N-acetyl glucosamine 2-epimerase mutant as well as preparation and application thereof

Abstract

The invention discloses an N-acetyl glucosamine 2-epimerase mutant as well as preparation and application of the N-acetyl glucosamine 2-epimerase mutant. The mutant enzyme comprises an amino acid sequence as shown in SEQ ID No.3. The preparation method comprises the following steps: by taking a recombinant vector containing a Sumo enhancing element and a wild type N-acetyl glucosamine 2-epimerase gene as a template, carrying out PCR (Polymerase Chain Reaction) by adopting a mutation primer to obtain a mutant gene segment; transforming the mutant gene segment into an engineering bacterium to obtain a recombinant bacterium for expressing the N-acetyl glucosamine 2-epimerase mutant protein; culturing recombinant bacteria, collecting and crushing thalli, centrifuging thallus crushing liquid, and taking supernatant, so as to obtain crude enzyme liquid containing the enzyme mutant; the thermal stability of the wild-type enzyme is improved through point mutation of specific amino acid sites, and the substrate affinity and the catalytic efficiency of the mutant are superior to those of the wild-type enzyme. The mutant can be used for efficient catalytic preparation of lactulose, and has the advantages of few byproducts, high product yield and the like.

Description

Technical Field

[0001] The present invention relates to an enzyme protein and its preparation and application, and in particular to an N-acetylglucosamine 2-epimerase mutant and its preparation and application in the catalytic preparation of lactulose. Background Art

[0002] Lactulose is composed of galactose and fructose linked by a β-1,4 glycosidic bond and is a high-value derivative of lactose. Due to its unique probiotic function, it has important application value in the fields of medicine, nutrition, and functional foods. Lactulose is metabolized in the intestine to generate low-molecular-weight organic acids, thereby promoting colonic peristalsis and relieving chronic constipation. In addition, lactulose also has the function of regulating the ammonia metabolism of intestinal flora and is used to treat hepatic encephalopathy. At present, the preparation of lactulose can be divided into chemical methods and biocatalytic methods. Acid-base synergistic catalysis is a common chemical method for producing lactulose. Under alkaline conditions, lactose is first catalyzed to form partial lactulose; then, by adding boric acid to the reaction system, a lactulose-borate complex is formed to drive the reaction in the direction favorable for lactulose formation; then, the pH of the reaction system is adjusted to acidic to decompose the complex into lactulose and boric acid; finally, the boric acid in the system is removed by using an ion exchange resin that specifically binds boric acid to achieve the production of lactulose. However, the chemical production of lactulose usually has the disadvantages of low conversion rate, generation of by-products, harsh reaction conditions, and complicated steps. Therefore, the production of lactulose based on the green, environmentally friendly, and efficient biocatalytic method has become a research hotspot.

[0003] Lactulose can be prepared by catalyzing the hydrolysis of lactose by β-galactosidase to generate galactose and glucose, and then adding fructose to the reaction system and using the transglycosylation activity of β-galactosidase to catalyze the galactosyl group to accept the fructosyl group through a β-1,4 glycosidic bond. However, adding an additional fructose substrate to the reaction system increases the production cost. Using the structural isomerization activity of cellobiose 2-epimerase to catalyze the conversion of the glucose moiety of lactose into a fructose moiety is a common biocatalytic strategy for preparing lactulose. However, there is currently no report on the production of lactulose by catalyzing lactose with N-acetylglucosamine 2-epimerase. Summary of the Invention

[0004] Object of the Invention: The object of the present invention is to provide an N - acetylglucosamine 2 - epimerase mutant with high thermal stability. Another object of the present invention is to propose a recombinant vector expressing the above - mentioned N - acetylglucosamine 2 - epimerase mutant and a recombinant bacterium containing the recombinant vector, so as to solve the problem of how to clone and recombinantly express the N - acetylglucosamine 2 - epimerase mutant protein. The third object of the present invention is to propose a preparation method of the N - acetylglucosamine 2 - epimerase mutant, so as to solve the problem of how to artificially prepare the above - mentioned N - acetylglucosamine 2 - epimerase mutant. The fourth object of the present invention is to provide the application of the above - mentioned N - acetylglucosamine 2 - epimerase mutant in the preparation of lactulose, so as to solve the problem of how to prepare lactulose.

[0005] Technical Solution: The N - acetylglucosamine 2 - epimerase mutant described in the present invention comprises the amino acid sequence shown in SEQ ID No.3.

[0006] The present invention is obtained by the K182R point mutation of the wild - type N - acetylglucosamine 2 - epimerase derived from Dictyoglomus thermophilum. The amino acid sequence of the wild - type N - acetylglucosamine 2 - epimerase is shown in SEQ ID No.1. The K182R point mutation is located on the surface of the spatial structure of the wild - type N - acetylglucosamine 2 - epimerase protein. This mutation does not affect the correct expression and folding of the subsequent mutant recombinant protein, and this mutation can effectively improve the thermal stability of the wild - type enzyme protein, thereby improving the catalytic synthesis efficiency of lactulose.

[0007] The second aspect of the present invention provides a recombinant vector expressing the above - mentioned N - acetylglucosamine 2 - epimerase mutant.

[0008] Preferably, the recombinant vector contains the nucleotide sequence shown in SEQ ID No.4, and this sequence is the gene coding sequence of the above - mentioned N - acetylglucosamine 2 - epimerase mutant.

[0009] The third aspect of the present invention provides a recombinant bacterium containing the above - mentioned recombinant vector.

