:20, 4:20, or 5:20.

[0097] In some embodiments, the volume ratio of the PEG solution to the protoplasts is (1-2):1.

[0098] In some embodiments, the volume ratio of the PEG solution to the protoplasts can be 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, or 2:1.

[0099] In some embodiments, the time of incubation at room temperature in the dark is 10-30 min. In some preferred embodiments, the time of incubation at room temperature in the dark is 20 min.

[0100] In some embodiments, the volume ratio of the W5 solution to the PEG solution is (3-5): 1. In some preferred embodiments, the volume ratio of the W5 solution to the PEG solution is 4:1.

[0101] In some embodiments, the formula of the WI solution is: 0.1-1 M mannitol, 10-30 mM KCl, 1-7 mM MES, and pH is 5-6.

[0102] In some embodiments, the formula of the WI solution is: 0.3-0.7 M mannitol, 15-25 mM KCl, 2-6 mM MES, and pH is 5-6.

[0103] In some embodiments, the WI solution has a formula of: 0.5 M mannitol, 20 mM KCl, 4 mM MES, and a pH of 5.7.

[0104] In some embodiments, the added volume of the WI solution is 1 mL.

[0105] In some embodiments, the temperature of the incubator is 20-30° C. In some embodiments, the temperature of the incubator is 25° C.

[0106] In some embodiments, the conversion method comprises the following steps:

[0107] Adjust the concentration of protoplasts to 2 × 10 6 / mL, adjust the plasmid concentration to greater than 1μg / μL;

[0108] Add 10-15 μg of plasmid, 100 μL of protoplasts and 110 μL of PEG solution, mix well, incubate at room temperature in the dark for 20 min, add 440 μL of W5 solution to terminate the reaction, and centrifuge at 150 × g for 5 min to remove the PEG solution;

[0109] Resuspend the protoplasts with 1 mL of WI solution, place horizontally in a 25°C incubator, incubate in the dark for 16-24 h, and collect the protoplasts by centrifugation;

[0110] The formula of the WI solution is: 0.5M mannitol, 20mM KCl, 4mM MES, and the pH is adjusted to 5.7.

[0111] The present disclosure is described in more detail below with reference to specific examples, however, the examples are for illustrative purposes only and have no limiting effect on the present disclosure. The reagents and biological materials described in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0112] The main reagents used in the following implementation cases include enzymatic solution, W5 solution, MMG solution, PEG solution, and WI solution. The concentrations in the following preparation methods are all final concentrations, and the specific volumes used are determined according to experimental requirements. The solvents are all water.

[0113] Preparation method of enzymatic solution: add 1% (w / v) Cellulase R10, 0.7% (w / v) Macerozyme R10, 0.6M mannitol, 20mM MES (pH=5.7) and 10mM KCl, place in a 55°C water bath for 10 minutes and then cool to room temperature; then add 10mM CaCl2, 0.1% (w / v) BSA, and 3mM β-mercaptoethanol.

[0114] The formula of W5 solution is: 154 mM NaCl, 125 mM CaCl2, 5 mM KCl and 2 mM MES.

[0115] The formula of MMG solution is: 0.4M mannitol, 15mM MgCl2, 4mM MES, and the pH is adjusted to 5.7.

[0116] The formula of PEG solution is: 0.2M mannitol, 100mM CaCl2, 40% (w / v) PEG4000.

[0117] The formula of WI solution is: 0.5M mannitol, 20mM KCl, 4mM MES, and the pH is adjusted to 5.7.

[0118] Here, M represents mol / L.

[0119] All the above reagents need to be sterilized by filtration through a 0.22μm microporous filter membrane before use.

[0120] Example 1. Preparation of protoplasts from Phalaenopsis orchid petals

[0121] The flow chart of the preparation of protoplasts from Phalaenopsis orchid petals is as follows Figure 1 As shown, the specific steps are as follows:

[0122] (1) Petal disinfection: Rinse the petal samples with tap water (select petals or sepals in good condition at the blooming stage, refer to the attached Figure 1 A) Remove impurities from the surface, transfer to a clean bench, and soak in 70% alcohol for 30 seconds; then soak in 0.1% mercuric chloride (HgCl2) for 5-6 minutes, then rinse with sterile water for 3 times and dry.

