Mutant protein of phosphohydroxypyruvate phosphonase and application thereof
By directing the evolution of dihydroxyacetone phosphatase, mutating its amino acid sequence, and constructing recombinant microorganisms, the problem of high-density fermentation using glucosamine oxidase in existing technologies has been solved, and a significant improvement in the production efficiency of 1,3-dihydroxyacetone based on glucose has been achieved.
Patent Information
- Application Number
- CN202311714281.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-14
- Publication Date
- 2026-02-27
- Estimated Expiration
- 2043-12-14
AI Technical Summary
In the existing technology, it is difficult to produce 1,3-dihydroxyacetone by high-density fermentation of Gluconobacterium oxysporum, and the price of glycerol raw material is higher than that of glucose raw material, which limits the application value of the biosynthetic route of 1,3-dihydroxyacetone based on glucose raw material.
By directing the evolution of dihydroxyacetone phosphatase, its amino acid sequence was mutated, especially M21V, N36D, L42P, T49A, I64V, S82G, T150S, and H244R, a dihydroxyacetone phosphatase mutant SF6-11 was formed. This mutant was then fused with the target protein or tagged with a sequence to construct recombinant microorganisms to improve their catalytic efficiency.
The yield of 1,3-dihydroxyacetone increased by 1.65 times during shake-flask fermentation, from 2.75±0.07 g/L to 4.54±0.09 g/L, significantly improving the yield and production efficiency of 1,3-dihydroxyacetone.
Smart Images

Figure BDA0004605602720000061 
Figure BDA0004605602720000071 
Figure BDA0004605602720000072
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and relates to mutant proteins of phospho-dihydroxyacetone phosphatase and application thereof. BACKGROUND
[0002] 1,3-Dihydroxyacetone (DHA) is the simplest three-carbon ketose, which is widely used in chemical industry, medicine, food, cosmetics and feed industry. In the chemical industry, 1,3-dihydroxyacetone is mainly used as an important organic synthesis intermediate. In the pharmaceutical industry, 1,3-dihydroxyacetone is an important drug synthesis intermediate, which can be used for the treatment of some viral skin diseases, and its derivatives are used for the synthesis of anti-AIDS drugs. In the food industry, 1,3-dihydroxyacetone can be used as a preservative ingredient mainly for food preservation. In the cosmetics industry, 1,3-dihydroxyacetone is used as an active ingredient of sunless tanning agent, which can react with free amino groups in the keratin of the epidermal keratin layer to achieve dyeing effect, similar to the melanin reaction, which can quickly make the skin become natural brown and maintain for several days. The mechanism is similar to the natural sunlight tanning kinetics, and can avoid sun exposure to protect the skin from ultraviolet damage. 1,3-dihydroxyacetone is the main active ingredient of almost all tanning sunscreen skin care products, and the raw material can also be used to replace chemical hair dye for hair dyeing product application. In the feed industry, 1,3-dihydroxyacetone, as an intermediate product of sugar metabolism, can also participate in the synthesis of triglycerides in higher plants and animals, so it is an intermediate product connecting sugar metabolism and fat metabolism. By feeding 1,3-dihydroxyacetone, the process of sugar metabolism and fat metabolism can be effectively improved, the flow direction of sugar metabolism and fat metabolism can be changed, the feed utilization efficiency can be improved, the fat synthesis metabolism can be reduced, the fat consumption in the animal body can be accelerated, and the quality of ketone bodies can be improved. Animal experiments show that feeding 1,3-dihydroxyacetone and pyruvic acid can effectively inhibit the accumulation of body fat, and can effectively improve the lean meat rate of poultry and livestock, so 1,3-dihydroxyacetone can be developed as a lean meat type feed additive.
[0003] Currently, the main method for producing 1,3-dihydroxyacetone in industry is microbial conversion of glycerol. A variety of microorganisms have been reported to convert glycerol to 1,3-dihydroxyacetone, among which Gluconobacter oxydans can convert glycerol to 1,3-dihydroxyacetone in one step through membrane-bound glycerol dehydrogenase and release it quickly into the fermentation broth. It has stable production performance and high conversion rate, so it is the most commonly used strain in microbial fermentation production of 1,3-dihydroxyacetone. For example, the team of Wei Dongzhi from East China University of Technology knocked out the membrane-bound alcohol dehydrogenase gene adhA, which significantly improved the growth of G. oxydans in high-concentration glycerol medium and the production of 1,3-dihydroxyacetone. Using resting cell method, 230 g / L glycerol was converted to 139.7 g / L DHA within 72 h, with a volumetric productivity of 1.94 g / L / h (Biosci Biotechnol Biochem. 2010; 74(7): 1391-5). The team of Xu Yong from Nanjing Forestry University used compressed oxygen to connect the fermenter, which significantly improved the glycerol conversion efficiency of G. oxydans. It achieved a 1,3-dihydroxyacetone yield of 301.2 ± 8.2 g / L in 32 h of fermentation, with a production rate of 9.41 ± 0.23 g / L / h, which is the highest yield of 1,3-dihydroxyacetone produced by G. oxydans from glycerol (Bioprocess Biosyst Eng. 2016 Aug; 39(8): 1315-8).
[0004] Because of the difficulty of high-density fermentation of Gluconobacter oxydans and the price of glycerol raw material is much higher than that of glucose, it is of great value to develop a biosynthetic route of 1,3-dihydroxyacetone based on glucose as raw material. In the glycolytic pathway, dihydroxyacetone phosphate (DHAP) is an important intermediate, and using the broad substrate specificity of phosphatase to catalyze dihydroxyacetone phosphate to produce 1,3-dihydroxyacetone is a metabolic route with potential production possibility. Vishist Kumar Jain et al. from the Institute of Chemical and Engineering Science, Agency for Science, Technology and Research, Singapore introduced dihydroxyacetone phosphate phosphatase HdpA from Corynebacterium glutamicum into Escherichia coli, and knocked out phosphotriose isomerase TpiA, methylglyoxal synthase MgsA and glycerol dehydrogenase GldA, obtaining an engineered strain for the synthesis of 1,3-dihydroxyacetone based on glucose as substrate. The theoretical conversion rate of this synthesis route is 0.5 g / g. The strain was fermented in a 2.5 L fermenter for 40 h, and the yield of 1,3-dihydroxyacetone was 6.60 ± 0.2 g / L, with a conversion rate of 0.44 g / g (Enzyme and Microbial Technology, 2016, 86:39-44). The team of You Chun from the Institute of Industrial Bioengineering, Tianjin, Chinese Academy of Sciences identified an extremely thermophilic halide dehalogenase-like hydrolase family phosphatase AfPase from Archaeoglobus fulgidus, combined with the use of five other enzymes from different sources, to form an in vitro enzymatic synthesis route from maltodextrin substrate to 1,3-dihydroxyacetone, obtaining 1.26 g / L of 1,3-dihydroxyacetone, with a conversion rate of 0.13 g / g (Bioresources and Bioprocessing, 2019, 6(1):1-11). The team of Hao Jian from the Shanghai Institute of Higher Education, Chinese Academy of Sciences, used Klebsiella pneumoniae as the chassis, introduced dihydroxyacetone phosphate phosphatase HdpA from Corynebacterium glutamicum, and knocked out phosphotriose isomerase TpiA, hydroxyacetone kinase DhaK, methylglyoxal synthase MgsA, and glycerol dehydrogenase GldA. The strain was fermented in a 3 L fermenter for 91 h, and the yield of 1,3-dihydroxyacetone was 23.9 g / L, with a conversion rate of 0.97 mol / mol, and the byproduct glycerol was 10.8 g / L (Microb Cell Fact. 2021 Jun 29;20(1):123).
