Mutant protein of dihydroxyacetone phosphate phosphatase and application

Abstract

The invention discloses mutant protein of dihydroxyacetone phosphate phosphatase and application of the mutant protein. The invention provides a phosphodihydroxyacetone phosphatase mutant protein, which is characterized in that residues of phosphodihydroxyacetone phosphatase corresponding to 21st, 36th, 42nd, 49th, 64th, 82nd, 150th and 244th sites of an amino acid sequence shown in a sequence 1 are mutated to obtain a protein with phosphodihydroxyacetone phosphatase activity; and the synthesis capability of the 1, 3-dihydroxyacetone is improved. The invention also provides related biological materials and derivatives of the protein, and application of the protein in preparation of 1, 3-dihydroxyacetone. The yield of 1, 3-dihydroxy acetone of the protein is greatly increased, compared with starting wild type dihydroxy acetone phosphate phosphatase, the yield of 1, 3-dihydroxy acetone obtained through shake flask fermentation of the dihydroxy acetone phosphate phosphatase mutant SF6-11 is increased by 1.65 times, and the yield of 1, 3-dihydroxy acetone is increased to 4.54 + / -0.09 g / L from 2.75 + / -0.07 g / L.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a mutant protein of dihydroxyacetone phosphate phosphatase and an application thereof. Background Art

[0002] 1,3-Dihydroxyacetone (DHA) is the simplest three-carbon ketose and is widely used in the fields of chemical industry, medicine, food, cosmetics and feed. In the chemical industry, 1,3-dihydroxyacetone is mainly used as an important organic synthesis intermediate. In the pharmaceutical industry, 1,3-dihydroxyacetone is an important drug synthesis intermediate that can be used to treat some viral skin diseases, and its derivatives are used to synthesize anti-AIDS drugs. In the food industry, 1,3-dihydroxyacetone can be used as a preservative ingredient and is mainly used for food preservation. In the cosmetics industry, 1,3-dihydroxyacetone, as an active ingredient in sunless tanning agents, can react with the free amino groups of keratin in the stratum corneum of the epidermis to achieve a dyeing effect, similar to the Medela reaction, which can quickly turn the skin into a natural tan and last for several days. This mechanism is similar to the natural sun tanning dynamics, while avoiding sun exposure and protecting the skin from UV damage. 1,3-dihydroxyacetone is the main active ingredient of almost all tanning and sunscreen skin care products. This raw material can also replace chemical hair dyes for hair dyeing products. In the feed industry, 1,3-dihydroxyacetone, as an intermediate product of sugar metabolism, can also participate in the synthesis of triglycerides in higher animals and plants. Therefore, it is an intermediate product connecting sugar metabolism and fat metabolism. By feeding 1,3-dihydroxyacetone, it can effectively improve the sugar metabolism and fat metabolism process, change the flow of sugar metabolism and fat metabolism, improve feed utilization efficiency, reduce fat anabolism, accelerate fat consumption in animals, and improve ketone body quality; animal experiments show that feeding 1,3-dihydroxyacetone and pyruvate can effectively inhibit the accumulation of body fat and effectively increase the lean meat rate of poultry and livestock. Therefore, a lean meat feed additive with 1,3-dihydroxyacetone as the main ingredient can be developed.

[0003] At present, the industrial production of 1,3-dihydroxyacetone mainly uses the microbial conversion of glycerol. It has been reported that a variety of microorganisms can convert glycerol to 1,3-dihydroxyacetone. Among them, Gluconobacter oxydans can convert glycerol into 1,3-dihydroxyacetone in one step through membrane-bound glycerol dehydrogenase and quickly release it into the fermentation broth. It has stable production performance and high conversion rate, so it has become the most used strain in the microbial fermentation production of 1,3-dihydroxyacetone. For example, the team of Wei Dongzhi from East China University of Science and Technology significantly improved the growth and 1,3-dihydroxyacetone production of Gluconobacter oxydans in high-concentration glycerol culture medium by knocking out the membrane-bound alcohol dehydrogenase gene adhA. Using the resting cell method, 230g / L glycerol was converted into 139.7g / L DHA within 72h, and the volumetric productivity was 1.94g / L / h (Biosci Biotechnol Biochem. 2010; 74(7):1391-5). Xu Yong's team from Nanjing Forestry University used compressed oxygen to connect fermentation tanks to significantly improve the glycerol conversion efficiency of Gluconobacter oxidans, achieving a 1,3-dihydroxyacetone yield of 301.2±8.2 g / L after 32 hours of fermentation, with a production rate of 9.41±0.23 g / L / h, which is currently the highest yield of 1,3-dihydroxyacetone produced by Gluconobacter oxidans from glycerol (Bioprocess Biosyst Eng. 2016Aug; 39(8):1315-8).

[0004] Since high-density fermentation of Gluconobacter oxydans is difficult and the price of glycerol raw materials is much higher than the market price of glucose raw materials, the development of a 1,3-dihydroxyacetone biosynthesis route based on glucose as raw materials has important application value. In the glycolysis pathway, dihydroxyacetone phosphate (DHAP) is an important intermediate product. Using the broad substrate specificity of phosphatases to catalyze dihydroxyacetone phosphate to produce 1,3-dihydroxyacetone is a metabolic route with potential production possibilities. Vishist Kumar Jain and others from the Institute of Chemical and Engineering Sciences of the Agency for Science, Technology and Research in Singapore introduced the dihydroxyacetone phosphate phosphatase HdpA from Corynebacterium glutamicum into Escherichia coli, and knocked out the triosephosphate isomerase TpiA, methylglyoxal synthase MgsA and glycerol dehydrogenase GldA, and obtained an engineered strain that synthesizes 1,3-dihydroxyacetone based on glucose as a substrate. The theoretical conversion rate of this synthetic route is 0.5 g / g. The strain was fermented in a 2.5L fermenter for 40 hours, and the 1,3-dihydroxyacetone production was 6.60±0.2 g / L, with a conversion rate of 0.44 g / g (Enzyme and Microbial Technology, 2016, 86:39-44). The You Chun team from the Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, identified an extremely thermophilic haloacid dehalogenase-like hydrolase family phosphatase AfPase from Archaeoglobus fulgidus. Combined with five other enzymes from different sources, they formed an in vitro enzymatic synthesis route from maltodextrin substrate to 1,3-dihydroxyacetone, obtaining 1.26 g / L 1,3-dihydroxyacetone with a conversion rate of 0.13 g / g (Bioresources and Bioprocessing, 2019, 6(1):1-11). Hao Jian's team from the Shanghai Advanced Research Institute of the Chinese Academy of Sciences used Klebsiella pneumoniae as the base bacteria, introduced dihydroxyacetone phosphate phosphatase HdpA from Corynebacterium glutamicum, knocked out triose phosphate isomerase TpiA, hydroxyacetone kinase DhaK, methylglyoxal synthase MgsA, and glycerol dehydrogenase GldA. The strain was fermented in a 3L fermenter for 91 hours, with a 1,3-dihydroxyacetone production of 23.9 g / L, a conversion rate of 0.97 mol / mol, and a by-product glycerol of 10.8 g / L (Microb Cell Fact. 2021Jun 29; 20(1):123).

[0005] Based on the key role of dihydroxyacetone phosphate phosphatase HdpA in the metabolic pathway from glucose to 1,3-dihydroxyacetone, using protein directed evolution technology to modify the substrate affinity and catalytic rate of the enzyme will help improve the yield and production rate of 1,3-dihydroxyacetone produced by engineered strains using glucose substrate fermentation. Summary of the invention

[0006] The purpose of the present invention is to provide a mutant protein of dihydroxyacetone phosphate phosphatase and its application.

[0007] In the first aspect, the present invention provides a dihydroxyacetone phosphate phosphatase mutant protein, which is the following A1 or A2 or A3:

[0008] The protein described in A1) is a protein having dihydroxyacetone phosphate phosphatase activity obtained by mutating residues 21, 36, 42, 49, 64, 82, 150 and 244 of the amino acid sequence of dihydroxyacetone phosphate phosphatase corresponding to SEQ ID NO: 1, while keeping other amino acid residues unchanged;

[0009] The protein described in A2) is a fusion protein obtained by connecting the protein described in A1 with a protein having a targeting function;

[0010] The protein described in A3) is a protein derived from A1 having dihydroxyacetone phosphate phosphatase activity obtained by adding a tag sequence to the end of the amino acid sequence of the protein shown in A1.