[0123] (2) Cutting the petals: Use a sterilized blade to cut the petals into uniform filaments of about 1 mm in thickness, and soak them in a 0.4 M mannitol solution in the dark for 30 min.

[0124] (3) Vacuum infiltration: The treated filaments were transferred into the enzymatic solution (petal mass / enzymatic solution volume = 1 g / 10 mL). The conical flask containing the enzymatic solution was placed in a vacuum desiccator (pressure of -0.06 MPa) and infiltrated for 1 hour in the dark.

[0125] (4) Enzymatic hydrolysis: Wrap the conical flask with tin foil and perform enzymatic hydrolysis on a horizontal shaker at 50 rpm at room temperature for 4 h.

[0126] (5) Collection and purification: Add an equal volume of W5 solution to the enzymatic hydrolysate in step 4, gently shake the enzymatic hydrolysate to fully release the protoplasts, use a 70 μm cell sieve to filter and collect the enzymatic hydrolysate containing the protoplasts, then rinse the vessel and the petal residue on the cell sieve with an equal volume of W5 solution 1-2 times, collect all the liquid into a 50 mL round-bottom centrifuge tube, and centrifuge in a horizontal rotor at 150×g, 1 up and 1 down, for 5 min to collect the protoplasts; gently resuspend the protoplasts with 10 mL of W5 solution and collect them in a tube, and centrifuge at 150×g, 1 up and 1 down, for 5 min to collect them. While minimizing the loss of protoplasts, remove the supernatant, add 1 mL of MMG solution to resuspend the protoplasts, and wrap them in tin foil for later use.

[0127] (6) Protoplast yield and activity determination

[0128] (a) Determination of protoplast yield: Mix the protoplast solution in step 5, use a cut pipette tip to draw 10 μL and drop it into the groove in the middle of the counting plate, cover it with a cover slip, allow the protoplasts to diffuse freely to the counting area, observe and count under the white light channel of the microscope, and calculate the protoplast yield. Count 3 replicates for each sample, and calculate 3 times for each replicate, and take the average value.

[0129] The yield of the prepared protoplasts was 9.0±1.5 (10 5 / g FW).

[0130] (b) Protoplast viability assay: Use a cut pipette tip to draw 100 μL of protoplasts into a 2 mL centrifuge tube, add 2 μL of 5 mg / mL fluorescein diacetate FDA solution, react at room temperature in the dark for 5 min, draw the protoplasts onto a glass slide, and observe and detect their viability under a fluorescence microscope (green fluorescence can be observed after protoplasts with high viability are excited, while protoplasts with low viability will not fluoresce). Randomly select 10 left and right fields for statistics and take the average value.

[0131] Calculation showed that the activity of the prepared protoplasts was as high as 95.67±0.7%.

[0132] In addition, the protoplasts stained with FDA observed under a fluorescence microscope showed Figure 2 .

[0133] Example 2. Phalaenopsis petal protoplasts transiently transformed with ZmUbi:GFP

[0134] (1) Transformation: In a 2 mL round-bottom centrifuge tube, add 5 μg, 10 μg or 15 μg (plasmid concentration greater than 1 μg / μL) pUC57-ZmUbi:GFP plasmid, 100 μL protoplasts (concentration of 2 × 10 6 / mL) and 110 μL PEG solution, gently mix, incubate for 20 min at room temperature in the dark. Add 440 μL W5 solution to terminate the reaction, and centrifuge at 150×g for 5 min to remove the PEG solution.

[0135] (2) Cultivation: Add 1 mL of WI solution to resuspend, transfer to a 50 mL centrifuge tube, place horizontally in a 25°C incubator, and keep away from light for 16-24 h.

[0136] (3) Fluorescence observation: Protoplasts were collected by centrifugation at 150 × g for 5 min. Most of the supernatant was removed, leaving 100 μL of residual liquid to resuspend the protoplast pellet; about 20 μL was taken and placed under a fluorescence microscope to observe the expression of ZmUbi:GFP. Ten different fields of view were observed to determine the transformation efficiency.

[0137] Calculations show that the conversion rate of protoplasts can reach 69.48±6.5%.