[0005] Based on the key role of dihydroxyacetone phosphate phosphatase HdpA in the synthesis of metabolic pathways from glucose to 1,3-dihydroxyacetone, using protein-directed evolution technology to modify the substrate affinity and catalytic speed of the enzyme will help to improve the yield and production rate of the engineered strain for the fermentation production of 1,3-dihydroxyacetone using glucose as substrate. SUMMARY
[0006] The present application aims to provide mutant proteins of phosphonacetyltransferase and applications thereof.
[0007] In a first aspect, the present application provides mutant proteins of phosphonacetyltransferase, which are A1 or A2 or A3 as follows:
[0008] A1) said protein is a protein with phosphonacetyltransferase activity, which is obtained by mutating residues corresponding to positions 21, 36, 42, 49, 64, 82, 150 and 244 of the amino acid sequence shown in SEQ ID NO: 1 of phosphonacetyltransferase, while keeping other amino acid residues unchanged;
[0009] A2) said protein is a fusion protein obtained by linking the protein shown in A1 with a protein with targeting function;
[0010] A3) said protein is a protein with phosphonacetyltransferase activity derived from A1, which is obtained by adding a tag sequence to the end of the amino acid sequence of the protein shown in A1.
[0011] The above-mentioned protein-tag refers to a polypeptide or protein expressed in fusion with the target protein by using DNA in vitro recombination technology, so as to facilitate the expression, detection, tracing and / or purification of the target protein. The protein-tag can be a Flag-tag protein, a His6-tag protein, an MBP-tag protein, an HA-tag protein, a myc-tag protein, a GST-tag protein or a SUMO-tag protein, etc.
[0012] In the above-mentioned protein, the phosphonacetyltransferase is derived from Corynebacterium glutamicum.
[0013] In the above-mentioned protein, the mutation is mutating M at position 21, N at position 36, L at position 42, T at position 49, I at position 64, S at position 82, T at position 150 and H at position 244 of the amino acid sequence shown in SEQ ID NO: 1 to V, D, P, A, V, G, S and R, respectively.
[0014] In the above-mentioned protein, the mutant protein of phosphonacetyltransferase is SF6-11, the amino acid sequence of which is shown in SEQ ID NO: 3 of the sequence listing.
[0015] In a second aspect, the present application provides biological materials related to the protein of the first aspect, which are any one of B1) to B8) as follows:
[0016] B1) a nucleic acid molecule encoding the mutant protein;
[0017] B2) an expression cassette comprising the nucleic acid molecule of B1);
[0018] B3) a recombinant vector comprising the nucleic acid molecule of B1);
[0019] B4) a recombinant vector comprising the expression cassette of B2);
[0020] B5) a recombinant microorganism comprising the nucleic acid molecule of B1);
[0021] B6) a recombinant microorganism comprising the expression cassette of B2);
[0022] B7) a recombinant microorganism comprising the recombinant vector of B3);
[0023] B8) a recombinant microorganism comprising the recombinant vector of B4).
[0024] In the above-mentioned related biological materials, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA and the like.
[0025] In the above-mentioned related biological materials, the recombinant microorganism is Escherichia coli, and specifically can be a 1,3-dihydroxyacetone production strain.
[0026] The recombinant microorganism described above is prepared according to a method comprising the following steps: introducing the gene encoding the protein of the first aspect into the host bacteria to obtain the recombinant microorganism.
[0027] In a third aspect, the present application provides the use of the protein of the first aspect in the preparation of 1,3-dihydroxyacetone.
[0028] In a fourth aspect, the present application provides the use of the nucleic acid molecule, expression cassette or recombinant vector of the second aspect or the recombinant microorganism in the production of 1,3-dihydroxyacetone or in the improvement of the yield of 1,3-dihydroxyacetone.
[0029] In a fifth aspect, the present application provides a method for producing 1,3-dihydroxyacetone or improving the yield of 1,3-dihydroxyacetone, comprising the following steps: fermenting and culturing the recombinant microorganism of the second aspect to obtain 1,3-dihydroxyacetone.
[0030] In a sixth aspect, the present application provides the use of a substance that mutates the amino acid residues corresponding to the 21st, 36th, 42nd, 49th, 64th, 82nd, 150th and 244th amino acid residues in the amino acid sequence shown in SEQ ID NO: 1 in the amino acid sequence of phosphohydroxyacetone phosphatase in the production of 1,3-dihydroxyacetone or in the improvement of the yield of 1,3-dihydroxyacetone.
[0031] The above-mentioned substance is any substance in which the amino acid sequence of phosphohydroxyl acetone phosphatase in a host bacterium is mutated to V at position 21, D at position 36, P at position 42, A at position 49, V at position 64, G at position 82, S at position 150, and R at position 244 of the amino acid sequence shown in SEQ ID NO: 1, and site-directed mutagenesis and the like in the prior art can be used.
[0032] The experiments of the present application demonstrate that the mutant SF6-11 of phosphohydroxyl acetone phosphatase obtained by replacing a plurality of or one of M21V, N36D, L42P, T49A, I64V, S82G, T150S, and H244R in the amino acid sequence of phosphohydroxyl acetone phosphatase has a 1.65-fold increase in the yield of 1,3-dihydroxyacetone in shake flask fermentation compared with the starting wild-type phosphohydroxyl acetone phosphatase, and the yield of 1,3-dihydroxyacetone is increased from 2.75 ± 0.07 g / L to 4.54 ± 0.09 g / L. BRIEF DESCRIPTION OF DRAWINGS
[0033] Figure 1 Flow chart for screening of phosphohydroxyl acetone phosphatase CgHdpA mutants.
[0034] Figure 2 Comparison of the yield of 1,3-dihydroxyacetone and specific growth rate of phosphohydroxyl acetone phosphatase HdpA mutants and wild-type HdpA. WT is the starting phosphohydroxyl acetone phosphatase CgHdpA, and EP1-E12, SF2-5, SF3-16, SF4-4B4, SF5-21, and SF6-11 are phosphohydroxyl acetone phosphatase mutants. DETAILED DESCRIPTION
[0035] The present application will be further described in conjunction with the specific embodiments. The examples provided below are only for the purpose of illustrating the present application, and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the present application.
[0036] In the following examples, the experimental methods are conventional unless otherwise specified. The materials, reagents, and the like used in the following examples can be obtained from commercial sources unless otherwise specified.
[0037] The Gene ID of each gene involved in the following examples is the Gene ID in the NCBI database (all Gene ID information is from the NCBI database, webpage link: https: / / www.ncbi.nlm.nih.gov / nuccore / CP000946.1 / ), and is as follows: the nucleotide sequence of the coding gene of the endogenous glucose-specific PTS enzyme IIBC component PtsG (i.e., ptsG gene) is Gene ID: EcolC_2500 (submission date: February 14, 2008). The nucleotide sequence of the coding gene of the endogenous pyruvate formate-lyase PflB (i.e., pflB gene) is Gene ID: EcolC_2693 (submission date: February 14, 2008). The nucleotide sequence of the coding gene of the pyruvate oxidase PoxB (i.e., poxB gene) is Gene ID: EcolC_2725 (submission date: February 14, 2008). The nucleotide sequence of the coding gene of the endogenous alcohol dehydrogenase AdhE (i.e., adhE gene) is Gene ID: EcolC_2387 (submission date: February 14, 2008).