[0011] The above-mentioned protein-tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag protein can be a Flag tag protein, a His6 tag protein, an MBP tag protein, an HA tag protein, a myc tag protein, a GST tag protein or a SUMO tag protein, etc.

[0012] In the above protein, the dihydroxyacetone phosphate phosphatase is derived from Corynebacterium glutamicum.

[0013] In the protein described above, the mutations are: the 21st M mutated to V, the 36th N mutated to D, the 42nd L mutated to P, the 49th T mutated to A, the 64th I mutated to V, the 82nd S mutated to G, the 150th T mutated to S and the 244th H mutated to R corresponding to the amino acid sequence shown in Sequence 1.

[0014] Among the proteins mentioned above, the dihydroxyacetone phosphate phosphatase mutant protein is SF6-11, and its amino acid sequence is shown in Sequence 3 of the sequence listing.

[0015] In a second aspect, the present invention provides a biological material related to the protein described in the first aspect, which is any one of the following B1) to B8):

[0016] B1) a nucleic acid molecule encoding the mutant protein;

[0017] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0018] B3) a recombinant vector containing the nucleic acid molecule described in B1);

[0019] B4) a recombinant vector containing the expression cassette described in B2);

[0020] B5) a recombinant microorganism containing the nucleic acid molecule described in B1);

[0021] B6) a recombinant microorganism containing the expression cassette described in B2);

[0022] B7) a recombinant microorganism containing the recombinant vector described in B3);

[0023] B8) A recombinant microorganism containing the recombinant vector described in B4).

[0024] In the above-mentioned related biological materials, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA.

[0025] In the above-mentioned related biological materials, the recombinant microorganism is Escherichia coli, and specifically can be a 1,3-dihydroxyacetone producing strain.

[0026] The recombinant microorganism described above is prepared according to a method comprising the following steps: introducing the coding gene of the protein described in the first aspect into the host bacteria to obtain the recombinant microorganism.

[0027] In a third aspect, the present invention provides use of the protein described in the first aspect in the preparation of 1,3-dihydroxyacetone.

[0028] In a fourth aspect, the present invention provides use of the nucleic acid molecule, expression cassette or recombinant vector or the recombinant microorganism described in the second aspect in producing 1,3-dihydroxyacetone or increasing the yield of 1,3-dihydroxyacetone.

[0029] In a fifth aspect, the present invention provides a method for producing 1,3-dihydroxyacetone or increasing the yield of 1,3-dihydroxyacetone, comprising the following steps: fermenting and culturing the recombinant microorganism described in the second aspect to obtain 1,3-dihydroxyacetone.

[0030] In a sixth aspect, the present invention provides the use of a substance that causes the amino acid sequence of dihydroxyacetone phosphate phosphatase to be mutated to the amino acid residues 21, 36, 42, 49, 64, 82, 150, and 244 corresponding to the amino acid sequence shown in SEQ ID NO: 1 in the production of 1,3-dihydroxyacetone or in increasing the yield of 1,3-dihydroxyacetone.

[0031] The above-mentioned substance is any substance in which the amino acid sequence of dihydroxyacetone phosphate phosphatase in the host bacteria corresponds to the amino acid sequence shown in SEQ ID NO: 1, wherein M at position 21 is mutated to V, N at position 36 is mutated to D, L at position 42 is mutated to P, T at position 49 is mutated to A, I at position 64 is mutated to V, S at position 82 is mutated to G, T at position 150 is mutated to S, and H at position 244 is mutated to R. Site-directed mutagenesis in the prior art can be used.

[0032] Experiments of the present invention prove that the dihydroxyacetone phosphate phosphatase mutant SF6-11 obtained by replacing multiple or one amino acid residues among M21V, N36D, L42P, T49A, I64V, S82G, T150S and H244R in the amino acid sequence of dihydroxyacetone phosphate phosphatase has a shake flask fermentation 1,3-dihydroxyacetone yield increased by 1.65 times compared with the original wild-type dihydroxyacetone phosphate phosphatase, and the 1,3-dihydroxyacetone yield is increased from 2.75±0.07 g / L to 4.54±0.09 g / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The flowchart for screening of dihydroxyacetone phosphate phosphatase CgHdpA mutants.

[0034] Figure 2 The figure shows the comparison of 1,3-dihydroxyacetone production and specific growth rate of HdpA mutant and wild type HdpA. WT is the starting HdpA CgHdpA, and EP1-E12, SF2-5, SF3-16, SF4-4B4, SF5-21 and SF6-11 are HdpA mutants. DETAILED DESCRIPTION

[0035] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0036] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0037] The Gene IDs of the genes involved in the following embodiments are all Gene IDs in the NCBI database (all gene ID information is from the NCBI database, web link: https: / / www.ncbi.nlm.nih.gov / nuccore / CP000946.1 / ), specifically as follows: The nucleotide sequence of the gene encoding the endogenous glucose-specific PTS enzyme IIBC component PtsG (i.e., the ptsG gene) is Gene ID: EcolC_2500 (submission date is 2008.2.14). The nucleotide sequence of the gene encoding the endogenous pyruvate formate lyase PflB (i.e., the pflB gene) is Gene ID: EcolC_2693 (submission date is 2008.2.14). The nucleotide sequence of the gene encoding the pyruvate oxidase PoxB (i.e., the poxB gene) is Gene ID: EcolC_2725 (submission date is 2008.2.14). The nucleotide sequence of the gene encoding endogenous alcohol dehydrogenase AdhE (ie, adhE gene) is Gene ID: EcolC_2387 (submission date: 2008.2.14).

[0038] The nucleotide sequence of the gene encoding the endogenous histidine phosphate carrier protein PtsH (i.e., the ptsH gene) is Gene ID: EcolC_1263 (submitted on February 14, 2008). The nucleotide sequence of the gene encoding the endogenous phosphoenolpyruvate-protein phosphotransferase IPtsI (i.e., the ptsI gene) is Gene ID: EcolC 1262 (submitted on February 14, 2008). The nucleotide sequence of the gene encoding the endogenous glucose-specific enzyme II complex EIIA Crr (i.e., the crr gene) is Gene ID: EcolC_1261 (submitted on February 14, 2008). The nucleotide sequence of the gene encoding the endogenous dihydroxyacetone kinase DhaRKLM (i.e., the dhaRKLM gene) is Gene ID: EcolC_2425 (submission date: 2008.2.14), EcolC_2426 (submission date: 2008.2.14), EcolC_2427 (submission date: 2008.2.14), and EcolC_2428 (submission date: 2008.2.14). The nucleotide sequence of the gene encoding the endogenous glycerol kinase GlpK (i.e., the glpK gene) is Gene ID: EcolC_4092 (submission date: 2008.2.14). The nucleotide sequence of the gene encoding the methylglyoxal synthase MgsA (i.e., the mgsA gene) is Gene ID: EcolC_2633 (submission date: 2008.2.14). The nucleotide sequence of the gene encoding glycerol dehydrogenase GldA (i.e., gldA gene) is Gene ID: EcolC_4070 (submission date: 2008.2.14). The nucleotide sequence of the gene encoding L-arabinose isomerase AraA (i.e., araA gene) is Gene ID: EcolC_3595 (submission date: 2008.2.14). The nucleotide sequence of the gene encoding ribulose kinase AraB (i.e., araB gene) is Gene ID: EcolC_3594 (submission date: 2008.2.14). The nucleotide sequence of the gene encoding endogenous triosephosphate isomerase TpiA (i.e., tpiA gene) is Gene ID: EcolC_4099 (submission date: 2008.2.14).

[0039] The nucleotide sequence of the gene encoding endogenous 6-phosphofructoyl aldolase 1FsaA (i.e., fsaA gene) is Gene ID: EcolC_2819 (submission date: 2008.2.14). The nucleotide sequence of the gene encoding endogenous 6-phosphofructoyl aldolase 2FsaB (i.e., fsaB gene) is Gene ID: EcolC_4069 (submission date: 2008.2.14). The nucleotide sequence of the gene encoding endogenous glycerol transporter GlpF (i.e., glpF gene) is Gene ID: EcolC_4091 (submission date: 2008.2.14). The nucleotide sequence of the gene encoding endogenous 6-phosphofructoyl aldolase Zwf (i.e., zwf gene) is Gene ID: EcolC_1780 (submission date: 2008.2.14). The nucleotide sequence of the gene encoding the endogenous phosphogluconate dehydratase Edd (i.e., the edd gene) is Gene ID: EcolC_1781 (submission date: 2008.2.14). The nucleotide sequence of the gene encoding the endogenous 2-keto-3-deoxy-6-phosphogluconate aldehyde Eda (i.e., the eda gene) is Gene ID: EcolC_1782 (submission date: 2008.2.14). The above Gene IDs are all Gene IDs in the NCBI database.