[0010] The fourth aspect of the present invention discloses a preparation method of the above - mentioned N - acetylglucosamine 2 - epimerase mutant, which comprises the following steps:

[0011] (1) Using a recombinant vector containing a Sumo enhancer element and a wild - type N - acetylglucosamine 2 - epimerase gene as a template, performing a PCR reaction with mutant primers to obtain a mutant gene fragment;

[0012] (2) Transform the mutant gene fragment into an engineered bacterium to obtain a recombinant bacterium expressing the N-acetylglucosamine 2-epimerase mutant protein;

[0013] (3) Culture the recombinant bacterium, collect and lyse the cells, and centrifuge the cell lysate to obtain the supernatant, which is the crude enzyme solution containing the N-acetylglucosamine 2-epimerase mutant.

[0014] In some embodiments, the engineered bacterium is Escherichia coli BL21.

[0015] Preferably, in step (1), the method for preparing the recombinant vector containing the Sumo enhancer element and the wild-type N-acetylglucosamine 2-epimerase gene is as follows: insert the wild-type N-acetylglucosamine 2-epimerase gene into the multiple cloning site of the pET22b plasmid to obtain pET22b-DithAGE, and the nucleotide sequence of the wild-type N-acetylglucosamine 2-epimerase gene is shown in SEQ ID No.2; then copy the nucleotide sequence of the Sumo enhancer element into pET22b-DithAGE, and the nucleotide sequence of the Sumo enhancer element is located at the 5' end of the wild-type N-acetylglucosamine 2-epimerase gene to obtain a recombinant vector containing the Sumo enhancer element and the wild-type N-acetylglucosamine 2-epimerase gene.

[0016] In some embodiments, the insertion sites of the foreign gene in the pET22b plasmid are 5'(Nde I) and 3'(XhoI).

[0017] Preferably, in step (1), the mutant primers include:

[0018] Forward primer: 5’-TTGATGCACTTTAGTAAGTTAGCC CGT GAAAAATCAAA-3’

[0019] Reverse primer: 5’-TTTCCAAAATCTTTGATTTTTC ACG GGCTAACTTACTAA-3’

[0020] The annealing temperature of the PCR reaction is 53℃-57℃.

[0021] Preferably, in step (3), the method for culturing the recombinant bacterium is as follows: inoculate the recombinant Escherichia coli into an LB liquid medium containing ampicillin, shake the culture at 37℃ until the logarithmic growth phase of the cells, then add IPTG with a final concentration of 2 mM to the culture solution, and induce expression at 37℃;

[0022] In step (1), the recombinant vector contains a His tag. In step (3), it further includes the step of purifying the crude enzyme solution through a nickel column to obtain the purified N-acetylglucosamine 2-epimerase mutant.

[0023] The fifth aspect of the present invention discloses the application of the above-mentioned N-acetylglucosamine 2-epimerase mutant in the preparation of lactulose.

[0024] The above application specifically includes the following steps: using lactose as the substrate, using a buffer solution with a pH of 7.0 - 8.0 as the reaction medium, adding the N-acetylglucosamine 2-epimerase mutant to form a reaction system, and reacting under the conditions of 80°C - 95°C to obtain lactulose. The reaction temperature is preferably 85°C - 90°C, and the reaction time is preferably 2h - 8h.

[0025] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages:

[0026] The present invention improves the thermal stability of N-acetylglucosamine 2-epimerase through point mutations at specific amino acid sites. After screening, a strain of N-acetylglucosamine 2-epimerase mutant capable of withstanding high temperatures for a long time is successfully obtained. At 85°C, the K m of the mutant is 168.5 mM, and the k cat is 2.64 s -1 . The substrate affinity and catalytic efficiency of the mutant are both superior to those of the wild-type enzyme. Under the optimal conditions, its substrate conversion efficiency is increased by 3.9% compared with the wild-type enzyme. This mutant can be used as a biocatalyst for the efficient preparation of lactulose, and has the advantages of environmental friendliness, low toxicity, few by-products, and high product yield, and has the prospect of industrial application. Description of the Drawings

[0027] Figure 1 Screening results of the enhanced elements for recombinant expression of DithAGE;

[0028] Among them, (A) figure is the SDS-PAGE analysis of recombinant DithAGE (M: standard marker; 1: supernatant of pET22b cell disruption; 2: precipitate of pET22b cell disruption; 3: supernatant of TTH cell disruption; 4: precipitate of TTH cell disruption; 5: supernatant of Trig cell disruption; 6: precipitate of Trig cell disruption; 7: supernatant of Tee cell disruption; 8: precipitate of Tee cell disruption; 9: supernatant of His cell disruption; 10: precipitate of His cell disruption; 11: supernatant of Sumo cell disruption; 12: precipitate of Sumo cell disruption; 13: supernatant of Mbp cell disruption; 14: precipitate of Mbp cell disruption; 15: supernatant of NusA cell disruption; 16: precipitate of NusA cell disruption; 17: supernatant of TrxA cell disruption; 18: precipitate of TrxA cell disruption; 19: supernatant of Gst cell disruption; 20: precipitate of Gst cell disruption); (B) figure is the lactulose conversion rate of recombinant DithAGE.