[0038] The nucleotide sequence of the gene encoding the endogenous histidine phosphate carrier protein PtsH (i.e., ptsH gene) is Gene ID: EcolC_1263 (as of February 14, 2008). The nucleotide sequence of the gene encoding the endogenous phospho-enolpyruvate-protein phosphotransferase IPtsI (i.e., ptsI gene) is Gene ID: EcolC 1262 (as of February 14, 2008). The nucleotide sequence of the gene encoding the endogenous glucose-specific enzyme II complex EIIA Crr (i.e., crr gene) is Gene ID: EcolC_1261 (as of February 14, 2008). The nucleotide sequence of the gene encoding the endogenous dihydroxyacetone kinase DhaRKLM (i.e., dhaRKLM gene) is Gene ID: EcolC_2425 (as of February 14, 2008), EcolC_2426 (as of February 14, 2008), EcolC_2427 (as of February 14, 2008), EcolC_2428 (as of February 14, 2008). The nucleotide sequence of the gene encoding the endogenous glycerol kinase GlpK (i.e., glpK gene) is Gene ID: EcolC_4092 (as of February 14, 2008). The nucleotide sequence of the gene encoding the methylglyoxal synthase MgsA (i.e., mgsA gene) is Gene ID: EcolC_2633 (as of February 14, 2008). The nucleotide sequence of the gene encoding the glycerol dehydrogenase GldA (i.e., gldA gene) is Gene ID: EcolC_4070 (as of February 14, 2008). The nucleotide sequence of the gene encoding the L-arabinose isomerase AraA (i.e., araA gene) is Gene ID: EcolC_3595 (as of February 14, 2008). The nucleotide sequence of the gene encoding the ribulokinase AraB (i.e., araB gene) is Gene ID: EcolC_3594 (as of February 14, 2008). The nucleotide sequence of the gene encoding the endogenous triose phosphate isomerase TpiA (i.e., tpiA gene) is Gene ID: EcolC_4099 (as of February 14, 2008).
[0039] The nucleotide sequence of the gene encoding the endogenous 6-phosphofructoaldolase 1 FsaA (i.e., fsaA gene) is Gene ID: EcolC_2819 (as of February 14, 2008). The nucleotide sequence of the gene encoding the endogenous 6-phosphofructoaldolase 2 FsaB (i.e., fsaB gene) is Gene ID: EcolC_4069 (as of February 14, 2008). The nucleotide sequence of the gene encoding the endogenous glycerol transporter GlpF (i.e., glpF gene) is Gene ID: EcolC_4091 (as of February 14, 2008). The nucleotide sequence of the gene encoding the endogenous 6-phosphogluconate dehydrogenase Zwf (i.e., zwf gene) is Gene ID: EcolC_1780 (as of February 14, 2008). The nucleotide sequence of the gene encoding the endogenous phosphogluconate dehydratase Edd (i.e., edd gene) is Gene ID: EcolC_1781 (as of February 14, 2008). The nucleotide sequence of the gene encoding the endogenous 2-keto-3-deoxy-6-phosphogluconate aldolase Eda (i.e., eda gene) is Gene ID: EcolC_1782 (as of February 14, 2008). Each of the above Gene IDs is a Gene ID in the NCBI database.
[0040] The E. coli strain TZ-237 involved in the following examples is a recombinant strain in which the full-length ptsHI-crr gene (1-2622 of ptsHI-crr gene, ptsHI-crr gene consists of three genes ptsH, ptsI and crr, the sequence numbers of the three genes are Gene ID: EcolC_1261, EcolC_1262, EcolC_1263), the full-length dhaRKLM gene (1-5290 of dhaRKLM gene, dhaRKLM gene consists of four genes dhaR, dhaK, dhaL and dhaM, the sequence numbers of the four genes are Gene ID: EcolC_2425, EcolC_2426, EcolC_2427, EcolC_2428), the 1-1509 of glpK gene (Gene ID: EcolC_4092), the 1-459 of mgsA gene (Gene ID: EcolC_2633), the 46-1104 of gldA gene (Gene ID: EcolC_2633), the 274-3159 of araBA gene (araBA gene consists of araB gene and araA gene, the knockout part is from 274 of araB gene to the end of araA gene; the two genes are Gene ID: EcolC_3594, EcolC_3595) and the 1-758 of tpiA gene (Gene ID: EcolC_4099) in ATCC 8739 are knocked out to achieve the purpose of inactivating the functions of these genes, and the P 93 The T7RNAP fragment (78-2682 of SEQ ID NO: 8) replaces the fragment shown in the 151-1434 of ptsG gene in the genome of ATCC 8739, and the poxB::P T7 The hdpA fragment (56-1158 of SEQ ID NO: 9) replaces the fragment shown in the 396-1083 of poxB gene in the genome of ATCC 8739, and the pflB::P T7 The hdpA fragment (56-1158 of SEQ ID NO: 11) replaces the fragment shown in the 1-2283 of pflB gene in the genome of ATCC 8739, and the 1-663 of fsaA gene and the 1-663 of fsaB gene are knocked out, and the 1-813 of glpF gene is knocked out, so that P 46 The nox (86-1621 of SEQ ID NO: 10) replaces the fragment shown in the 102-2676 of E. coli adhE gene; the 1-1476 of zwf gene is knocked out, the 1-1812 of edd gene is knocked out, and the 1-642 of eda gene is knocked out, to obtain the recombinant strain.
[0041] In the following examples, the P 10The promoter is a nucleotide sequence of SEQ ID NO: 4.
[0042] In the following examples, the plasmid pSC101 is publicly available from Tianjin Institute of Industrial Biotechnology, which is described in the non-patent literature Bernardi, A., Bernardi, F., 1984. Complete sequence of pSC101. Nucleic acids research. 12, 9415-26, and can be used for repeating the experiments of the present application, but cannot be used for other purposes.
[0043] In the following examples, the plasmid pKD46 is a product of the CGSC E. coli Stock Center of Yale University, which is described in the non-patent literature: Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A. 2000 Jun 6; 97(12): 6640-6645. The sequence of this plasmid has been disclosed in the NCBI database, with the sequence number AY048746.
[0044] In the following examples, the pACYC184 plasmid is described in the non-patent literature: Rose RE. The nucleotide sequence of pACYC184. Nucleic Acids Res. 1988 Jan 11; 16(1): 355. The sequence of this plasmid has been disclosed in the NCBI database, with the sequence number X06403.
[0045] In the following examples, the reagents PrimeSTAR GXL DNA Polymerase and TaKaRa Taq are products of Takara Bio Company (Beijing) Ltd. (Takara). The restriction endonuclease DpnI is a product of NEB Company.
[0046] The SanPrep Column DNA Gel Recovery Kit used for PCR product purification is a product of Shangon Biotech (Shanghai) Co., Ltd.
[0047] PCR SuperMix (+dye) and Trans1-T1 Phage Resistant chemically competent cells are products of Beijing TransGen Biotech Co., Ltd.
[0048] The LB solid medium in the following examples is a medium prepared from sodium chloride, peptone, yeast extract, agar and water, and the contents of sodium chloride, peptone, yeast extract and agar are as follows: 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract, 20 g / L agar.
[0049] The main strains and main plasmids used and constructed in the following examples are shown in Table 1 and Table 2, respectively.
[0050] Table 1 shows the main strains used and constructed in the present examples
[0051]
[0052]
[0053] Table 2 shows the main plasmids constructed in the present examples
[0054]
[0055] In the following examples, the LB liquid medium is a medium prepared from sodium chloride, peptone, yeast extract and water, and the contents of sodium chloride, peptone and yeast extract are as follows: 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract.