[0040] The Escherichia coli strain TZ-237 involved in the following embodiments is a strain of ATCC 8739 Escherichia coli in which the full-length ptsHI-crr gene (ptsHI-crr gene positions 1-2622, ptsHI-crr gene consists of three genes ptsH, ptsI and crr, and the sequence numbers of the three genes are Gene ID: EcoLC_1261, EcoLC_1262, EcoLC_1263), the full-length dhaRKLM gene (dhaRKLM gene positions 1-5290, dhaRKLM gene consists of four genes dhaR, dhaK, dhaL and dhaM, and the sequence numbers of the four genes are Gene ID: EcoLC_2425, EcoLC_2426, EcoLC_2427, EcoLC_2428), the glpK gene (Gene ID: EcoLC_4092) positions 1-1509, the mgsA gene (Gene ID: EcoLC_4093) positions 1-1510, the The 1st to 459th positions of the gldA gene (Gene ID: EcolC_2633), the 46th to 1104th positions of the gldA gene (Gene ID: EcolC_2633), the 274th to 3159th positions of the araBA gene (araBA gene is composed of araB gene and araA gene, and the knockout part is from the 274th position of the araB gene to the end of the araA gene; the two genes are Gene ID: EcolC_3594, EcolC_3595) and the 1st to 758th positions of the tpiA gene (Gene ID: EcolC_4099) were knocked out to inactivate the functions of these genes, and P 93 -T7RNAP fragment (SEQ ID NO: 78-2682) replaced the fragment shown in position 151-1434 of ptsG gene in ATCC 8739 genome, and poxB::P T7 -hdpA fragment (56-1158 of SEQ ID NO. 9) replaced the fragment of poxB gene at position 396-1083 in ATCC8739 genome, and pflB::P T7 -hdpA fragment (56-1158th position of SEQ ID NO. 11) replaced the fragment of pflB gene from position 1 to position 2283 in the ATCC 8739 genome, and knocked out fsaA gene from position 1 to position 663 and fsaB gene from position 1 to position 663, and knocked out glpF gene from position 1 to position 813, so that P 46 -nox (position 86-1621 of sequence 10) replaced the 102-2676 fragment of the adhE gene of Escherichia coli; knocked out positions 1-1476 of the zwf gene, knocked out positions 1-1812 of the edd gene, and knocked out positions 1-642 of the eda gene to obtain recombinant bacteria.

[0041] In the following embodiments, the P 10The promoter is a nucleotide sequence of SEQ ID NO: 4 in the sequence listing.

[0042] In the following examples, plasmid pSC101 is available to the public from Tianjin Industrial Biotechnology Research Institute and is recorded in the non-patent document "Bernardi, A., Bernardi, F., 1984. Complete sequence of pSC101. Nucleic acids research. 12, 9415-26". The public can obtain it from Tianjin Industrial Biotechnology Research Institute to repeat the experiments of this application and cannot be used for other purposes.

[0043] In the following examples, plasmid pKD46 is a product of the Yale University CGSC Escherichia coli collection, which is described in the non-patent literature: Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci US A. 2000 Jun 6; 97(12): 6640-6645. The sequence of this plasmid has been published in the NCBI database with the sequence number: AY048746.

[0044] In the following examples, the pACYC184 plasmid is described in the non-patent literature: Rose RE. The nucleotide sequence of pACYC184. Nucleic Acids Res. 1988 Jan 11; 16(1): 355. The plasmid sequence has been published in the NCBI database with the sequence number: X06403.

[0045] In the following examples, the reagents: PrimeSTAR GXL DNA Polymerase and TaKaRa Taq are all products of Takara Biotechnology (Beijing) Co., Ltd. The restriction endonuclease DpnI is a product of NEB.

[0046] PCR products were purified using the SanPrep column-based DNA gel recovery kit, a product of Sangon Biotechnology (Shanghai) Co., Ltd.

[0047] PCR SuperMix (+dye) and Trans1-T1 Phage Resistant chemically competent cells are products of Beijing TransGen Biotech Co., Ltd.

[0048] In the following examples, culture medium: LB solid medium is a culture medium made of sodium chloride, peptone, yeast extract, agar and water, and the contents of sodium chloride, peptone, yeast extract and agar are as follows: 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract and 20 g / L agar.

[0049] The main strains and main plasmids constructed in the following examples are shown in Table 1 and Table 2, respectively.

[0050] Table 1 shows the main strains used and constructed in this example.

[0051]

[0052]

[0053] Table 2 shows the main plasmids constructed in this example.

[0054]

[0055] In the following examples, LB liquid culture medium is a culture medium made of sodium chloride, peptone, yeast extract and water, and the contents of sodium chloride, peptone and yeast extract are as follows: 10 g / L sodium chloride, 10 g / L peptone and 5 g / L yeast extract.

[0056] In the following examples, M9 solid culture medium is a culture medium made of glucose, inorganic salts, trace elements, agar and water, and the contents of glucose, inorganic salts, trace elements and agar are as follows: 10 g / L glucose, 6.78 g / L Na2HPO4, 3.0 g / LKH2PO4, 1.0 g / L NH4Cl, 0.5 g / L NaCl, 0.493 g / L MgSO4·7H2O, 0.011 g / L CaCl2, 1 mL trace elements and 20 g / L agar.

[0057] In the following examples, M9 liquid culture medium is a culture medium made of glucose, inorganic salts, trace elements and water, and the contents of glucose, inorganic salts and trace elements are as follows: 10 g / L glucose, 6.78 g / L Na2HPO4, 3.0 g / L KH2PO4, 1.0 g / L NH4Cl, 0.5 g / L NaCl, 0.493 g / L MgSO4·7H2O, 0.011 g / L CaCl2, and 1 mL trace elements.

[0058] In the following examples, the fermentation medium CM9: the composition of each liter of the medium is 50g glucose, 5g white corn syrup powder, 0.47g KCl, 1g NH4Cl, 0.87g (NH4)2SO4, 0.5g MgSO4·7H2O, 1mM KH2PO4, 1mL trace elements, and the balance is water.

[0059] The trace element formula is as follows: 0.2g / L ZnCl2, 0.05g / L H3BO3, 0.2g / L CoCl2·6H2O, 0.1g / LCuCl2·2H2O, 1.6g / L FeCl3·6H2O, 0.17g / L Na2MoO4·2H2O, and the balance is water.

[0060] LB solid medium containing chloramphenicol (final concentration of 34 μg / ml) is a medium made of sodium chloride, peptone, yeast extract, agar, chloramphenicol and water, and the contents of sodium chloride, peptone, yeast extract, agar and chloramphenicol are as follows: 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract, 20 g / L agar, 34 μg / ml chloramphenicol.

[0061] LB liquid medium containing chloramphenicol (final concentration is 34 μg / ml) is a medium made of sodium chloride, peptone, yeast extract, chloramphenicol and water, and the contents of sodium chloride, peptone, yeast extract and chloramphenicol are as follows: 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract, 34 μg / ml chloramphenicol.

[0062] LB solid medium containing ampicillin (final concentration of 50 μg / ml) and chloramphenicol (final concentration of 34 μg / ml) is a medium made of sodium chloride, peptone, yeast extract, agar, ampicillin, chloramphenicol and water, and the contents of sodium chloride, peptone, yeast extract, agar, ampicillin and chloramphenicol are as follows: 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract, 20 g / L agar, 50 μg / ml ampicillin, 34 μg / ml chloramphenicol.

[0063] M9 solid culture medium containing ampicillin (final concentration of 50 μg / ml) is a culture medium made of glucose, inorganic salts, trace elements, agar and water. The contents of glucose, inorganic salts, trace elements and agar are as follows: 10 g / L glucose, 6.78 g / L Na2HPO4, 3.0 g / L KH2PO4, 1.0 g / L NH4Cl, 0.5 g / L NaCl, 0.493 g / L MgSO4·7H2O, 0.011 g / L CaCl2, 1 mL trace elements, 20 g / L agar, 50 μg / ml ampicillin.