[0029] Figure 2 Purification results of recombinant DithAGE and its mutants;

[0030] Among them, M: standard marker; 1: K161R; 2: K126R; 3: K49R; 4: K329R; 5: K326R; 6: K351R; 7: K86R; 8: K179R; 9: K25R; 10: K332R; 11: K182R; 12: K242R; 13: K125R; 14: K108R; 15: K307R; 16: K29R; 17: K84R; 18: K190R; 19: K186R; 20: K155R; 21: K238R; 22: K196R; 23: K184R; 24: G27A; 25: G158A; 26: G252A; 27: G68A; 28: G245A; 29: Sumo-DithAGE.

[0031] Figure 3 Are the lactulose conversion rates of wild-type DithAGE and its mutants;

[0032] Figure 4 Are the optimal pH values of wild-type DithAGE and mutant K182R;

[0033] Figure 5 Are the optimal reaction temperatures of wild-type DithAGE and mutant K182R;

[0034] Among them, WT represents wild-type DithAGE.

[0035] Figure 6 Are the thermal stabilities of wild-type DithAGE and mutant K182R;

[0036] Among them, figure (A) shows the wild-type DithAGE, and figure (B) shows the mutant K182R.

[0037] Figure 7 It is the circular dichroism spectrum curve and secondary structure content analysis of wild-type DithAGE and mutant K182R;

[0038] Among them, figure (A) is the circular dichroism spectrum curve, and figure (B) is the analysis result diagram of the protein secondary structure content.

[0039] Figure 8 It is the lactulose conversion rate of wild-type DithAGE and mutant K182R under the condition of 90 °C. Specific implementation mode

[0040] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0041] Example 1: An N-acetylglucosamine 2-epimerase mutant, whose amino acid sequence is shown in SEQ ID No. 3:

[0042] MKVVSIVGARPQFIKLAPFSAELRKNGIKEVILHTGQHYDENMSELFFKELEIPEPDYNLGIGSGSHGEQTGRMLIGIEEVLVKEKPDVVIVYGDTNSTLAGALASAKIHIPLAHVEAGLRSFNKKMPEEINRIVADHLSDILFCPTETAVENLKREGIEKGVYLVGDVMFDALMHFSKLAREKSKILEKLSLNPKDYYLITVHRAENTDNPERLKNIFSAISELDKEVIFPIHPRTKNRLKELGLEGYLRGRVRIIDPVGYLDMIELEKNALAILTDSGGVQKEAFWLRVPCITLREETEWVETLKYGWNILVGSNKERILEAIKNIKNGKEISFENDYASPKMREVLIKELERRREDDR

[0043] The preparation method of the above-mentioned N-acetylglucosamine 2-epimerase mutant is as follows:

[0044] (1) Construct a recombinant expression vector containing a Sumo enhancer element and a wild-type N-acetylglucosamine 2-epimerase gene derived from Thermococcus thermophilus, and the method is:

[0045] The N-acetylglucosamine 2-epimerase from wild-type Thermococcus hydrothermalis, D. thermophilum AGE for short, is called DithAGE, and its amino acid sequence is shown in SEQ ID No.1 (NCBI Accession Number: WP_149122648.1):

[0046] MKVVSIVGARPQFIKLAPFSAELRKNGIKEVILHTGQHYDENMSELFFKELEIPEPDYNLGIGSGSHGEQTGRMLIGIEEVLVKEKPDVVIVYGDTNSTLAGALASAKIHIPLAHVEAGLRSFNKKMPEEINRIVADHLSDILFCPTETAVENLKREGIEKGVYLVGDVMFDALMHFSKLAKEKSKILEKLSLNPKDYYLITVHRAENTDNPERLKNIFSAISELDKEVIFPIHPRTKNRLKELGLEGYLRGRVRIIDPVGYLDMIELEKNALAILTDSGGVQKEAFWLRVPCITLREETEWVETLKYGWNILVGSNKERILEAIKNIKNGKEISFENDYASPKMREVLIKELERRREDDR

[0047] Restriction enzyme sites 5'(Nde I) and 3'(Xho I) were added to both ends of the nucleotide sequence of the coding gene of wild-type N-acetylglucosamine 2-epimerase, and the codons were optimized according to the codon preference of Escherichia coli to obtain the recombinant coding gene of wild-type DithAGE, and its sequence is shown in SEQ ID No.2:

[0048] GGAATTC CATATG ATGAAAGTTGTTAGTATTGTTGGTGCTCGGCCACAATTTATTAA

[0049] ATTAGCTCCATTTAGTGCTGAATTACGGAAGAATGGTATCAAAGAAGTCATTTTACA

[0050] TACGGGCCAACATTACGATGAAAATATGAGTGAATTATTTTTTAAAGAATTGGAGAT

[0051] TCCGGAACCGGATTATAATTTAGGTATTGGTAGTGGTAGTCATGGTGAACAAACGG

[0052] GTCGGATGTTAATTGGTATTGAAGAAGTTTTGGTTAAAGAAAAACCGGATGTTGTT

[0053] ATTGTTTATGGTGATACGAATAGTACGTTAGCTGGTGCTTTAGCTAGTGCTAAAATT

[0054] CATATTCCATTAGCTCATGTTGAAGCTGGTTTACGGAGTTTTAATAAAAAAATGCCG

[0055] GAAGAAATTAATCGGATTGTTGCTGATCATTTAAGTGATATTTTATTTTGTCCAACGG

[0056] AAACGGCTGTTGAAAATTTAAAACGGGAGGGTATTGAGAAAGGTGTCTATTTAGTT

[0057] GGTGATGTCATGTTTGACGCCTTGATGCACTTTAGTAAGTTAGCCAAGGAAAAATC

[0058] AAAGATTTTGGAAAAATTGTCATTAAATCCGAAAGATTATTATTTAATTACGGTTCAT

[0059] CGGGCTGAAAATACGGATAATCCGGAACGGTTAAAAAACATTTTTAGTGCTATTAG

[0060] TGAGTTAGATAAAGAAGTTATTTTCCCAATTCATCCACGGACGAAAAATCGGTTAA

[0061] AAGAATTAGGTTTAGAAGGTTATTTACGGGGTCGGGTTCGGATTATTGATCCGGTTG

[0062] GTTATTTAGACATGATTGAGTTAGAGAAAAATGCTTTAGCTATTTTAACGGATAGTG

[0063] GTGGTGTTCAAAAAGAAGCTTTTTGGTTACGGGTTCCATGTATTACGTTACGGGAA

[0064] GAAACGGAATGGGTTGAAACTTTGAAATATGGCTGGAATATCTTAGTTGGTTCAAA

[0065] TAAGGAACGGATCTTAGAAGCCATTAAAAATATTAAAAACGGTAAAGAAATTAGTT

[0066] TTGAAAATGATTATGCTAGTCCAAAAATGCGGGAAGTTTTAATCAAAGAATTAGAA

[0067] CGGCGTCGGGAAGATGATCGGTAA CTCGAG CGG

[0068] The single-underlined part in the above sequence is the Nde I restriction site, and the double-underlined part is the Xho I restriction site.

[0069] The recombinant coding gene fragment of DithAGE was obtained by total synthesis according to the sequence shown in SEQ ID No. 2. The recombinant coding gene fragment of DithAGE and the pET22b empty plasmid were respectively digested with Nde I and Xho I and then ligated to obtain the recombinant expression plasmid pET22b-DithAGE.

[0070] pET22b-DithAGE was transformed into E. coli BL21 recipient bacteria and spread on an LB agar plate containing 100 mM ampicillin at a final concentration. After culturing at 37 °C for 12 h, clones were randomly selected from the colonies grown on the plate and plasmids were extracted. Agarose gel electrophoresis identification and nucleotide sequence determination were respectively carried out to obtain the recombinant bacterium BL21 / pET22b-DithAGE. BL21 / pET22b-DithAGE was respectively inoculated into an LB liquid medium containing ampicillin and cultured at 37 °C and 200 r / min until OD 600 = 0.6 - 0.8. Then, IPTG with a final concentration of 2 mM was added to the culture medium. After inducing expression at 37 °C for 12 h, centrifugation was carried out at 4 °C and 8000 r / min for 10 min, the supernatant was discarded, and the wet bacterial cells were collected. The wet bacterial cells were washed three times with 50 mM PBS (pH 7.4) buffer, and then resuspended with 50 mM PBS (pH 7.4) buffer at a ratio of 25:1 (v / w). The cells were broken using an ultrasonic crusher with a power of 300 w and a cycle of 3 s - 7 s (for a total of 45 min). Centrifugation was carried out at 4 °C and 10,000 rpm for 10 min to obtain the broken supernatant, which was the crude enzyme solution.

[0071] Enzyme activity assay: The crude enzyme solution was mixed with a 200 g / L lactose aqueous solution at a volume ratio of 1:1 (v / v), with a total system volume of 10 mL. Reaction conditions: React at 80 °C for 8 h, and terminate the reaction in an ice bath for 30 min. Take the reaction solution and detect the lactulose content using high performance liquid chromatography (HPLC).

[0072] HPLC detection conditions: HPLC was used to determine the contents of lactulose, lactose, fructose, and galactose during fermentation. The fermentation broth was centrifuged at 12,000 rpm for 10 min and then filtered through a 0.22 μm aqueous syringe filter for HPLC detection. Chromatographic column: AllChrom NH2 (250 mm × 4.6 mm, 5 μm), column temperature 30 °C. HPLC analysis conditions: Mobile phase was acetonitrile:water = 70:30 (v / v), injection volume 5 μL, flow rate 0.8 mL / min. The detector was an evaporative light scattering detector, and the drift tube temperature was 95 °C. The lactulose yield was determined based on the peak retention time and peak area.

[0073] After HPLC testing, no lactulose was generated in the reaction system, indicating that pET22b-DithAGE could not express active recombinant DithAGE protein in BL21.

[0074] In order to enable the recombinant bacterium to normally express active DithAGE protein, the present invention fused a translation enhancement element at the N-terminus of recombinant DithAGE, such as the Trig-Tee-His tandem sequence (hereinafter simply referred to as TTH), Trig, Tee, His, and protein tags Mbp, Gst, NusA, TrxA, Sumo. The amino acid sequences of the above translation enhancement elements are as follows:

[0075]

[0076]

[0077]

[0078] The specific method is as follows:

[0079] The nucleotide sequence of the enhancing element was optimized according to the codon preference of Escherichia coli and synthesized by Genewiz (Suzhou) Inc. to the N-terminus of recombinant DithAGE. The nucleotide sequence of the enhancing element is located at the 5'-end of the DithAGE-encoding gene, obtaining the N-acetylglucosamine 2-epimerase recombinant expression vectors pET22b-TTH-DithAGE, pET22b-Trig-DithAGE, pET22b-Tee-DithAGE, pET22b-His-DithAGE, pET22b-Mbp-DithAGE, pET22b-Gst-DithAGE, pET22b-NusA-DithAGE, pET22b-TrxA-DithAGE, pET22b-Sumo-DithAGE. The corresponding recombinant enzymes are TTH-DithAGE (36.2 kDa), Trig-DithAGE (90.5 kDa), Tee-DithAGE (42.8 kDa), His-DithAGE (42 kDa), Mbp-DithAGE (82.7 kDa), Gst-DithAGE (67.5 kDa), NusA-DithAGE (96.4 kDa), TrxA-DithAGE (53.6 kDa), Sumo-DithAGE (53.9 kDa).