[0056] In the following examples, the M9 solid medium is a medium prepared from glucose, inorganic salt, trace element, agar and water, and the contents of glucose, inorganic salt, trace element and agar are as follows: 10 g / L glucose, 6.78 g / L Na2HPO4, 3.0 g / L KH2PO4, 1.0 g / L NH4Cl, 0.5 g / L NaCl, 0.493 g / L MgSO4·7H2O, 0.011 g / L CaCl2, 1 mL trace element, 20 g / L agar.
[0057] In the following examples, the M9 liquid medium is a medium prepared from glucose, inorganic salt, trace element and water, and the contents of glucose, inorganic salt and trace element are as follows: 10 g / L glucose, 6.78 g / L Na2HPO4, 3.0 g / L KH2PO4, 1.0 g / L NH4Cl, 0.5 g / L NaCl, 0.493 g / L MgSO4·7H2O, 0.011 g / L CaCl2, 1 mL trace element.
[0058] In the following examples, the fermentation CM9 medium: the composition of the medium per liter is 50 g glucose, 5 g white corn syrup powder, 0.47 g KCl, 1 g NH4Cl, 0.87 g (NH4)2SO4, 0.5 g MgSO4·7H2O, 1 mM KH2PO4, 1 mL trace element, and the balance is water.
[0059] The trace element formula is as follows: 0.2 g / L ZnCl2, 0.05 g / L H3BO3, 0.2 g / L CoCl2·6H2O, 0.1 g / L CuCl2·2H2O, 1.6 g / L FeCl3·6H2O, 0.17 g / L Na2MoO4·2H2O, and the balance is water.
[0060] LB solid medium containing chloramphenicol (final concentration 34 μg / ml) is a medium made of sodium chloride, peptone, yeast extract, agar, chloramphenicol and water, the contents of sodium chloride, peptone, yeast extract, agar, chloramphenicol are as follows: 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract, 20 g / L agar, 34 μg / ml chloramphenicol.
[0061] LB liquid medium containing chloramphenicol (final concentration 34 μg / ml) is a medium made of sodium chloride, peptone, yeast extract, chloramphenicol and water, the contents of sodium chloride, peptone, yeast extract, chloramphenicol are as follows: 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract, 34 μg / ml chloramphenicol.
[0062] LB solid medium containing ampicillin (final concentration 50 μg / ml) and chloramphenicol (final concentration 34 μg / ml) is a medium made of sodium chloride, peptone, yeast extract, agar, ampicillin, chloramphenicol and water, the contents of sodium chloride, peptone, yeast extract, agar, ampicillin, chloramphenicol are as follows: 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract, 20 g / L agar, 50 μg / ml ampicillin, 34 μg / ml chloramphenicol.
[0063] M9 solid medium containing ampicillin (final concentration 50 μg / ml) is a medium made of glucose, inorganic salt, trace element, agar and water, the contents of glucose, inorganic salt, trace element, agar are as follows: 10 g / L glucose, 6.78 g / L Na2HPO4, 3.0 g / L KH2PO4, 1.0 g / L NH4Cl, 0.5 g / L NaCl, 0.493 g / L MgSO4·7H2O, 0.011 g / L CaCl2, 1 mL trace element, 20 g / L agar, 50 μg / ml ampicillin.
[0064] M9 liquid medium containing ampicillin (final concentration 50 μg / ml) is a medium made of glucose, inorganic salts, agar and water. The contents of glucose, inorganic salts and agar are as follows: 10 g / L glucose, 6.78 g / L Na2HPO4, 3.0 g / L KH2PO4, 1.0 g / L NH4Cl, 0.5 g / L NaCl, 0.493 g / L MgSO4·7H2O, 0.011 g / L CaCl2, 1 mL trace elements, and 50 μg / ml ampicillin.
[0065] LB liquid medium containing 10% sucrose (sodium chloride-free) is a medium made of sucrose, peptone, yeast extract and water. The contents of sucrose, peptone and yeast extract are as follows: 10% sucrose, 10 g / L peptone, and 5 g / L yeast extract by mass percentage.
[0066] In the following examples, unless otherwise specified, the first position of each nucleotide sequence is the 5′ terminal nucleotide of the corresponding DNA, and the last position is the 3′ terminal nucleotide of the corresponding DNA.
[0067] Example 1: Construction of recombinant plasmid pSC100-CgHdpA
[0068] The main problem limiting the yield of 1,3-dihydroxyacetone is the low activity of the phosphate dihydroxyacetone phosphatase CgHdpA on the substrate phosphate dihydroxyacetone. Therefore, this invention primarily focuses on constructing and screening CgHdpA mutants to obtain the mutant with the best catalytic efficiency, maximizing the metabolic flux towards the 1,3-dihydroxyacetone metabolic pathway, thereby increasing the yield of 1,3-dihydroxyacetone to meet the requirements of industrial production. The specific process is as follows:
[0069] The constitutive low-copy weak promoter recombinant plasmid pSC100-CgHdpA contains the replication origin site ori of the low-copy plasmid pSC101 and the coding sequence of the replication protein RepA, as well as the constitutive artificially regulated promoter element P. 10 And the hdpA gene encoding phosphatase CgHdpA, the specific process is as follows:
[0070] 1. Amplify the pSC100 vector backbone
[0071] Using DNA from the low-copy plasmid pSC101 as a template, PCR amplification was performed using primer pair pSC-P10-up / pSC-HdpA-down:
[0072] pSC-P10-up:
[0073] 5'-GGCGAGAGGCTCAATTATATCAGCACAGGGCTCTTGTCAACACCGCCAGAGATAAGCGCCTGTAGTGCCATTTAC-3'
[0074] pSC-down: 5'-CCCCATGCGAGAGTAGGGAACT-3'
[0075] The amplification system was as follows: 5x PrimeSTAR GXL Buffer (Mg 2+ plus) 10 μl, dNTP 4 μl (2.5 mM of each dNTP), DNA template 1 μl (20 ng / μl), primer (10 μM) 1 μl each, PrimeSTAR GXL DNA Polymerase (1.25 U / μl) 0.5 μl, distilled water 32.5 μl, and the total volume was 50 μl.
[0076] The amplification conditions were as follows: 98°C pre-denaturation for 2 minutes (1 cycle); 98°C denaturation for 10 seconds, 55°C annealing for 15 seconds, 68°C extension for 50 seconds (30 cycles); and 68°C extension for 5 minutes (1 cycle).
[0077] The PCR amplification product was digested with restriction endonuclease DpnI at 37°C for 2 hours, and the PCR product was recovered using agarose gel to obtain the pSC100 vector skeleton.
[0078] 2. Amplification of phosphohydroxypyruvate phosphonase CgHdpA encoding gene hdpA
[0079] The hdpA gene of Corynebacterium glutamicum ATCC13032 (GeneBank No: CAF20597.1, 27-FEB-2015) was synthesized by Jinshui Biotechnology Co., Ltd. (hdpA gene) as the starting hdpA gene of the present embodiment. The gene encodes the phosphohydroxypyruvate phosphonase (CgHdpA) which will serve as the starting phosphohydroxypyruvate phosphonase of the present embodiment. The amino acid sequence of the phosphohydroxypyruvate phosphonase (CgHdpA) is shown in SEQ ID NO: 1 in the sequence listing, and the nucleotide sequence of the encoding gene hdpA gene is shown in SEQ ID NO: 2 in the sequence listing.