[0064] M9 liquid culture medium containing ampicillin (final concentration of 50 μg / ml) is a culture medium made of glucose, inorganic salts, agar and water. The contents of glucose, inorganic salts and agar are as follows: 10 g / L glucose, 6.78 g / L Na2HPO4, 3.0 g / L KH2PO4, 1.0 g / L NH4Cl, 0.5 g / L NaCl, 0.493 g / L MgSO4·7H2O, 0.011 g / L CaCl2, 1 mL trace elements, and 50 μg / ml ampicillin.

[0065] LB liquid medium (without sodium chloride) containing 10% sucrose is a medium made of sucrose, peptone, yeast extract and water. The contents of sucrose, peptone and yeast extract are as follows: mass percentage 10% sucrose, 10g / L peptone, 5g / L yeast extract.

[0066] In the following examples, unless otherwise specified, the first position of each nucleotide sequence is the 5' terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.

[0067] Example 1. Construction of recombinant plasmid pSC100-CgHdpA

[0068] The main problem restricting the production of 1,3-dihydroxyacetone is the low activity of dihydroxyacetone phosphate phosphatase CgHdpA on the substrate dihydroxyacetone phosphate. Therefore, the present invention mainly constructs and screens CgHdpA mutants to obtain mutations with the best catalytic efficiency, so that the metabolic flow is maximized to the 1,3-dihydroxyacetone metabolic pathway, thereby increasing the production of 1,3-dihydroxyacetone to meet the requirements of industrial production. The specific process is as follows:

[0069] The constitutive low-copy weak promoter recombinant plasmid pSC100-CgHdpA contains the replication origin ori of the low-copy plasmid pSC101 and the coding sequence of the replication protein RepA and the constitutive artificially regulated promoter element P 10 , and the dihydroxyacetone phosphate phosphatase CgHdpA encoding gene hdpA, the specific process is as follows:

[0070] 1. Amplify the pSC100 vector backbone

[0071] Using the DNA of the low-copy plasmid pSC101 as a template, PCR amplification was performed using primers pSC-P10-up / pSC-HdpA-down:

[0072] pSC-P10-up:

[0073] 5'-GGCGAGAGGCTCAATTATATCAGCACAGGGCTCTTGTCAACACCGCCAGAGATAAGCGCCTGTAGTGCCATTTAC-3'

[0074] pSC-down:5'-CCCCATGCGAGAGTAGGGAACT-3'

[0075] Amplification system: 5× PrimeSTAR GXL Buffer (Mg 2+ plus) 10μl, dNTP 4μl (each dNTP 2.5mM), DNA template 1μl (20ng / μl), primers (10μM) 1μl each, PrimeSTAR GXL DNA Polymerase (1.25U / μl) 0.5μl, distilled water 32.5μl, the total volume is 50μl.

[0076] The amplification conditions were pre-denaturation at 98°C for 2 minutes (1 cycle); denaturation at 98°C for 10 seconds, annealing at 55°C for 15 seconds, and extension at 68°C for 50 seconds (30 cycles); and extension at 68°C for 5 minutes (1 cycle).

[0077] The PCR amplification product was digested with restriction endonuclease DpnI and reacted at 37°C for 2 hours. The PCR product was recovered using agarose gel to obtain the pSC100 vector backbone.

[0078] 2. Amplify the gene hdpA encoding dihydroxyacetone phosphate phosphatase CgHdpA

[0079] The hdpA gene (GeneBank No: CAF20597.1, 27-FEB-2015) of Corynebacterium glutamicum ATCC13032 was used as the starting hdpA gene of this embodiment and was synthesized at GenScript Biotech Co., Ltd. (hdpA gene). The gene encodes a protein dihydroxyacetone phosphate phosphatase (CgHdpA) which will be used as the starting dihydroxyacetone phosphate phosphatase of this embodiment. The amino acid sequence of dihydroxyacetone phosphate phosphatase (CgHdpA) is shown in Sequence 1 in the sequence table, and the nucleotide sequence of the encoding gene hdpA gene is shown in Sequence 2 in the sequence table.

[0080] Using the hdpA gene shown in SEQ ID NO: 2 as a template, PCR amplification was performed using primer pair HdpA-CF / HdpA-CR to obtain an hdpA gene fragment of 878 bp.

[0081] HdpA-CF:

[0082] 5'-TATAATTGAGCCTCTCGCCCCACCAATTCGGTTTAAACCAGGAAACAGCTATGACAGTAAACATATCATACCTAACTGA-3'

[0083] HdpA-CR:

[0084] 5'-AGTTCCCTACTCTCGCATGGGGTTTAATCGGTAAATTGCTGTTCGTC-3'.

[0085] Amplification system: 5× PrimeSTAR GXL Buffer (Mg 2+ plus) 10μl, dNTP 4μl (each dNTP 2.5mM), DNA template 1μl (20ng / μl), primers (10μM) 1μl each, PrimeSTAR GXL DNA Polymerase (1.25U / μl) 0.5μl, distilled water 32.5μl, the total volume is 50μl.

[0086] The amplification conditions were 98°C pre-denaturation for 2 minutes (1 cycle); 98°C denaturation for 10 seconds, 55°C annealing for 15 seconds, 68°C extension for 50 seconds (30 cycles); 68°C extension for 5 minutes (1 cycle). The PCR product was recovered using agarose gel.

[0087] 3. Construction of plasmid pSC100-CgHdpA

[0088] The pSC100 vector backbone obtained in 1 above and the hdpA gene fragment obtained in 2 above were subjected to PCR rolling circle amplification and ligated to obtain a PCR amplification product.

[0089] Amplification system: 5× PrimeSTAR GXL Buffer (Mg 2+ plus) 10 μl, dNTP 4 μl (each dNTP 2.5 mM), pSC100 vector backbone 2 μl, hdpA gene fragment 2 μl, PrimeSTAR GXL DNA Polymerase (1.25 U / μl) 0.5 μl, distilled water 31.5 μl, the total volume is 50 μl.

[0090] The amplification conditions were pre-denaturation at 98°C for 2 minutes (1 cycle); denaturation at 98°C for 10 seconds, annealing at 60°C for 15 seconds, and extension at 68°C for 3 minutes (30 cycles); and extension at 68°C for 5 minutes (1 cycle).

[0091] Dilute the PCR amplification product 5 times and heat-shock transform Trans1-T1 Phage Resistant chemical competent cells: add the ligation product to 50μl Trans1-T1 chemical competent cells, ice bath for 30 minutes, heat shock at 42℃ for 30 seconds, immediately put on ice for 2 minutes, add 250μl LB liquid culture medium, incubate at 200rpm, 37℃ for 1 hour. The transformed cells are coated with LB solid culture medium plates containing ampicillin (final concentration of 50μg / ml) and cultured at 37℃ overnight. Pick 10 clones, use primers pSC-YZ-up / pSC-YZ-down for strain PCR, extract plasmids for sequencing analysis:

[0092] pSC-YZ-up:5'-GGCACCTGAGTCGCTGTCTTTTT-3'

[0093] pSC-YZ-down: 5'-CCAGTTTGCTCAGGCTCTCCCA-3'

[0094] This plasmid is a plasmid in which the hdpA gene fragment (the product of PCR amplification of HdpA-CF and HdpA-CR using sequence 2 as a template) is inserted into the pSC100 backbone vector. 10 The promoter (sequence 4) was located downstream, and the other sequences of the pSC100 vector were kept unchanged to obtain a recombinant expression vector named pSC100-CgHdpA.

[0095] Example 2: Screening for dominant mutations of dihydroxyacetone phosphate phosphatase CgHdpA using a growth-coupled method

[0096] Figure 1 The flowchart for screening of dihydroxyacetone phosphate phosphatase CgHdpA mutants.