[0138] Protoplasts transformed with 5 μg, 10 μg and 15 μg of pUC57_ZmUbi:GFP plasmid were observed under a fluorescence microscope. Figure 3 .

[0139] Example 3. Phalaenopsis petal protoplasts transiently transformed with CRISPR-Act2.0 transcriptional activation elements

[0140] In order to further verify the performance of the protoplasts prepared by the disclosed method and the research and application method, in this example, Phalaenopsis petal protoplasts were used to transiently transform the CRISPR-Act2.0 transcription activation element to observe its activation and expression effects.

[0141] (1) Transformation: In a 2 mL round-bottom centrifuge tube, add CRISPR-Act2.0 reporter system related plasmids (including 10 μg pUC57-CRISPR-Act2.0 10 μg, 5 μg pUC57-sgRNA2.0 (sgRNA1-4) and 5 μg pUC57-pPeGDPS-GFP), 200 μL protoplasts and 220 μL PEG solution, mix gently, and incubate at room temperature in the dark for 30 min. Add 880 μL W5 solution to terminate the reaction, and centrifuge at 150 × g for 5 min to remove the PEG solution;

[0142] The sequence information of the four sgRNAs is shown in Table 1 below:

[0143] Table 1 sgRNA sequence information

[0144] sgRNA sequence SEQ ID NO.X sgRNA1 agtttatgattaattaagcatgg 1 sgRNA2 tacaccataaggggcatctaggg 2 sgRNA3 atccttctcaaacaagcagacgg 3 sgRNA4 cacggatgcatctggctgtgtgg 4

[0145] The CRISPR-Act2.0 transcription activation system has been reported in the following literature:

[0146] Lowder, LGet al. Robust transcriptional activation in plants using multiplexed CRISPR-Act2.0and mTALE-Act systems. Mol. Plant 11, 245–256 (2018).

[0147] The ability of pPeGDPS to activate gene expression in Phalaenopsis petals has been reported in the following literature:

[0148] Hsiao,Y.et al.Comparison of transcripts in Phalaenopsis bellina andPhalaenopsis equestris(Orchidaceae)flowers to deduce the monoterpenebiosynthesis pathway.BMC Plant Biol 6,14(2006).

[0149] (2) Cultivation: After re-suspending by adding 2 mL of WI solution, transfer to a 12-well plate, add 0.5 mL of WI solution to each well, place horizontally in a 25°C incubator, and keep in the dark for 48 h.

[0150] (3) RT-PCR detection: Protoplasts were collected by centrifugation at 150×g for 5 min, and the supernatant was removed as much as possible without losing the protoplast pellet. RNA was extracted and reverse transcribed before RT-PCR to measure the changes in GFP transcription levels, with Phalaenopsis EF1α as the internal reference gene.

[0151] The experimental results are shown in Figure 4 , indicating that the pPeGDPS promoter is indeed transcriptionally activated and that different sgRNAs have different effects on transcriptional activation.

[0152] The above is only a preferred embodiment of the present invention, and the present invention should not be limited to the contents disclosed in the embodiment and the drawings. Any equivalent or modification completed without departing from the spirit disclosed in the present invention shall fall within the scope of protection of the present invention.

Claims

1. A method for preparing protoplasts of Phalaenopsis orchid petals, comprising the following steps: (1) Take Phalaenopsis orchid petals, wash and disinfect them; (2) Cut the petals after disinfection into thin strips and soak them in a mannitol solution away from light; (3) transferring the filaments soaked in step (2) into an enzymatic solution and placing them in a vacuum desiccator away from light for permeation; (4) taking the infiltrated filaments from step (3) and placing them in a low-speed shaking table away from light to continue enzymatic hydrolysis, thereby obtaining an enzymatic hydrolyzate containing petal protoplasts; (5) The enzymatic hydrolyzate obtained in step (4) was diluted with W5 solution, filtered, and the filtrate was centrifuged at low speed, the supernatant was discarded, and the protoplast pellet was resuspended with W5 solution. After low speed centrifugation again, the supernatant was discarded, and the protoplast pellet was resuspended with MMG solution.

2. The method according to claim 1, wherein: The specific process of cleaning and disinfection in step (1) is: rinse the petals with water, soak the petals in 70% alcohol for 30 seconds, soak the petals in 0.1% mercuric chloride for 5-6 minutes, rinse the petals with sterile water and absorb the moisture.