[0080] The hdpA gene shown in SEQ ID NO: 2 was used as a template, and primer pair HdpA-CF / HdpA-CR was used for PCR amplification to obtain an 878 bp hdpA gene fragment.
[0081] HdpA-CF:
[0082] 5'-TATAATTGAGCCTCTCGCCCCACCAATTCGGTTTAAACCAGGAAACAGCTATGACAGTAAACATATCATACCTAACTGA-3'
[0083] HdpA-CR:
[0084] 5'-AGTTCCCTACTCTCGCATGGGGTTAATCGGTAAATTGCTGTTCGTC-3'.
[0085] The amplification system was 5x PrimeSTAR GXL Buffer (Mg 2+ plus) 10 μl, dNTP 4 μl (2.5 mM of each dNTP), DNA template 1 μl (20 ng / μl), primer (10 μM) 1 μl each, PrimeSTAR GXL DNA Polymerase (1.25 U / μl) 0.5 μl, distilled water 32.5 μl, and the total volume was 50 μl.
[0086] The amplification conditions were pre-denaturation at 98°C for 2 minutes (1 cycle); denaturation at 98°C for 10 seconds, annealing at 55°C for 15 seconds, and extension at 68°C for 50 seconds (30 cycles); and extension at 68°C for 5 minutes (1 cycle). The PCR product was recovered using agarose gel.
[0087] 3. Construction of plasmid pSC100-CgHdpA
[0088] The pSC100 vector skeleton obtained in the above 1 was subjected to PCR rolling circle amplification connection with the hdpA gene fragment obtained in the above 2, to obtain a PCR amplification product.
[0089] The amplification system was 5x PrimeSTAR GXL Buffer (Mg 2+ plus) 10 μl, dNTP 4 μl (2.5 mM of each dNTP), pSC100 vector skeleton 2 μl, hdpA gene fragment 2 μl, PrimeSTAR GXL DNA Polymerase (1.25 U / μl) 0.5 μl, distilled water 31.5 μl, and the total volume was 50 μl.
[0090] The amplification conditions were pre-denaturation at 98°C for 2 minutes (1 cycle); denaturation at 98°C for 10 seconds, annealing at 60°C for 15 seconds, and extension at 68°C for 3 minutes (30 cycles); and extension at 68°C for 5 minutes (1 cycle).
[0091] Dilute the PCR product 5-fold and heat shock transform Trans1-T1 Phage Resistant chemically competent cells: Add the ligation product to 50 μl Trans1-T1 chemically competent cells, ice bath for 30 minutes, 42°C heat shock for 30 seconds, immediately placed on ice for 2 minutes, add 250 μl LB liquid medium, 200 rpm, 37°C incubate for 1 hour. The transformed cells are coated with LB solid medium containing ampicillin (final concentration of 50 μg / ml), 37°C overnight culture. Pick 10 clones, use primers pSC-YZ-up / pSC-YZ-down for strain PCR, extract plasmid sequencing analysis:
[0092] pSC-YZ-up: 5'-GGCACCTGAGTCGCTGTCTTTTT-3'
[0093] pSC-YZ-down: 5'-CCAGTTTGCTCAGGCTCTCCCA-3'
[0094] The plasmid is to insert the hdpA gene fragment (the product of PCR amplification with sequence 2 as template, HdpA-CF and HdpA-CR) into the P 10 downstream of the promoter (sequence 4), keeping other sequences of the pSC100 vector unchanged, to obtain a recombinant expression vector, named pSC100-CgHdpA.
[0095] Example 2, screening of phosphonacetylpropionate phosphatase CgHdpA dominant mutants by growth coupling method
[0096] Figure 1 Flow chart for screening of phosphonacetylpropionate phosphatase CgHdpA mutants.
[0097] 1. Construction of growth coupling screening host strain TZ-238
[0098] First, the growth coupling screening host strain needs to be constructed for the screening platform of the phosphonacetylpropionate phosphatase CgHdpA mutant plasmid library. The construction of the growth coupling screening host strain starts from the 1,3-dihydroxyacetone engineering strain TZ-237, and uses a two-step homologous recombination method to knock out the inserted hdpA gene in the strain chromosome (located in poxB, pflB), respectively, to obtain recombinant E. coli TZ-238, which includes the following 4 steps:
[0099] 1) Use pACYC184 plasmid as template to amplify homologous recombination fragment poxB-Cm
[0100] Use primer pair poxB-Cm-up / poxB-Cm-down for PCR amplification:
[0101] poxB-Cm-up:
[0102] AAACCCACCCACAAGAGCTATTCCGCGAATGTAGTCACTATTGCGAGCTGGTTTCTGTGACGGAAGATCACTTCGCA
[0103] poxB-Cm-down:
[0104] CGTCACAGGTGAAAATAGCGTCATCGGCGGCAAAATGACTAATTTGCTGCGCCAGTTACGCCCCGCCCTGCCACT
[0105] The amplification system was 5x PrimeSTAR GXL Buffer (Mg 2+ plus) 10 μl, dNTP 4 μl (2.5 mM of each dNTP), DNA template 1 μl (20 ng / μl), primer (10 μM) 1 μl each, PrimeSTAR GXL DNA Polymerase (1.25 U / μl) 0.5 μl, distilled water 32.5 μl, and the total volume was 50 μl.
[0106] The amplification conditions were 98°C pre-denaturation for 2 minutes (1 cycle); 98°C denaturation for 10 seconds, 54°C annealing for 15 seconds, 68°C extension for 40 seconds (30 cycles); and 68°C extension for 5 minutes (1 cycle).
[0107] A 966 bp DNA fragment poxB-Cm was obtained by PCR amplification. The poxB-Cm contained a DNA fragment of a chloramphenicol gene and its promoter and a 55 bp homologous recombination fragment on the left and right of the poxB gene. The nucleotide sequence of the poxB-Cm is shown in SEQ ID NO: 5.
[0108] The DNA fragment poxB-Cm was used for homologous recombination: first, the plasmid pKD46 was transformed into the 1,3-dihydroxyacetone-producing engineering strain TZ-237 by electroporation, and then the DNA fragment poxB-Cm was electroporated into the 1,3-dihydroxyacetone-producing engineering strain TZ-237 with the plasmid pKD46.
[0109] The electroporation and screening process is as follows: first, prepare the electroporation competent cells of the 1,3-dihydroxyacetone producing engineered strain TZ-237 with plasmid pKD46, refer to "Dower, W. J., Miller, J. F., Ragsdale, C. W., 1988. High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res. 16, 6127-45"; place 50 μl of the electroporation competent cells of the 1,3-dihydroxyacetone producing engineered strain TZ-237 with plasmid pKD46 on ice, add 50 ng of DNA fragment poxB-Cm, and place on ice for 2 minutes, and then transfer to a 2 mm Bio-Rad electroporation cup. Use a MicroPulser (Bio-Rad) electroporation instrument, and the shock parameters are voltage 2.5 kv. After the shock, quickly transfer 1 ml of LB liquid medium to the electroporation cup, blow 5 times, then transfer to a test tube, incubate at 75 rpm and 30°C for 4 hours. Take 200 μl of the obtained bacterial liquid, and spread on an LB solid medium containing ampicillin (final concentration 50 μg / ml) and chloramphenicol (final concentration 34 μg / ml), and incubate at 30°C overnight. After incubation, select 10 single colonies for PCR verification, and use primers Cm-YZ-up / poxB-YZ-down for verification:
[0110] Cm-YZ-up: 5'-CTACACATATATTCGCAAGATGTGGCGTG-3'
[0111] poxB-YZ-down: 5'-CAAAGTTTGTGTCGTGTAGTTCGGTGC-3'
[0112] The amplification system is as follows: PCR SuperMix (+dye) 10 μl, primers (10 μM) 1 μl each, distilled water 8 μl, total volume 20 μl, and inoculate the single colony into the system.