[0080] The above recombinant expression vectors carrying the N-acetylglucosamine 2-epimerase gene were respectively transformed into Escherichia coli BL21. The recombinant bacteria were cultured and induced to express the target protein. After collecting the bacterial cells, the cells were lysed. SDS-PAGE electrophoresis was used to detect the target protein bands in the supernatant and precipitate of cell lysis, and the conversion rate of recombinant DithAGE with different translation enhancing elements fused at the N-terminus to catalyze lactose to produce lactulose was analyzed. The results are as Figure 1 shown. SDS-PAGE electrophoresis showed that when the Sumo tag was fused to the N-terminus of DithAGE, the expression level was the highest; the conversion rate of recombinant Sumo-DithAGE to catalyze lactose to produce lactulose was 31.2%, higher than that of other recombinant enzymes.

[0081] (2) Using the Sumo recombinant expression vector pET22b-Sumo-DithAGE as a template, mutant primers were designed for PCR reaction to construct the corresponding mutants. The method is as follows:

[0082] (2.1) Select the mutation sites

[0083] Using the crystal structure of 2,3-diacetamido-2,3-dideoxyglucuronic acid 2-epimerase from Thermus thermophilus HB27 (PDB: 8sxy.1.A) as a template, the three-dimensional structure model of DithAGE was constructed through SWISS-MODEL (https: / / www.swissmodel.expasy.org). Then, the surface amino acids of DithAGE were analyzed using the bioinformatics analysis tool GetArea (https: / / curie.utmb.edu / getarea.htmL). Lysine (K) on the surface of DithAGE was mutated to arginine (R), and glycine (G) was mutated to alanine (A) to screen for mutants that could improve the thermal stability and lactulose conversion rate of DithAGE. Specific point mutations and corresponding mutant primers include:

[0084]

[0085]

[0086]

[0087] The annealing temperatures of the above point mutation primers in the PCR reaction are all in the range of 58°C - 66°C.

[0088] (2.2) According to the gene sequence of DithAGE, using the recombinant vector pET22b-Sumo-DithAGE as a template, mutant primers were designed, and the whole plasmid PCR technology was used to perform a single mutation on the 182nd amino acid of DithAGE. Primer sequences:

[0089] Forward primer (5’→3’): (Underlined is the mutated base)

[0090] Reverse primer (5’→3’): (Underlined is the mutated base)

[0091] The PCR reaction system and PCR amplification conditions are shown in Tables 1 and 2:

[0092] Table 1 Components and addition amounts of the PCR reaction system

[0093]

[0094] Table 2 PCR reaction program

[0095]

[0096] The nucleotide sequence of the mutant gene fragment in the PCR product is shown in SEQ ID No.4:

[0097]

[0098] AAAGAAGTTATTTTCCCAATTCATCCACGGACGAAAAATCGGTTAAAAGAATTAGG

[0099] TTTAGAAGGTTATTTACGGGGTCGGGTTCGGATTATTGATCCGGTTGGTTATTTAGA

[0100] CATGATTGAGTTAGAGAAAAATGCTTTAGCTATTTTAACGGATAGTGGTGGTGTTCA

[0101] AAAAGAAGCTTTTTGGTTACGGGTTCCATGTATTACGTTACGGGAAGAAACGGAAT

[0102] GGGTTGAAACTTTGAAATATGGCTGGAATATCTTAGTTGGTTCAAATAAGGAACGG

[0103] ATCTTAGAAGCCATTAAAAATATTAAAAACGGTAAAGAAATTAGTTTTGAAAATGA

[0104] TTATGCTAGTCCAAAAATGCGGGAAGTTTTAATCAAAGAATTAGAACGGCGTCGGG

[0105] AAGATGATCGGTAA

[0106] (3) The recombinant plasmid carrying the mutant gene fragment was transformed into Escherichia coli BL21 to obtain a recombinant bacterium expressing the N-acetylglucosamine 2-epimerase mutant protein. The method is as follows:

[0107] Take 8 μL of the PCR product, add 1 μL of Dpn I and 1 μL of 10×QuickCut buffer respectively, incubate at 37°C for 2 h. Then add the reaction solution to 100 μL of E. coli DH5α competent cells in an ice bath, let it stand on ice for 30 min, then perform heat shock at 42°C for 90 s, quickly place it on ice to cool for 5 min. Add 700 μL of LB liquid medium, culture at 37°C and 200 r / min for 1 h, centrifuge at 4000 r / min for 1 min, discard the supernatant, resuspend the bacterial pellet with a small amount of liquid left at the bottom of the tube, spread it on an LB solid plate containing ampicillin at a final concentration of 100 μg / mL, and culture it upside down at 37°C for 12 h. Pick colonies and inoculate them into 10 mL of LB liquid medium containing ampicillin at a final concentration of 100 μg / mL, and culture at 37°C for 12 h. Send the bacterial solution to Suzhou Genewiz Biotechnology Co., Ltd. for gene sequencing to obtain the recombinant plasmid pET22b-K182R. Transform the correctly sequenced recombinant plasmid into Escherichia coli BL21 to obtain the recombinant bacterium BL21 / pET22b-K182R. Since the whole plasmid PCR product is linear DNA with only one nick at the 5' and 3' ends, it will be ligated into a circular form in Escherichia coli after direct transformation, so direct transformation can be carried out.