[0097] 1. Construction of growth-coupled screening host strain TZ-238

[0098] First, it is necessary to construct a growth-coupled screening host strain to construct a screening platform strain for the construction of a mutant plasmid library of dihydroxyacetone phosphate phosphatase CgHdpA. The construction of the growth-coupled screening host strain starts from the 1,3-dihydroxyacetone-producing engineering strain TZ-237, and uses a two-step homologous recombination method to knock out the hdpA gene inserted on the chromosome of the strain (located at poxB and pflB, respectively) to obtain recombinant Escherichia coli TZ-238, which specifically includes the following 4 steps:

[0099] 1) Using pACYC184 plasmid as template, amplify the homologous recombination fragment poxB-Cm

[0100] PCR amplification using primers poxB-Cm-up / poxB-Cm-down:

[0101] poxB-Cm-up:

[0102] AAACCCACCCACAAGAGCTATTCCGCGAATGTAGTCACTATTGCGAGCTGGTTTCTGTGACGGAAGATCACTTCGCA

[0103] poxB-Cm-down:

[0104] CGTCACAGGTGAAAATAGCGTCATCGGCGGCAAAATGACTAATTTGCTGCGCCAGTTACGCCCCGCCCTGCCACT

[0105] Amplification system: 5× PrimeSTAR GXL Buffer (Mg 2+ plus) 10μl, dNTP 4μl (each dNTP 2.5mM), DNA template 1μl (20ng / μl), primers (10μM) 1μl each, PrimeSTAR GXL DNA Polymerase (1.25U / μl) 0.5μl, distilled water 32.5μl, the total volume is 50μl.

[0106] The amplification conditions were pre-denaturation at 98°C for 2 minutes (1 cycle); denaturation at 98°C for 10 seconds, annealing at 54°C for 15 seconds, and extension at 68°C for 40 seconds (30 cycles); and extension at 68°C for 5 minutes (1 cycle).

[0107] PCR amplification obtained a 966 bp DNA fragment poxB-Cm. poxB-Cm contains a DNA fragment of the chloramphenicol gene and its promoter and a 55 bp homologous recombination fragment on the left and right of the poxB gene knockout. The nucleotide sequence of the poxB-Cm is shown in Sequence 5.

[0108] The DNA fragment poxB-Cm was used for homologous recombination: first, the plasmid pKD46 was transformed into the 1,3-dihydroxyacetone-producing engineering strain TZ-237 by electroporation, and then the DNA fragment poxB-Cm was electroporated into the 1,3-dihydroxyacetone-producing engineering strain TZ-237 carrying the plasmid pKD46.

[0109] The electroporation and screening process is as follows: first, prepare electroporation competent cells of the engineering strain TZ-237 producing 1,3-dihydroxyacetone with plasmid pKD46, and refer to "Dower, WJ, Miller, JF, Ragsdale, CW, 1988. High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res. 16, 6127-45"; place 50 μl of electroporation competent cells of the engineering strain TZ-237 producing 1,3-dihydroxyacetone with plasmid pKD46 on ice, add 50 ng of DNA fragment poxB-Cm, place on ice for 2 minutes, and transfer to a 2 mm Bio-Rad electroporation cup. Use MicroPulser (Bio-Rad) electroporator, and the electroporation parameter is 2.5 kV. After the electroporation, quickly transfer 1 ml of LB liquid culture medium to the electroporation cup, pipette 5 times, and then transfer to a test tube, incubate at 75 rpm and 30°C for 4 hours. Take 200 μl of the incubated bacterial solution and apply it on a plate of LB solid culture medium containing ampicillin (final concentration of 50 μg / ml) and chloramphenicol (final concentration of 34 μg / ml). After overnight incubation at 30°C, select 10 single colonies for PCR verification, using primers Cm-YZ-up / poxB-YZ-down for verification:

[0110] Cm-YZ-up: 5'-CTACACATATATTCGCAAGATGTGGCGTG-3'

[0111] poxB-YZ-down: 5'-CAAAGTTTGTGTCGTGTAGTTCGGTGC-3'

[0112] The amplification system is: 10 μl of PCR SuperMix (+ dye), 1 μl of each primer (10 μM), 8 μl of distilled water, the total volume is 20 μl, and a single colony is picked and inoculated into the system.

[0113] The amplification conditions were pre-denaturation at 94°C for 5 minutes (1 cycle); denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 40 seconds (30 cycles); and extension at 72°C for 5 minutes (1 cycle).

[0114] The PCR amplification product was detected by agarose gel electrophoresis, and a DNA band of 1198 bp was correctly cloned. The single colony verified by sequencing was named TZ-237 (poxB-Cm).

[0115] 2) Using pET30a plasmid (Novagen, catalog number: 69909) as a template, amplify the homologous recombination fragment pflB-Kan

[0116] PCR amplification of pflB-Kan-up / pflB-Kan-down using primers:

[0117] pflB-Kan-up:

[0118] TGGTTGTCGAAGTACGCAGTAAATAAAAAATCCACTTAAGAAGGTAGGTGTTACGAAGATCCTTTGATCTTTTCTACGGG

[0119] pflB-Kan-down:

[0120] CTTTCGTGGAGCCTTTATTGTACGCTTTTTACTGTACGATTTCAGTCAAATCTAATTAGAAAAACTCATCGAGCATCAAATG

[0121] Amplification system: 5× PrimeSTAR GXL Buffer (Mg 2+ plus) 10μl, dNTP 4μl (each dNTP 2.5mM), DNA template 1μl (20ng / μl), primers (10μM) 1μl each, PrimeSTAR GXL DNA Polymerase (1.25U / μl) 0.5μl, distilled water 32.5μl, the total volume is 50μl.

[0122] The amplification conditions were pre-denaturation at 98°C for 2 minutes (1 cycle); denaturation at 98°C for 10 seconds, annealing at 54°C for 15 seconds, and extension at 68°C for 40 seconds (30 cycles); and extension at 68°C for 5 minutes (1 cycle).

[0123] PCR amplification obtained a 1046 bp DNA fragment pflB-Kan. pflB-Kan contains a DNA fragment of the kalamycin gene and its promoter and a 55 bp homologous recombination fragment on the left and right of the knockout pflB gene. The nucleotide sequence of the pflB-Kan is shown in Sequence 6.

[0124] The DNA fragment pflB-Kan was used for homologous recombination: first, the engineering strain TZ-237 (poxB-Cm) carrying the plasmid pKD46 was used to prepare electroporation competent cells, and then the DNA fragment pflB-Kan was electroporated into the engineering strain TZ-237 (poxB-Cm) carrying the plasmid pKD46 for electroporation competent cells.

[0125] The electroporation and screening process is as follows: first, prepare electroporation competent cells of the engineering strain TZ-237 producing 1,3-dihydroxyacetone with plasmid pKD46, and refer to "Dower, WJ, Miller, JF, Ragsdale, CW, 1988. High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res. 16, 6127-45"; place 50 μl of electroporation competent cells of the engineering strain TZ-237 (poxB-Cm) with plasmid pKD46 on ice, add 50 ng of DNA fragment pflB-Kan, place on ice for 2 minutes, and transfer to a 2 mm Bio-Rad electroporation cup. Use MicroPulser (Bio-Rad) electroporator, and the electroporation parameter is 2.5 kV. After the electroporation, quickly transfer 1 ml of LB liquid culture medium to the electroporation cup, pipette 5 times, and then transfer to a test tube, incubate at 75 rpm and 30°C for 4 hours. Take 200 μl of the incubated bacterial solution and apply it on a plate containing LB solid culture medium containing karatomycin (final concentration of 50 μg / ml) and chloramphenicol (final concentration of 34 μg / ml). After overnight incubation at 30°C, select 10 single colonies for PCR verification, using primers Kan-YZ-up / pflB-YZ-down for verification:

[0126] Kan-YZ-up: 5'-GAGTGATTTTGATGACGAGCGTAATGGC-3'

[0127] pflB-YZ-down:5'-ACAGGATTCAAAGGAGTGAATGCGAC-3'

[0128] The amplification system is: 10 μl of PCR SuperMix (+ dye), 1 μl of each primer (10 μM), 8 μl of distilled water, the total volume is 20 μl, and a single colony is picked and inoculated into the system.

[0129] The amplification conditions were pre-denaturation at 94°C for 5 minutes (1 cycle); denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 40 seconds (30 cycles); and extension at 72°C for 5 minutes (1 cycle).

[0130] The PCR amplification product was detected by agarose gel electrophoresis, and a DNA band of 558 bp was correctly cloned. The single colony verified by sequencing was named TZ-238.