[0113] The amplification conditions are as follows: 94°C pre-denaturation for 5 minutes (1 cycle); 94°C denaturation for 30 seconds, 60°C annealing for 30 seconds, 72°C extension for 40 seconds (30 cycles); and 72°C extension for 5 minutes (1 cycle).
[0114] Detect the PCR amplification product by agarose gel electrophoresis, and the correct clone has a DNA band of 1198 bp. Name the single colony verified by sequencing as TZ-237 (poxB-Cm).
[0115] 2) Using pET30a plasmid (Novagen, Cat. No. 69909) as a template, a homologous recombination fragment pflB-Kan was amplified
[0116] PCR amplification was performed using primer pair pflB-Kan-up / pflB-Kan-down:
[0117] pflB-Kan-up:
[0118] TGGTTGTCGAAGTACGCAGTAAATAAAAAATCCACTTAAGAAGGTAGGTGTTACGAAGATCCTTTGATCTTTTCTACGGG
[0119] pflB-Kan-down:
[0120] CTTTCGTGGAGCCTTTATTGTACGCTTTTTACTGTACGATTTCAGTCAAATCTAATTAGAAAAACTCATCGAGCATCAAATG
[0121] The amplification system was as follows: 5x PrimeSTAR GXL Buffer (Mg 2+ plus) 10 μl, dNTP 4 μl (2.5 mM for each dNTP), DNA template 1 μl (20 ng / μl), primer (10 μM) 1 μl each, PrimeSTAR GXL DNA Polymerase (1.25 U / μl) 0.5 μl, distilled water 32.5 μl, and the total volume was 50 μl.
[0122] The amplification conditions were as follows: pre-denaturation at 98 °C for 2 minutes (1 cycle); denaturation at 98 °C for 10 seconds, annealing at 54 °C for 15 seconds, and elongation at 68 °C for 40 seconds (30 cycles); and elongation at 68 °C for 5 minutes (1 cycle).
[0123] PCR amplification obtained a 1046 bp DNA fragment pflB-Kan. pflB-Kan contains a DNA fragment of a kanamycin gene and its promoter and a 55 bp homologous recombination fragment on the left and right of the pflB gene knockout. The nucleotide sequence of the pflB-Kan is shown in SEQ ID NO: 6.
[0124] The DNA fragment pflB-Kan was used for homologous recombination: first, the engineering strain TZ-237 (poxB-Cm) carrying plasmid pKD46 was prepared into electrocompetent cells, and then the DNA fragment pflB-Kan was electroporated into the electrocompetent cells of the engineering strain TZ-237 (poxB-Cm) carrying plasmid pKD46.
[0125] The electroporation and screening process is as follows: first, prepare the electroporation competent cells of the 1,3-dihydroxyacetone engineering strain TZ-237 with plasmid pKD46, according to the method of "Dower, W. J., Miller, J. F., Ragsdale, C. W., 1988. High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res. 16, 6127-45"; place 50 μl of the electroporation competent cells of the engineering strain TZ-237 (poxB-Cm) with plasmid pKD46 on ice, add 50 ng of DNA fragment pflB-Kan, and place on ice for 2 minutes, and then transfer to a 2 mm Bio-Rad electroporation cup. Use a MicroPulser (Bio-Rad) electroporation instrument, and the electroporation parameters are voltage 2.5 kv. After electroporation, quickly transfer 1 ml of LB liquid medium to the electroporation cup, shake 5 times, then transfer to a test tube, and incubate at 30°C at 75 rpm for 4 hours. Take 200 μl of the obtained bacterial liquid, and spread on an LB solid medium containing carbenicillin (final concentration 50 μg / ml) and chloramphenicol (final concentration 34 μg / ml), and incubate at 30°C overnight. After incubation, select 10 single colonies for PCR verification, and use primers Kan-YZ-up / pflB-YZ-down for verification:
[0126] Kan-YZ-up: 5'-GAGTGATTTTGATGACGAGCGTAATGGC-3'
[0127] pflB-YZ-down: 5'-ACAGGATTCAAAGGAGTGAATGCGAC-3'
[0128] The amplification system is as follows: PCR SuperMix (+dye) 10 μl, primers (10 μM) 1 μl each, distilled water 8 μl, and the total volume is 20 μl. The single colony is picked and inoculated into the system.
[0129] The amplification conditions are as follows: 94°C pre-denaturation for 5 minutes (1 cycle); 94°C denaturation for 30 seconds, 60°C annealing for 30 seconds, 72°C extension for 40 seconds (30 cycles); and 72°C extension for 5 minutes (1 cycle).
[0130] The PCR amplification product is detected by agarose gel electrophoresis, and the correct clone has a 558 bp DNA band. The correct single colony is named TZ-238 after sequencing verification.
[0131] Strain TZ-238 is P T7 -hdpA gene (positions 56-1158 of SEQ ID NO: 9) is replaced with Cm promoter + chloramphenicol gene (positions 56-911 of poxB-Cm sequence shown in SEQ ID NO: 5), and P T7 -hdpA gene (positions 56-1158 of SEQ ID NO: 11) is replaced with Kan promoter + kanamycin gene (positions 56-991 of SEQ ID NO: 6).
[0132] 2. Constructing HdpA mutation library by error-prone PCR method
[0133] The specific steps are as follows:
[0134] 1) Amplifying pSC100 vector skeleton
[0135] The recombinant plasmid pSC100-CgHdpA in Example 1 was used as a template, and primer pair pSC100-F / pSC100-R was used for amplification.
[0136] pSC100-F: AGCTGTTTCCTGGTTTAAACCGAATTGG
[0137] pSC100-R: CCCCATGCGAGAGTAGGGAACT
[0138] The amplification system was as follows: 5x PrimeSTAR GXL Buffer (Mg 2+ plus) 10 μl, dNTP 4 μl (2.5 mM of each dNTP), pSC100-CgHdpA template 1 μl (20 ng / μl), primer (10 μM) 1 μl each, PrimeSTAR GXL DNA Polymerase (1.25 U / μl) 0.5 μl, distilled water 32.5 μl, and the total volume was 50 μl.
[0139] The amplification conditions were as follows: 98°C pre-denaturation for 2 minutes (1 cycle); 98°C denaturation for 10 seconds, 54°C annealing for 15 seconds, 68°C extension for 90 seconds (30 cycles); and 68°C extension for 5 minutes (1 cycle).
[0140] The PCR amplification obtained a 3500 bp DNA fragment pSC100 vector skeleton. The PCR amplification product was digested with restriction endonuclease DpnI at 37°C for 2 hours, and the PCR product was recovered using agarose gel.
[0141] 2) Error-prone PCR amplification of CgHdpA mutant fragments
[0142] The recombinant plasmid pSC100-CgHdpA in Example 1 was used as a template, and primer pair CgHdpA-p100-CF / CgHdpA-pSC-CR was used.