[0108] (4) Culture the recombinant bacterium, collect and lyse the cells, centrifuge the cell lysate and take the supernatant to obtain the crude enzyme solution containing N-acetylglucosamine 2-epimerase mutant.

[0109] For the preliminary screening of the thermal stability of the above mutant, inoculate the recombinant bacterium in step 3 into an LB liquid medium containing ampicillin resistance at a final concentration of 100 μg / mL at an inoculation amount of 2% (v / v), culture at 37°C and 200 r / min until 600 OD = 0.6 - 0.8, then add IPTG at a final concentration of 2 mM to the culture solution, induce expression at 37°C for 12 h, centrifuge at 4°C and 8000 r / min for 10 min, discard the supernatant, and collect the cells. Wash the cells three times with 50 mM PBS (pH 7.4) buffer, use an ultrasonic crusher [power 300 w, 3 s - 7 s cycle (for a total of 45 min)] to lyse the cells, centrifuge at 4°C and 10,000 rpm for 10 min to obtain the lysed supernatant, incubate at 90°C for 30 min, and detect the remaining enzyme activity of the mutant. The enzyme activity before incubation is defined as 100%. After the mutant K182R is incubated at 95°C for 30 min, the remaining enzyme activity is 60.2%, while the remaining enzyme activity of the wild type is 42.1%, indicating that the mutant K182R has better thermal stability than the wild type.

[0110] Prepare other mutants according to the above recombinant method, and screen for mutants with a higher lactulose conversion rate than the wild-type enzyme. The results are as Figure 3 shown. Figure 3The conversion rates of 29 mutants to lactulose are shown. Among them, the conversion rate of K182R to lactulose is 35.1%, which is higher than that of the wild type (31.2%). K182R was selected for subsequent experiments.

[0111] Example 2: Purification of wild type and mutant K182R was carried out as follows:

[0112] (1) Cultivation of recombinant bacteria and cell disruption

[0113] The BL21 / pET22b-DithAGE and BL21 / pET22b-K182R constructed in Example 1 were streaked on LB solid medium and incubated at 37 °C in an inverted position for 12 h. Single colonies were picked and transferred to LB liquid medium containing ampicillin resistance, and cultured at 37 °C and 200 r / min until OD 600 = 0.6 - 0.8. IPTG with a final concentration of 2 mM was added to the culture medium, and after induction at 37 °C for 8 h, the cells were centrifuged at 4 °C and 8000 r / min for 10 min. The supernatant was discarded and the cells were collected. The obtained cells were washed three times with 50 mM PBS (pH 7.4) buffer, and 2 g of cells were resuspended in 50 mL of 50 mM PBS (pH 7.4) buffer to obtain a cell suspension. The cells were disrupted using an ultrasonic cell disruptor [power 300 w, 3 s - 7 s cycle (total 45 min)], and the disrupted supernatant was obtained by centrifugation at 4 °C and 10,000 rpm for 10 min. After centrifugation, the precipitate was removed, and the crude enzyme solution was obtained.

[0114] (2) Purification of recombinant enzyme using nickel column

[0115] Lysis buffer was added according to the ratio of 4 mL of non-denaturing lysis buffer per gram of bacterial precipitate, and the cells were resuspended thoroughly. Lysozyme with a final concentration of 1 mg / mL was added and mixed well, and the mixture was incubated in an ice-water bath for 30 min and then sonicated on ice to disrupt the cells. The ultrasonic power was 300 w, and each sonication was for 10 s with a 10 s interval, for a total of 6 sonication treatments. The cells were centrifuged at 4 °C and 10,000 r / min for 30 min, and the cell disruption supernatant was collected. Take 1 mL of well-mixed 50% (v / v) BevoGold TM (Reducing-resistant Chelating His-tag Purification Resin), centrifuge at 4 °C and 2000 r / min for 10 s to discard the storage solution. Add 0.5 mL of non-denaturing lysis buffer to the gel and mix well to equilibrate the gel, then discard the liquid. Repeat the equilibration 2 more times and discard the liquid. Add 4 mL of cell disruption supernatant and shake at 4 °C and 50 r / min for 1 h. The cell disruption supernatant and BeyoGold TMA mixture of His-tag Purification Resin was loaded into an affinity chromatography column. The lid at the bottom of the purification column was opened, and the liquid in the column was allowed to flow out under the action of gravity. Approximately 20 μL of the flow-through liquid was collected for subsequent analysis. The column was washed 5 times, each time adding 1 mL of non-denaturing washing solution, and approximately 20 μL of the eluate passing through the column was collected for subsequent analysis and detection each time, which was the pure enzyme solution (the enzyme protein concentration was 125 μg·mL -1 ).

[0116] Example 3: Determination of the Optimal pH of Wild-Type and Mutant K182R

[0117] Dissolve 200 g / L lactose in 50 mM Na2HPO4-NaH2PO4 (pH 6.8 - 7.8) and 50 mM Britton-Robinson (pH 7.8 - 8.5) buffer solutions. Take the pure enzyme solution prepared in Example 2 as the experimental enzyme to determine the optimal pH of the enzyme. Mix the enzyme and the substrate at a volume ratio of 1:1 (v / v), incubate at 85 °C for 8 h, and detect the enzyme activities of wild-type and mutant K182R under different pH conditions. From Figure 4 it can be seen that the optimal pH of both wild-type and mutant K182R is 7.4, and there is no significant difference in their enzyme activities under the same pH environment.