[0131] Strain TZ-238 was generated by replacing the poxB position on the chromosome of TZ-237 with P T7 -hdpA gene (positions 56-1158 in sequence 9) was replaced with Cm promoter + chloramphenicol gene (positions 56-911 in the poxB-Cm sequence shown in sequence 5), and the P at the pflB position was replaced with T7 -hdpA gene (positions 56-1158 in SEQ ID NO: 11) was replaced with Kan promoter + kalamycin gene (positions 56-991 in SEQ ID NO: 6).

[0132] 2. Construction of HdpA mutant library using error-prone PCR method

[0133] The specific steps are as follows:

[0134] 1) Amplify the pSC100 vector backbone

[0135] The recombinant plasmid pSC100-CgHdpA in Example 1 was used as a template and amplified using the primer pair pSC100-F / pSC100-R.

[0136] pSC100-F:AGCTGTTTCCTGGTTTAAACCGAATTGG

[0137] pSC100-R:CCCCATGCGAGAGTAGGGAACT

[0138] Amplification system: 5× PrimeSTAR GXL Buffer (Mg 2+ plus) 10μl, dNTP 4μl (2.5mM of each dNTP), pSC100-CgHdpA template 1μl (20ng / μl), primers (10μM) 1μl each, PrimeSTAR GXL DNA Polymerase (1.25U / μl) 0.5μl, distilled water 32.5μl, the total volume is 50μl.

[0139] The amplification conditions were pre-denaturation at 98°C for 2 minutes (1 cycle); denaturation at 98°C for 10 seconds, annealing at 54°C for 15 seconds, and extension at 68°C for 90 seconds (30 cycles); and extension at 68°C for 5 minutes (1 cycle).

[0140] The 3500 bp DNA fragment pSC100 vector backbone was obtained by PCR amplification. The PCR amplification product was digested with restriction endonuclease DpnI, reacted at 37°C for 2 hours, and the PCR product was recovered by agarose gel.

[0141] 2) Error-prone PCR amplification of CgHdpA mutant fragment

[0142] The recombinant plasmid pSC100-CgHdpA in Example 1 was used as a template and the primer pair CgHdpA-p100-CF / CgHdpA-pSC-CR was used.

[0143] CgHdpA-p100-CF:

[0144] CCAATTCGGTTTAAACCAGGAAACAGCTATGACAGTAAACATATCATACCTAACTGA

[0145] CgHdpA-pSC-CR:

[0146] AGTTCCCTACTCTCGCATGGGGTTAATCGGTAAATTGCTGTTCGTC

[0147] Error-prone PCR reaction system: Taq PCR Buffer 10X buffer 5μl, dNTP (10mM) 1μl, dATP (10mM) 2μl, dTTP (10mM) 2μl, MnCl2 (25mM) 1μl, primers (10μM) 1μl each, pSC100-CgHdpA template (10ng / μl), Taq DNA polymerase (2.5U / μl) 1μl, and the rest is water, the total volume is 50μl.

[0148] Error-prone PCR amplification conditions: pre-denaturation at 94°C for 3 minutes (1 cycle); denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1 minute (35 cycles); extension at 72°C for 10 minutes (1 cycle).

[0149] The 878 bp CgHdpA mutant fragment was obtained by error-prone PCR amplification. The template plasmid was digested with restriction endonuclease DpnI and reacted at 37°C for 2 hours. The CgHdpA mutant fragment was recovered by agarose gel.

[0150] 3) PCR amplification reaction

[0151] After the CgHdpA mutant fragment obtained in 2) was recovered by agarose gel electrophoresis, the pSC100 vector backbone obtained in 1) was subjected to PCR amplification reaction together with the CgHdpA mutant fragment to obtain a PCR ligation product, which was the CgHdpA mutant library (abbreviated as pSC100-mCgHdpA).

[0152] Amplification system: 5× PrimeSTAR GXL Buffer (Mg 2+plus) 10 μl, dNTP 4 μl (2.5 mM of each dNTP), pSC100 vector backbone 5 μl (50 ng / μl), CgHdpA mutant fragment 5 μl (100 ng / μl), PrimeSTAR GXLDNA Polymerase (1.25 U / μl) 0.5 μl, distilled water 25.5 μl, the total volume is 50 μl.

[0153] Amplification conditions were as follows: pre-denaturation at 98°C for 2 minutes (1 cycle); denaturation at 98°C for 10 seconds, annealing at 54°C for 15 seconds, and extension at 68°C for 2 minutes (35 cycles); and extension at 68°C for 5 minutes (1 cycle).

[0154] The 4343 bp ligation product pSC100-mCgHdpA was obtained by PCR amplification.

[0155] 3. Screening of CgHdpA mutant library using growth-coupled method

[0156] The PCR ligation product obtained in step 3) of step 2 was diluted 5 times and then transformed into competent cells of the screening host strain TZ-238 obtained in step 1. The transformed cells were spread on M9 solid culture medium containing ampicillin (final concentration of 50 μg / ml) and cultured overnight at 37°C. The library capacity was 300,000 CFU / μg DNA. The colony size was observed. The cloned strains of the dihydroxyacetone phosphate phosphatase HdpA mutant with complete catalytic function could grow normally, the cloned strains of the dihydroxyacetone phosphate phosphatase HdpA mutant with inactive activity could not grow, the cloned strains of the dihydroxyacetone phosphate phosphatase HdpA mutant with reduced activity grew weakly and had a small colony diameter, and the cloned strains of the dihydroxyacetone phosphate phosphatase HdpA mutant with increased activity grew normally and had a large colony diameter.

[0157] The clone strains with normal growth and larger colony diameter were selected as the strains containing mutants.

[0158] The mutant-containing strain was cultured using a 96-well deep-well plate, and the cloned strain containing the starting gene dihydroxyacetone phosphate phosphatase HdpA (i.e., the recombinant bacteria obtained by transferring the pSC100-CgHdpA plasmid into TZ-238) was used as a control to screen and compare the growth differences between the mutant-containing strain and the control group. The specific steps are as follows:

[0159] (1) 96-well deep-well plate culture: The control group clones and mutant-containing strain clones with larger colony diameters were selected and inoculated into a 96-well deep-well plate (500 μl medium, 2000 μl volume) containing ampicillin (final concentration of 50 μg / ml) and M9 liquid medium. At the same time, they were inoculated into an LB solid medium plate containing ampicillin (final concentration of 50 μg / ml) as a backup and cultured overnight at 37°C and 1000 rpm.

[0160] (2) ELISA detection: Use an 8-channel pipette (50-300 μl) to aspirate 200 μl of bacterial solution and add it to a 96-well microplate. Place the plate in an ELISA reader (TECAN, Switzerland) to detect the OD600nm value of the bacterial solution and select the mutant-containing clones with values ​​greater than those of the control group.

[0161] (3) Growth curve rescreening: The control group clones and the selected mutant-containing strain clones were inoculated into a 48-well deep-well plate (500 μl medium, 5000 μl volume) containing ampicillin (final concentration of 50 μg / ml) and M9 liquid culture medium, and placed in the MicroScreen high-throughput microbial growth analysis system (MicroScreen-HT, Jie Ling Instrument, Tianjin, China), and cultured overnight at 37°C and 1000 rpm. The OD600nm value was set to be detected every 1 hour, and the growth curve of each group of clones was automatically drawn to calculate the specific growth rate μ (h -1 ), and select strains containing mutants with μ values ​​higher than those of the control group.

[0162] Specific growth rate μ: The amount of bacteria added per unit mass of bacteria per hour is called the specific growth rate of bacteria. It is a parameter that characterizes the growth rate of microorganisms and is also an important parameter in fermentation kinetics.

[0163] The calculation formula is: μ = [ln (N2 / N1)] / t

[0164] μ——Specific growth rate, unit: h-1

[0165] t——time, unit: h

[0166] N2——the number of microbial cells at any time

[0167] N1——the amount of biological cells after starting to culture for t time

[0168] 4. Construction of HdpA mutant library using DNA shuffling method

[0169] 1) Obtaining mHdpA mutant fragments using DNA shuffling

[0170] The strains containing mutants whose μ values ​​obtained from the 3rd screening were higher than those of the control group were selected, and plasmids were extracted and recorded as mHdpA mutant plasmids, which were sent to a sequencing company for sequencing analysis (GENEWIZ, Suzhou). mHdpA mutant plasmids containing different mutation sites were selected, and different mHdpA mutant fragments were amplified using the primer pair pSC-YZ-F / pSC-YZ-F:

[0171] pSC-YZ-F:GGCACCTGAGTCGCTGTCTTTTT

[0172] pSC-YZ-F:CCAGTTTGCTCAGGCTTCCCCA

[0173] The amplification system is: PCR SuperMix (+dye) 25 μl, template plasmid 1 μl, primers (10 μM) 1 μl each, distilled water 22 μl, the total volume is 50 μl.