[0143] CgHdpA-p100-CF:
[0144] CCAATTCGGTTTAAACCAGGAAACAGCTATGACAGTAAACATATCATACCTAACTGA
[0145] CgHdpA-pSC-CR:
[0146] AGTTCCCTACTCTCGCATGGGGTTAATCGGTAAATTGCTGTTCGTC
[0147] The error-prone PCR reaction system: Taq PCR Buffer 10X buffer 5 μl, dNTP (10 mM) 1 μl, dATP (10 mM) 2 μl, dTTP (10 mM) 2 μl, MnCl2 (25 mM) 1 μl, primer (10 μM) 1 μl each, pSC100-CgHdpA template (10 ng / μl), Taq DNA polymerase (2.5 U / μl) 1 μl, the rest is water, the total volume is 50 μl.
[0148] Error-prone PCR amplification conditions: 94°C pre-denaturation for 3 minutes (1 cycle); 94°C denaturation for 30 seconds, 55°C annealing for 30 seconds, 72°C extension for 1 minute (35 cycles); 72°C extension for 10 minutes (1 cycle).
[0149] The error-prone PCR amplification obtained 878 bp CgHdpA mutant fragment, the PCR amplification product was digested with restriction endonuclease DpnI, 37°C reaction for 2 hours, the CgHdpA mutant fragment was recovered by agarose gel.
[0150] 3), PCR amplification reaction
[0151] After recovering the CgHdpA mutant fragment obtained in 2) by agarose gel electrophoresis, the pSC100 vector skeleton obtained in 1) was subjected to PCR amplification reaction together with the CgHdpA mutant fragment, and the PCR ligation product was obtained, which was the CgHdpA mutant library (abbreviated as pSC100-mCgHdpA).
[0152] The amplification system was: 5×PrimeSTAR GXL Buffer (Mg 2+10 μl, dNTP 4 μl (2.5 mM each), pSC100 vector backbone 5 μl (50 ng / μl), CgHdpA mutant fragment 5 μl (100 ng / μl), PrimeSTAR GXL DNA Polymerase (1.25 U / μl) 0.5 μl, distilled water 25.5 μl, total volume 50 μl.
[0153] The amplification conditions were 98°C pre-denaturation for 2 minutes (1 cycle); 98°C denaturation for 10 seconds, 54°C annealing for 15 seconds, 68°C extension for 2 minutes (35 cycles); 68°C extension for 5 minutes (1 cycle).
[0154] The PCR amplification obtained a 4343 bp ligation product pSC100-mCgHdpA.
[0155] 3. Screening of CgHdpA mutant library by growth coupling
[0156] The PCR ligation product obtained in 2) above was diluted 5 times, and then transformed into the competent cells of the screening host strain TZ-238 obtained in 1). The transformed cells were spread on M9 solid medium containing ampicillin (final concentration 50 μg / ml) and incubated at 37°C overnight. The library capacity was 300,000 CFU / μg DNA. The colony size was observed. The clone strain carrying the mutant of phosphohydroxypyruvate aldolase HdpA with complete catalytic function could grow normally, the clone strain carrying the mutant of phosphohydroxypyruvate aldolase HdpA with lost activity could not grow, the clone strain carrying the mutant of phosphohydroxypyruvate aldolase HdpA with reduced activity could grow weakly with smaller colony diameter, and the clone strain carrying the mutant of phosphohydroxypyruvate aldolase HdpA with increased activity could grow normally with larger colony diameter.
[0157] The clone strain with normal growth and larger colony diameter was selected as the mutant-containing strain.
[0158] The mutant-containing strain was cultured in a 96-well deep well plate. The clone strain containing the starting gene phosphohydroxypyruvate aldolase HdpA (i.e. the recombinant strain obtained by transforming pSC100-CgHdpA plasmid into TZ-238) was used as a control. The growth difference between the mutant-containing strain and the control was screened and compared. The specific steps were as follows:
[0159] (1) 96-well deep well plate culture: pick control group clones and mutant-containing strain clones with larger colony diameter, inoculate into 96-well deep well plates (500 μl medium, 2000 μl volume) containing ampicillin (final concentration 50 μg / ml) M9 liquid medium, and inoculate into LB solid medium containing ampicillin (final concentration 50 μg / ml) plates as backup, and incubate overnight at 37°C and 1000 rpm.
[0160] (2) Enzyme marker detection: use an 8-channel pipette (50-300 μl) to take 200 μl of bacterial liquid and add it to a 96-well microplate, and place it in an enzyme marker (TECAN, Switzerland) to detect the OD600nm value of the bacterial liquid, and select mutant-containing strain clones with values greater than the control group.
[0161] (3) Growth curve re-screening: inoculate control group clones and selected mutant-containing strain clones into 48-well deep well plates (500 μl medium, 5000 μl volume) containing ampicillin (final concentration 50 μg / ml) M9 liquid medium, and place them in a MicroScreen high-throughput microbial growth analysis system (MicroScreen-HT, Jingling Instruments, Tianjin, China), and incubate overnight at 37°C and 1000 rpm. Set the OD600nm value to be detected every 1 hour, automatically draw the growth curve of each group of clones, calculate the specific growth rate μ (h -1 ), and select mutant-containing strain clones with μ values higher than the control group.
[0162] Specific growth rate μ: the amount of bacterial mass increased per hour per unit mass of bacterial mass is called the specific growth rate of bacterial mass. It is a parameter that characterizes the growth rate of microorganisms and is an important parameter in fermentation kinetics.
[0163] The calculation formula is: μ = [ln(N2 / N1)] / t
[0164] μ - specific growth rate, unit h-1
[0165] t - time, unit h
[0166] N2 - the amount of microbial cells at any time
[0167] N1 - the amount of biological cells after t hours of incubation
[0168] 4. Constructing an HdpA mutation library using DNA shuffling
[0169] 1) Obtain mHdpA mutant fragments using DNA shuffling
[0170] The strains containing mutations with a higher μ value than the control group were selected from the screening of 3, the plasmid was extracted, marked as mHdpA mutant plasmid, and sent to a sequencing company (GENEWIZ, Suzhou) for sequencing analysis. The mHdpA mutant plasmid containing different mutation sites was selected, and different mHdpA mutant fragments were amplified using primer pairs pSC-YZ-F / pSC-YZ-F:
[0171] pSC-YZ-F: GGCACCTGAGTCGCTGTCTTTTT
[0172] pSC-YZ-F: CCAGTTTGCTCAGGCTCTCCCA
[0173] The amplification system is as follows: PCR SuperMix (+dye) 25 μl, template plasmid 1 μl, primer (10 μM) 1 μl each, distilled water 22 μl, total volume 50 μl.
[0174] The amplification conditions are as follows: 94°C pre-denaturation for 5 minutes (1 cycle); 94°C denaturation for 30 seconds, 60°C annealing for 30 seconds, 72°C extension for 40 seconds (30 cycles); 72°C extension for 5 minutes (1 cycle).
[0175] The PCR amplification product was detected by agarose gel electrophoresis, and the correct clone had a DNA band of 1278 bp. Each mutant fragment was recovered by agarose gel electrophoresis.
[0176] An equal amount of different mutant fragments was mixed to perform DNA shuffling experiment, and the specific experimental steps are described in reference literature “Zhang C, Chen Q, Fan F, Tang J, Zhan T, Wang H, Zhang X. Directed evolution of alditol oxidase for the production of optically pure D-glycerate from glycerol in the engineered Escherichia coli. J Ind Microbiol Biotechnol. 2021 Aug 24; 48 (7-8): kuab041 ”.