[0118] Example 4: Determination of the Optimal Reaction Temperature of Wild-Type and Mutant K182R

[0119] Dissolve 200 g / L lactose in 50 mM Na2HPO4-NaH2PO4 (pH 7.4) buffer solution. Take the pure enzyme solution prepared in Example 2 as the experimental enzyme to determine the optimal reaction temperature of the enzyme. Mix the enzyme and the substrate at a volume ratio of 1:1 (v / v), and the enzyme reaction system is incubated at 60 °C, 65 °C, 70 °C, 75 °C, 80 °C, 85 °C, 90 °C for 8 h respectively, and detect the enzyme activities of wild-type and mutant K182R at different temperatures. From Figure 5 it can be seen that the optimal reaction temperature of both wild-type and mutant K182R is 85 °C, and under the conditions of 85 °C - 90 °C, the enzyme activity of mutant K182R is higher than that of wild-type.

[0120] Example 5: Thermal Stability Analysis of Wild-Type and Mutant K182R

[0121] The pure enzyme solutions of wild-type and mutant K182R prepared in Example 2 at a certain concentration were incubated at 85 °C, 90 °C, and 95 °C respectively, and the remaining enzyme activities of wild-type and mutant after incubation were detected to characterize the thermal stability. The enzyme activity without heat treatment was taken as the initial enzyme activity (i.e., the enzyme activity measured at 85 °C reaction temperature, which has been confirmed), and the relative enzyme activity was defined as the ratio of the remaining enzyme activity to the initial enzyme activity. From Figure 6It can be seen that the wild-type enzyme and the mutant K182R still retain nearly 100% of their activity after incubation at 85°C for 5 h; as the incubation temperature increases, the remaining enzyme activity begins to decrease. After incubation at 90°C for 5 h, only 42% of the enzyme activity remains in the wild-type, and 64% remains in K182R, indicating that the thermal stability of the mutant K182R is improved compared to the wild-type; when incubated at 95°C for 5 h, both the wild-type and the mutant K182R almost lose all their activity.

[0122] Example 6: Analysis of kinetic parameters of wild-type and mutant K182R

[0123] Lactose substrate solutions with concentrations of 50 g / L, 100 g / L, 150 g / L, 200 g / L, 250 g / L, and 300 g / L were prepared respectively. The lactose solutions with different concentrations were mixed with the wild-type and mutant K182R pure enzyme solutions prepared in Example 2 at a volume ratio of 1:1 (v / v), and reacted at 85°C for 8 h. The enzyme activities of the wild-type and the mutant were measured, and the non-linear regression equation of substrate concentration and specific enzyme activity was plotted to calculate the Michaelis constant K m value, catalytic constant k cat and catalytic efficiency k cat / K m value. The results are shown in the following table: The K m value of the mutant K182R is 168.50 mM, which is lower than that of the wild-type (205.10 mM), indicating that the mutant has a higher affinity for the substrate; the catalytic efficiency k cat / K m (1.56×10 -2 s -1 ·mM -1 ) of the mutant K182R is 1.28 times that of the wild-type (1.22×10 -2 s -1 ·mM -1 ).

[0124] Table 3 Analysis of kinetic parameters of wild-type and mutant K182R

[0125]

[0126] Example 7: Secondary structure analysis and melting temperature determination of wild-type and mutant K182R

[0127] At 25°C, the secondary structure contents of the wild-type and mutant K182R prepared in Example 2 were analyzed by circular dichroism spectroscopy. Data were collected from a wavelength of 190 nm to 260 nm at a scanning speed of 1 nm / s. The circular dichroism spectrum curve of the mutant K182R showed certain changes compared to the wild-type, such as Figure 7As shown in Figure (A). The secondary structure contents of the wild type and the mutant were analyzed, and it was found that the contents of random coils and β-turn structures were similar between them. The α-helix content of the mutant decreased by 9% compared with the wild type, while the β-sheet content of the mutant increased by 5% compared with the wild type, as shown in Figure 7 Figure (B). The increase in the β-sheet content of the mutant may be an important reason for the improvement of its thermal stability.

[0128] The wild type and mutant pure enzyme solutions prepared in Example 2 were taken, a temperature gradient from 20 °C to 90 °C was set, the samples were heated at a rate of 0.5 °C / min, and the melting temperature T m value of the wild type and the mutant was detected. It was determined that the T m value of the mutant K182R was 83.2 °C, which was higher than that of the wild type (82.9 °C), indicating that the mutant K182R had higher thermal stability than the wild type.

[0129] Example 8: Application of the wild type and the mutant K182R

[0130] 200 g / L lactose was dissolved in 50 mM Na2HPO4-NaH2PO4 (pH 7.4) buffer solution. The wild type and mutant K182R pure enzyme solutions prepared in Example 2 were respectively mixed with the substrate at a volume ratio of 1:1 (v / v) to construct an enzymatic reaction system for synthesizing lactulose, and incubated at 90 °C for 8 h, and the production amount of lactulose was analyzed. The results are as shown in Figure 8 Figure. As the reaction time extended, the conversion rates of the wild type and the mutant K182R catalyzing lactose to produce lactulose increased; after reacting for 8 h, the conversion rate of the mutant K182R to lactulose reached 30.8%, which was higher than that of the wild type (25.0%), indicating that the mutant K182R was more suitable for catalyzing the conversion of lactulose under high-temperature conditions.