3. The method according to claim 1 or 2, wherein: The concentration of mannitol in step (2) is 0.1-1M; Preferably, the concentration of mannitol in step (2) is 0.2-0.6M; Preferably, the concentration of mannitol in step (2) is 0.4 M; Preferably, the light-proof soaking time in step (2) is 15-45 minutes; Preferably, the light-proof immersion time in step (2) is 30 minutes.

4. The method according to any one of claims 1 to 3, wherein: The preparation method of the enzymatic hydrolysate is as follows: 1%-5% (w / v) Cellulase R10, 0.1%-1% (w / v) Macerozyme R10, 0.1-1M mannitol, 10-30mM MES (pH=5.7) and 5-15mM KCl are mixed, and the mixture is placed in a 55° C. water bath for 10 minutes, cooled to room temperature, and 5-15mM CaCl2, 0.1%-0.5% (w / v) BSA, and 1-5mM β-mercaptoethanol are added to obtain the enzymatic hydrolysate; Preferably, the preparation method of the enzymatic hydrolysate is as follows: 1%-3% (w / v) Cellulase R10, 0.5%-1% (w / v) Macerozyme R10, 0.5-1M mannitol, 15-25mM MES (pH=5.7) and 7-13mM KCl are mixed, placed in a 55°C water bath for 10 minutes, cooled to room temperature, and 7-13mM CaCl2, 0.1% (w / v) BSA, and 3mM β-mercaptoethanol are added to obtain the enzymatic hydrolysate; Preferably, the preparation method of the enzymatic hydrolysate is: 1% (w / v) Cellulase R10, 0.7% (w / v) Macerozyme R10, 0.6M mannitol, 20mM MES (pH=5.7) and 10mM KCl are mixed, in a 55°C water bath for 10 minutes, cooled to room temperature, and 10mM CaCl2, 0.1% (w / v) BSA, and 3mM β-mercaptoethanol are added to obtain the enzymatic hydrolysate.

5. The method according to any one of claims 1 to 4, wherein: In step (3), the weight / volume ratio of petals to enzymatic hydrolysate is 1:(5-15); Preferably, in step (3), the weight / volume ratio of petals to enzymatic hydrolysate is 1:10; Preferably, the specific process of step (3) is: transferring the filaments soaked in step (2) into the enzymatic hydrolysis solution, the mass volume ratio of the filaments to the enzymatic hydrolysis solution is 1:10, placing the enzymatic hydrolysis solution containing the filaments in a vacuum dryer, setting the pressure to -0.06Mpa, and infiltrating for 1 hour under dark conditions.

6. The method according to any one of claims 1 to 5, wherein: The enzymatic hydrolysis time in step (4) is 2-6 hours; Preferably, the enzymatic hydrolysis time in step (4) is 4 h; Preferably, the rotation speed of the horizontal shaking table in step (4) is 20-80 rpm; Preferably, the rotation speed of the horizontal shaking table in step (4) is 50 rpm.

7. The method according to any one of claims 1 to 6, wherein: The formula of W5 solution in step (5) is: 100-200 mM NaCl, 100-150 mM CaCl2, 3-7 mM KCl and 1-3 mM MES; Preferably, the formula of W5 solution in step (5) is: 120-180 mM NaCl, 120-130 mM CaCl2, 4-6 mM KCl and 1-3 mM MES; Preferably, the formula of W5 solution in step (5) is: 154mM NaCl, 125mM CaCl2, 5mM KCl and 2mM MES; Preferably, the formula of the MMG solution in step (5) is: 0.2-0.6M mannitol, 10-20mM MgCl2, 2-6mM MES, and the pH is adjusted to 5-6; Preferably, the formula of the MMG solution in step (5) is: 0.3-0.5M mannitol, 12-18mM MgCl2, 3-5mM MES, and the pH is adjusted to 5-6; Preferably, the formula of the MMG solution in step (5) is: 0.4M mannitol, 15mM MgCl2, 4mM MES, and the pH is adjusted to 5.

7.