[0174] The amplification conditions were pre-denaturation at 94°C for 5 minutes (1 cycle); denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 40 seconds (30 cycles); and extension at 72°C for 5 minutes (1 cycle).

[0175] The PCR amplification product was detected by agarose gel electrophoresis, and the correct clone had a DNA band of 1278 bp. The mutant fragments were recovered by agarose gel electrophoresis.

[0176] Different mutant fragments were mixed in equal amounts and DNA shuffling experiments were performed. For specific experimental steps, please refer to the reference "Zhang C, Chen Q, Fan F, Tang J, Zhan T, Wang H, Zhang X. Directed evolution of alditoloxidase for the production of optically pure D-glycerate from glycerol in the engineered Escherichia coli. J Ind Microbiol Biotechnol. 2021 Aug 24; 48(7-8): kuab041".

[0177] 2) Construction of DNA shuffling library

[0178] The mHdpA mutant fragments (mixed fragments of different mutants) obtained in 1) were subjected to PCR amplification and ligation reaction with the pSC100 vector, and the specific steps were the same as 3) in 2 to construct a DNA shuffle library of mHdpA.

[0179] 3) Screening of DNA shuffling library

[0180] The PCR ligation product obtained in 2) was diluted 5 times and transformed into the competent cells of the screening host strain TZ-238 obtained in 1. The screening steps of the DNA shuffling library were the same as 3, and the strain clones containing mutants with larger colony diameters were selected and recorded as the screening host strain TZ-238 carrying the plasmid of the dihydroxyacetone phosphate phosphatase HdpA mutant.

[0181] 5. Screening of dominant mutants of dihydroxyacetone phosphate phosphatase HdpA through the production of 1,3-dihydroxyacetone

[0182] The screening host strain TZ-238 carrying the recombinant plasmid pSC100-HdpA with the starting gene was used as the control group, and the screening host strain TZ-238 carrying the plasmid of the dihydroxyacetone phosphate phosphatase HdpA mutant was tested and compared in shake flask fermentation to produce 1,3-dihydroxyacetone. The specific steps are as follows:

[0183] (1) Seed culture: A single clone to be tested was selected and inoculated into a small test tube (15 mm × 100 mm) containing 3 ml of LB liquid culture medium containing ampicillin (final concentration of 50 μg / ml), and cultured overnight at 37°C and 250 rpm to obtain a seed solution for inoculation of the fermentation medium.

[0184] (2) Expansion culture: The seed culture solution was inoculated into 50 ml CM9 liquid culture medium (250 ml Erlenmeyer flask) at an inoculum volume of 1% (V / V) and cultured at 37° C. and 250 rpm for 48 h.

[0185] (3) Analysis method: Take 2 ml of the bacterial solution cultured in step (2), centrifuge at 13,000 rpm for 2 min, collect the supernatant, transfer 100 μl of the supernatant into 900 μl of sterile water, dilute 10 times, filter the supernatant using a 0.22 μm inorganic filter membrane, and analyze the content of 1,3-dihydroxyacetone using high performance liquid chromatography (HPLC).

[0186] After filtering the supernatant, the yield of 1,3-dihydroxyacetone was analyzed by HPLC. The 1,3-dihydroxyacetone standard was purchased from Shanghai Myrel Biochemical Technology Co., Ltd., with the product catalog number B66080-500G. The elution time of 1,3-dihydroxyacetone was 9.5 min. The equation of the standard curve for quantitative detection of 1,3-dihydroxyacetone by HPLC was: y=346656x+12665, R2=0 9999. The filtered supernatant was diluted a certain multiple and then subjected to HPLC quantitative detection. The peak area obtained by the detection was the y value, which was substituted into the 1,3-dihydroxyacetone standard curve equation to obtain the x value, which was multiplied by the dilution multiple to obtain the yield.

[0187] HPLC detection conditions: using Yuexu The fermentation products were analyzed by HPLC using Sugar-Ca chromatographic column. The column temperature was controlled at 70°C, the mobile phase was 0.5g / L EDTA-Ca aqueous solution, the flow rate was 0.4ml / min, the injection volume of each sample was 20μl, and the detection time was 30 minutes.

[0188] 6. Evaluation of 1,3-dihydroxyacetone production by dihydroxyacetone phosphate phosphatase HdpA mutant

[0189] The six advantageous mutants obtained from the first round of error-prone PCR mutation library and the second to fifth rounds of DNA shuffling libraries were subjected to shake flask fermentation and 48-well plate culture, respectively, for 1,3-dihydroxyacetone production determination, specific growth rate μ value calculation and growth curve analysis. The analysis method was the same as the 1,3-dihydroxyacetone content analysis method in step 5, and the specific growth rate μ value calculation and growth curve analysis method were the same as step 3.

[0190] 1,3-Dihydroxyacetone production Figure 2 , where WT is the screening host strain TZ-238 carrying the recombinant plasmid pSC100-HdpA carrying the starting gene, EP1-E12, SF2-5, SF3-16, SF4-4B4, SF5-21, and SF6-11 represent the screening host strains carrying the plasmid of dihydroxyacetone phosphate phosphatase HdpA mutant. It can be seen that the yields of the six screening host strains carrying the plasmid of dihydroxyacetone phosphate phosphatase HdpA mutant are all higher than that of the screening host strain TZ-238 carrying the recombinant plasmid pSC100-HdpA carrying the starting gene. The specific growth rate μ value of the screening host strain carrying the HdpA mutant plasmid was also improved in each round. The 1,3-dihydroxyacetone production of the screening host strain carrying the HdpA mutant plasmid SF6-11 of the dihydroxyacetone phosphate phosphatase was the highest, reaching 4.54±0.09 g / L, which was 1.65 times higher than that of the screening host strain TZ-238 carrying the recombinant plasmid pSC100-HdpA carrying the starting gene (Table 3). The specific growth rate μ value of the screening host strain carrying the HdpA mutant plasmid SF6-11 of the dihydroxyacetone phosphate phosphatase was also the highest, reaching 0.39±0.002 h -1 Compared with the screening host strain TZ-238 carrying the recombinant plasmid pSC100-HdpA carrying the starting gene, the production of 1,3-dihydroxyacetone was increased by 1.86 times (Table 3). Table 3 is the evaluation of the screening host strain carrying the plasmid of dihydroxyacetone phosphate phosphatase HdpA mutant.

[0191] Control and mutant DHA(g / L) <![CDATA[μ(h -1 )]]> HkDJ 2.75±0.07 0.21±0.018 SF6-11 4.54±0.09 0.39±0.002

[0192] The first column in the above table is the name of the screening host strain carrying the SF6-11 plasmid of the dihydroxyacetone phosphate phosphatase HdpA mutant, which is replaced by the name of the mutant protein.

[0193] The amino acid sequence of the mutant SF3-16 is shown in SEQ ID NO:7.

[0194] 7. Analysis of mutation sites of dihydroxyacetone phosphate phosphatase HdpA mutant

[0195] The gene sequencing analysis of the dihydroxyacetone phosphate phosphatase mutant SF6-11 was performed. Compared with the starting hdpA gene of sequence 2 in the sequence list and the HdpA encoded by it (sequence 1 in the sequence list, starting dihydroxyacetone phosphate phosphatase), the nucleotide change information and mutation site amino acid summary of the mutant SF6-11 are shown in Table 4.

[0196] Table 4 shows the sequence analysis of the HdpA mutant of the dihydroxyacetone phosphate phosphatase mutant

[0197]

[0198] In the second and third columns of the above table, in the nucleotide changes and amino acid changes, the numbers represent the mutation positions, the nucleotides or amino acid residues before the numbers represent the nucleotides or amino acid residues before the mutation, and the nucleotides or amino acid residues after the numbers represent the nucleotides or amino acid residues after the mutation.