[0131] In summary, the present invention utilized the Escherichia coli expression system and achieved the active expression of N-acetylglucosamine 2-epimerase DithAGE derived from Thermococcus thermophilus through the fusion protein or short peptide tag strategy. When the Sumo tag was fused to the N-terminus of DithAGE, the conversion rate of the recombinant enzyme catalyzing lactose to produce lactulose was the highest, reaching 31.2%; then, the mutant K182R was constructed through the surface amino acid modification strategy. Its optimal pH and optimal temperature were 7.4 and 85 °C respectively, which were the same as those of the wild type. The specific enzyme activity and catalytic efficiency were 1.15 times and 1.28 times that of the wild type respectively. Under the optimal conditions, the conversion rate of catalyzing lactose to produce lactulose was 35.1%, which was 3.9% higher than that of the wild type enzyme; the melting temperature T m value of the wild type and the mutant K182R was measured, and it was found that the T mThe value is 83.2 °C, which is higher than that of the wild type (82.9 °C), indicating that the mutant K182R has higher thermal stability than the wild type. When incubated at 90 °C for 8 h and analyzing the production amount of lactulose, it was found that the conversion rate of lactulose by the mutant K182R reached 30.8%, which is higher than that of the wild type (25.0%), indicating that the mutant K182R is more suitable for catalyzing the conversion of lactulose under high-temperature conditions. By analyzing the secondary structure content of the wild type and the mutant K182R, it was found that the β-sheet content in the mutant increased by 5% compared with the wild type. The increase in the β-sheet content of the mutant may be an important reason for its improved thermal stability. The wild type DithAGE and the mutant K182R can be used as efficient biocatalysts for the preparation of lactulose, with the advantages of environmental friendliness, low toxicity, few by-products, and high product yield, and have the prospect of industrial application.

Claims

1. An N-acetylglucosamine 2-epimerase mutant, characterized in that, Comprising the amino acid sequence shown in SEQ ID No.

3.

2. A recombinant vector expressing the N - acetylglucosamine 2 - epimerase mutant according to claim 1.

3. The recombinant vector according to claim 2, wherein Containing the nucleotide sequence shown in SEQ ID No.

4.

4. A recombinant bacterium containing the recombinant vector according to claim 2.

5. The preparation method of the N-acetylglucosamine 2-epimerase mutant according to claim 1, wherein Comprising the following steps: (1) Using a recombinant vector containing a Sumo enhancer element and a wild - type N - acetylglucosamine 2 - epimerase gene as a template, performing a PCR reaction with mutant primers to obtain a mutant gene fragment; (2) Transforming the mutant gene fragment into an engineered bacterium to obtain a recombinant bacterium expressing the N - acetylglucosamine 2 - epimerase mutant protein; (3) Culturing the recombinant bacterium, collecting and lysing the cells, and centrifuging the cell lysate to take the supernatant to obtain a crude enzyme solution containing the N - acetylglucosamine 2 - epimerase mutant.

6. The preparation method of the N-acetylglucosamine 2-epimerase mutant according to claim 5, wherein, In step (1), the preparation method of the recombinant vector containing a Sumo enhancer element and a wild - type N - acetylglucosamine 2 - epimerase gene is as follows: inserting the wild - type N - acetylglucosamine 2 - epimerase gene into the multiple cloning site of the pET22b plasmid to obtain pET22b - DithAGE, and the nucleotide sequence of the wild - type N - acetylglucosamine 2 - epimerase gene is shown in SEQ ID No. 2; then copying the nucleotide sequence of the Sumo enhancer element into pET22b - DithAGE, and the nucleotide sequence of the Sumo enhancer element is located at the 5' end of the wild - type N - acetylglucosamine 2 - epimerase gene to obtain a recombinant vector containing a Sumo enhancer element and a wild - type N - acetylglucosamine 2 - epimerase gene.

7. The preparation method of the N-acetylglucosamine 2-epimerase mutant according to claim 5, wherein, In step (1), the mutant primers include: Forward primer: 5’-TTGATGCACTTTAGTAAGTTAGCC CGT GAAAAATCAAA-3’ Reverse primer: 5’-TTTCCAAAATCTTTGATTTTTC ACG GGCTAACTTACTAA-3’ The annealing temperature of the PCR reaction is 53°C - 57°C.

8. The preparation method of the N-acetylglucosamine 2-epimerase mutant according to claim 5, characterized in that, In step (3), the method for culturing the recombinant bacterium is as follows: inoculating the recombinant Escherichia coli into a Luria - Bertani (LB) liquid medium containing ampicillin, culturing with shaking at 37°C until the logarithmic growth phase of the bacteria, and then adding Isopropyl β - D - thiogalactopyranoside (IPTG) to induce expression at 37°C. In step (1), the recombinant vector contains a His tag, and in step (3), it also includes the step of purifying the crude enzyme solution with a nickel column to obtain a purified N - acetylglucosamine 2 - epimerase mutant.

9. Use of the N - acetylglucosamine 2 - epimerase mutant according to claim 1 in the preparation of lactulose.

10. The application according to claim 9, characterized in that, Comprising the following steps: using lactose as a substrate, using a buffer solution with a pH of 7.0 - 8.0 as a reaction medium, adding the N - acetylglucosamine 2 - epimerase mutant to form a reaction system, and reacting at 80°C - 95°C to obtain lactulose.

Images