8. The method according to any one of claims 1 to 7, wherein: The method comprises the following steps: (1) Rinse the petals with water, soak them in 70% alcohol for 30 seconds, soak the petals in 0.1% mercuric chloride for 5-6 minutes, rinse with sterile water and dry them; (2) Cut the petals into uniform filaments of about 1 mm after disinfection and soak them in 0.4 M mannitol solution in the dark for 30 min; (3) transferring the filaments soaked in step (2) into the enzymatic hydrolysis solution, wherein the weight / volume ratio of the filaments to the enzymatic hydrolysis solution is 1:10, placing the enzymatic hydrolysis solution containing the filaments in a vacuum desiccator, setting the pressure to -0.06 MPa, and infiltrating for 1 hour under dark conditions; (4) taking the infiltrated filaments and the enzymatic hydrolysate obtained in step (3) and placing them in a shaking table at 50 rpm in the dark and continuing the enzymatic hydrolysis for 4 h to obtain an enzymatic hydrolysate containing petal protoplasts; (5) The enzymatic hydrolyzate obtained in step (4) was diluted with an equal volume of W5 solution, filtered through a cell sieve, and the petal residue was rinsed with an equal volume of W5 solution, all liquid was collected, and protoplasts were collected by centrifugation at 150 × g for 5 min. The protoplasts were resuspended in 10 mL of W5 solution, and the protoplasts were collected by centrifugation at 150 × g for 5 min. The supernatant was discarded, and the protoplast pellet was resuspended with MMG solution; The formula of the enzymatic solution is as follows: 1% (w / v) Cellulase R10, 0.7% (w / v) Macerozyme R10, 0.6M mannitol, 20mM MES (pH=5.7) and 10mM KCl are mixed, placed in a 55°C water bath for 10 minutes, cooled to room temperature, and 10mM CaCl2, 0.1% (w / v) BSA, and 3mM β-mercaptoethanol are added to obtain the enzymatic solution; The formula of W5 solution is: 154mM NaCl, 125mM CaCl2, 5mM KCl and 2mM MES; The formula of MMG solution is: 0.4M mannitol, 15mM MgCl2, 4mM MES, and the pH is adjusted to 5.

7.

9. A method for transforming Phalaenopsis petal protoplasts, characterized in that: The protoplasts prepared by the method according to any one of claims 1 to 8, wherein the transformation method comprises the following steps: The plasmid and protoplast cells were mixed, PEG solution was added, and incubated at room temperature in the dark; After incubation, W5 solution was added to the solution, and the PEG solution was removed by centrifugation; WI solution was added to the centrifuged solution to resuspend it, and the solution was placed horizontally in an incubator in the dark for 16-24 hours, and the protoplasts were collected by centrifugation.

10. The method according to claim 9, wherein: The weight / volume ratio of the plasmid and protoplast is (1-5):20; Preferably, the volume ratio of the PEG solution to the protoplasts is (1-2):1; Preferably, the incubation time at room temperature and away from light is 10-30 min; preferably 20 min; Preferably, the volume ratio of the W5 solution to the PEG solution is (3-5):1; preferably 4:1; Preferably, the formula of the WI solution is: 0.1-1M mannitol, 10-30mM KCl, 1-7mM MES, pH 5-6; Preferably, the formula of the WI solution is: 0.3-0.7 M mannitol, 15-25 mM KCl, 2-6 mM MES, pH 5-6; Preferably, the formula of the WI solution is: 0.5M mannitol, 20mM KCl, 4mM MES, pH 5.7; Preferably, the added volume of the WI solution is 1 mL; Preferably, the temperature of the incubator is 20-30°C; Preferably, the conversion method comprises the following steps: Adjust the concentration of protoplasts to 2 × 10 6 / mL, adjust the plasmid concentration to greater than 1μg / μL; Add 10-15 μg of plasmid, 100 μL of protoplasts and 110 μL of PEG solution, mix well, incubate at room temperature in the dark for 20 min, add 440 μL of W5 solution to terminate the reaction, and centrifuge at 150 × g for 5 min to remove the PEG solution; Resuspend the protoplasts with 1 mL of WI solution, place horizontally in a 25°C incubator, incubate in the dark for 16-24 h, and collect the protoplasts by centrifugation; The formula of the WI solution is: 0.5M mannitol, 20mM KCl, 4mM MES, and the pH is 5.7.

Images