[0199] The mutant SF6-11 gene is a mutant gene obtained by replacing the nucleotide at position 189 of the CDS (sequence 2) of the HdpA gene with G, the nucleotide at position 191 with A, the nucleotide at position 234 with G, the nucleotide at position 253 with C, the nucleotide at position 273 with G, the nucleotide at position 318 with G, the nucleotide at position 320 with T, the nucleotide at position 372 with G, the nucleotide at position 374 with T, the nucleotide at position 576 with A, and the nucleotide at position 859 with G, while keeping the other nucleotides of HdpA unchanged.

[0200] The amino acid sequence of mutant SF6-11 is sequence 3, which is a mutant protein obtained by subjecting the HdpA protein (sequence 1) to the following mutations: M21V, N36D, L42P, T49A, I64V, S82G, T150S, H244R, while keeping the other amino acid residues of the HdpA protein unchanged.

[0201] Example 3: Application of mutant SF6-11 in increasing the yield of 1,3-dihydroxyacetone

[0202] 1. Construction of recombinant vector pSC100-SF6-11

[0203] The recombinant vector pSC100-SF6-11 was constructed according to the method in Example 1.

[0204] 1. Amplify the pSC100 vector backbone

[0205] Same as 1 of Example 1;

[0206] 2. Amplification of the gene encoding the CgHdpA mutant SF6-11 of dihydroxyacetone phosphate phosphatase

[0207] It is basically the same as Example 1, except that:

[0208] Using the coding gene of the CgHdpA mutant SF6-11 shown in SEQ ID NO: 3 as a template, PCR amplification was performed using primer pair HdpA-CF / HdpA-CR to obtain a 878 bp SF6-11 gene fragment.

[0209] HdpA-CF:

[0210] 5'-TATAATTGAGCCTCTCGCCCCACCAATTCGGTTTAAACCAGGAAACAGCTATGACAGTAAACATATCATACCTAACTGA-3'

[0211] HdpA-CR:

[0212] 5'-AGTTCCCTACTCTCGCATGGGGTTTAATCGGTAAATTGCTGTTCGTC-3'.

[0213] 3. Construction of plasmid pSC100-SF6-11

[0214] The SF6-11 gene fragment of 2 and the vector backbone of 1 were connected according to method 3 of Example 1 to obtain the recombinant vector pSC100-SF6-11.

[0215] The recombinant vector pSC100-SF6-11 is a vector in which the nucleotide sequence of the protein shown in SEQ ID NO:3 (mutant SF6-11 gene) is inserted into the pSC100 vector. 10 The recombinant expression vector with other sequences of the pSC100 vector unchanged downstream of the promoter was named pSC100-SF6-11.

[0216] 2. Construction of recombinant bacteria

[0217] The above-mentioned recombinant vector pSC100-SF6-11 and the recombinant plasmid pSC100-HdpA in Example 1 were respectively introduced into the host strain TZ-238 constructed in Example 2 to obtain recombinant bacteria TZ-238 / pSC100-SF6-11 and recombinant bacteria TZ-238 / pSC100-HdpA.

[0218] 3. Fermentation production of 1,3-dihydroxyacetone

[0219] The specific steps are as follows:

[0220] 1. Seed culture: Pick the recombinant bacteria TZ-238 / pSC100-SF6-11 and the recombinant bacteria TZ-238 / pSC100-HdpA monoclonal to be tested respectively, inoculate them into small test tubes (15 mm×100 mm) containing 3 ml of LB liquid culture medium containing ampicillin (final concentration of 50 μg / ml), and culture them overnight at 37°C and 250 rpm to obtain seed liquid for inoculation of fermentation medium.

[0221] 2. Expanded culture: Inoculate each seed culture solution into 50 ml CM9 medium (250 ml Erlenmeyer flask) at an inoculum volume of 1% (V / V), culture at 37° C. and 250 rpm for 48 h, and collect the bacterial solution.

[0222] 3. Analysis method: Take 2 ml of the bacterial solution after culture in step 2, centrifuge at 13,000 rpm for 2 min to collect the supernatant, transfer 100 μl of the supernatant into 900 μl of sterile water, dilute 10 times, filter the supernatant using a 0.22 μm inorganic filter membrane, and use high performance liquid chromatography (HPLC) to analyze the yield of 1,3-dihydroxyacetone (same as 5 in Example 2).

[0223] The growth rates of the recombinant bacteria TZ-238 / pSC100-SF6-11 and the recombinant bacteria TZ-238 / pSC100-HdpA monoclonal were detected according to the method of 3 of Example 2.

[0224] The results are as follows: The recombinant bacteria TZ-238 / pSC100-SF6-11 had the highest 1,3-dihydroxyacetone production, reaching 4.54±0.09 g / L, which was 1.65 times higher than that of TZ-238 / pSC100-HdpA (Table 3). The specific growth rate μ value of the recombinant bacteria TZ-238 / pSC100-SF6-11 was also the highest, reaching 0.39±0.002 h -1 , which was 1.86 times higher than that of TZ-238 / pSC100-HdpA. The only difference between the two strains was the coding gene of HdpA gene (sequence 2) and HdpA mutant SF6-11 (sequence 3).

[0225] Therefore, it can be seen that the HdpA mutant SF6-11 can produce or increase the yield of 1,3-dihydroxyacetone, and mutating the HdpA gene to the gene encoding the HdpA mutant SF6-11 can increase the yield of 1,3-dihydroxyacetone and also increase the growth rate of the strain.

[0226] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A mutant protein of dihydroxyacetone phosphate phosphatase, which is A1 or A2 or A3 as follows: The protein described in A1) is a protein having dihydroxyacetone phosphate phosphatase activity obtained by mutating residues 21, 36, 42, 49, 64, 82, 150 and 244 of the amino acid sequence of dihydroxyacetone phosphate phosphatase corresponding to SEQ ID NO: 1, while keeping other amino acid residues unchanged; The protein described in A2) is a fusion protein obtained by connecting the protein described in A1 with a protein having a targeting function; The protein described in A3) is a protein derived from A1 with a tag sequence added to the end of the amino acid sequence of the protein described in A1 and having dihydroxyacetone phosphate phosphatase activity.

2. The protein according to claim 1, characterized in that: The mutations are: mutating the 21st M to V, the 36th N to D, the 42nd L to P, the 49th T to A, the 64th I to V, the 82nd S to G, the 150th T to S and the 244th H to R corresponding to the amino acid sequence shown in sequence 1.

3. The protein according to claim 1 or 2, characterized in that: The amino acid sequence of the dihydroxyacetone phosphate phosphatase mutant protein is shown in Sequence 3 of the sequence listing.

4. The protein-related biological material according to any one of claims 1 to 3, characterized in that: The relevant biological material is any one of the following B1) to B8): B1) a nucleic acid molecule encoding the mutant protein; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1); B4) a recombinant vector containing the expression cassette described in B2); B5) a recombinant microorganism containing the nucleic acid molecule described in B1); B6) a recombinant microorganism containing the expression cassette described in B2); B7) a recombinant microorganism containing the recombinant vector described in B3); B8) A recombinant microorganism containing the recombinant vector described in B4).

5. The related biological material according to claim 4, characterized in that: The recombinant microorganism is Escherichia coli.

6. The recombinant microorganism according to claim 4 or 5, characterized in that: The recombinant microorganism is prepared according to a method comprising the following steps: introducing a gene encoding the protein described in any one of claims 1 to 3 into the host bacteria to obtain a recombinant microorganism.

7. Use of the protein according to any one of claims 1 to 3 in the preparation of 1,3-dihydroxyacetone.

8. Use of the nucleic acid molecule, expression cassette, recombinant vector or recombinant microorganism according to claim 4 in producing 1,3-dihydroxyacetone or increasing the yield of 1,3-dihydroxyacetone.

9. A method for producing 1,3-dihydroxyacetone or increasing the yield of 1,3-dihydroxyacetone, comprising the following steps: fermenting and culturing the recombinant microorganism according to any one of claims 4 to 7 to obtain 1,3-dihydroxyacetone.

10. Use of a substance in which the amino acid sequence of dihydroxyacetone phosphate phosphatase is mutated to correspond to the 21st, 36th, 42nd, 49th, 64th, 82nd, 150th and 244th amino acid residues of the amino acid sequence shown in SEQ ID NO: 1 in producing 1,3-dihydroxyacetone or increasing the yield of 1,3-dihydroxyacetone.

Images