[0177] 2) Construction of DNA shuffling library
[0178] The mHdpA mutant fragments (mixed different mutant fragments) obtained in 1) were subjected to PCR amplification and ligation reaction with pSC100 vector, and the specific steps were the same as those in 2) 3), to construct the DNA shuffling library of mHdpA.
[0179] 3) Screening of DNA shuffling library
[0180] The PCR ligation product obtained in 2) was diluted 5 times, and then transformed into the competent cells of the screening host strain TZ-238 obtained in 1). The DNA shuffling library screening step was the same as in 3), and a strain clone with a larger colony diameter was selected as a mutant-containing strain clone, which was recorded as the screening host strain TZ-238 carrying the phosphonacetaldehyde phosphatase HdpA mutant plasmid.
[0181] 5. Screening of phosphonacetaldehyde phosphatase HdpA dominant mutants by production of 1,3-dihydroxyacetone
[0182] The screening host strain TZ-238 carrying the recombinant plasmid pSC100-HdpA with the starting gene was used as a control group, and the screening host strain TZ-238 carrying the phosphonacetaldehyde phosphatase HdpA mutant plasmid was used for shake flask fermentation production of 1,3-dihydroxyacetone. The specific steps are as follows:
[0183] (1) Seed culture: the single clone to be tested was inoculated into a small test tube (15 mm x 100 mm) containing 3 ml of LB liquid medium containing ampicillin (final concentration of 50 μg / ml), and incubated at 37°C and 250 rpm overnight to obtain a seed liquid for inoculation of the fermentation medium.
[0184] (2) Subculture: the seed culture liquid was inoculated into 50 ml of CM9 liquid medium (250 ml flask) at an inoculation amount of 1% (V / V) for culture, and incubated at 37°C and 250 rpm for 48 h.
[0185] (3) Analysis method: 2 ml of the bacterial liquid after step (2) was centrifuged at 13,000 rpm for 2 min to collect the supernatant, 100 μl of which was removed into 900 μl of sterile water for 10-fold dilution. The supernatant was filtered using a 0.22 μm inorganic filter, and the content of 1,3-dihydroxyacetone was analyzed using high performance liquid chromatography (HPLC).
[0186] After filtering the supernatant, the production of 1,3-dihydroxyacetone was analyzed by HPLC. The 1,3-dihydroxyacetone standard was purchased from Shanghai Maier Biochemical Technology Co., Ltd., and the product catalog number was B66080-500G. The 1,3-dihydroxyacetone peak time was 9.5 min. The HPLC quantitative detection of 1,3-dihydroxyacetone standard curve equation was y = 346656x + 12665, R2= 0 9999. After diluting the filtered supernatant by a certain multiple, HPLC quantitative detection was performed, the peak area obtained was the y value, which was brought into the 1,3-dihydroxyacetone standard curve equation to obtain the x value, and then multiplied by the dilution multiple to obtain the yield.
[0187] The HPLC detection conditions were as follows: using Yuhua The fermentation product was analyzed by HPLC using a Sugar-Ca column, the column oven was controlled at 70℃, the mobile phase was 0.5 g / L EDTA-Ca aqueous solution, the flow rate was 0.4 ml / min, the injection volume was 20 μl, and the detection time was 30 min.
[0188] 6. Evaluation of 1,3-dihydroxyacetone production by HdpA mutants of dihydroxyacetone phosphate phosphatase
[0189] The 6 superior mutants screened from the first round of error-prone PCR mutant library and the second to fifth rounds of DNA shuffling libraries were subjected to shake flask fermentation and 48-well plate culture, and the 1,3-dihydroxyacetone production, specific growth rate μ value calculation and growth curve analysis were performed according to the 1,3-dihydroxyacetone content analysis method, specific growth rate μ value calculation and growth curve analysis method of Step 5.
[0190] 1,3-dihydroxyacetone production is shown in Table 3 Figure 2 , wherein WT is the screening host strain TZ-238 carrying the starting gene recombinant plasmid pSC100-HdpA, and EP1-E12, SF2-5, SF3-16, SF4-4B4, SF5-21 and SF6-11 represent 6 screening host strains carrying HdpA mutant plasmids of dihydroxyacetone phosphate phosphatase. It can be seen that the production of the 6 screening host strains carrying HdpA mutant plasmids of dihydroxyacetone phosphate phosphatase is higher than that of the screening host strain TZ-238 carrying the starting gene recombinant plasmid pSC100-HdpA, and the specific growth rate μ value of the screening host strains carrying HdpA mutant plasmids of dihydroxyacetone phosphate phosphatase is also improved round by round. Among them, the 1,3-dihydroxyacetone production of the screening host strain carrying the HdpA mutant SF6-11 plasmid of dihydroxyacetone phosphate phosphatase is the highest, reaching 4.54±0.09 g / L, which is 1.65 times higher than that of the screening host strain TZ-238 carrying the starting gene recombinant plasmid pSC100-HdpA (Table 3), and the specific growth rate μ value of the screening host strain carrying the HdpA mutant SF6-11 plasmid of dihydroxyacetone phosphate phosphatase is also the highest, reaching 0.39±0.002 h -1 , which is 1.86 times higher than that of the screening host strain TZ-238 carrying the starting gene recombinant plasmid pSC100-HdpA (Table 3). Table 3 shows the evaluation of 1,3-dihydroxyacetone production by the screening host strains carrying HdpA mutant plasmids of dihydroxyacetone phosphate phosphatase.
[0191] Control and Mutant DHA (g / L) μ(h -1 )]]> HdpA 2.75±0.07 0.21±0.018 SF6-11 4.54±0.09 0.39±0.002
[0192] The first column in the above table is the name of the screening host strain carrying the phosphohydroxypyruvate phosphonase HdpA mutant SF6-11 plasmid, which is replaced by the name of the mutant protein.
[0193] The amino acid sequence of the mutant SF3-16 is shown in SEQ ID NO. 7.
[0194] 7. Mutation site analysis of the phosphohydroxypyruvate phosphonase HdpA mutant
[0195] The phosphohydroxypyruvate phosphonase mutant SF6-11 was subjected to gene sequencing analysis. The nucleotide change information and mutation site amino acid of the mutant SF6-11, relative to the starting hdpA gene of SEQ ID NO. 2 in the sequence listing and the HdpA encoded thereby (SEQ ID NO. 1, starting phosphohydroxypyruvate phosphonase), are shown in Table 4.
[0196] Table 4 is the sequence analysis of the phosphohydroxypyruvate phosphonase mutant HdpA mutant
[0197]
[0198] In the second and third columns of the above table, the numbers in the nucleotide change and amino acid change represent the mutation position, the nucleotide or amino acid residue before the number represents the nucleotide or amino acid residue before mutation, and the nucleotide or amino acid residue after the number represents the nucleotide or amino acid residue after mutation.
[0199] The mutant SF6-11 gene is a mutant gene obtained by replacing the 189th nucleotide of the CDS (SEQ ID NO. 2) of the HdpA gene with G, the 191st nucleotide with A, the 234th nucleotide with G, the 253rd nucleotide with C, the 273rd nucleotide with G, the 318th nucleotide with G, the 320th nucleotide with T, the 372nd nucleotide with G, the 374th nucleotide with T, the 576th nucleotide with A, the 859th nucleotide with G, and keeping the other nucleotides of HdpA unchanged.
[0200] The amino acid sequence of the mutant SF6-11 is SEQ ID NO. 3, which is a mutant protein obtained by mutating the HdpA protein (SEQ ID NO. 1) as follows: M21V, N36D, L42P, T49A, I64V, S82G, T150S, H244R, and keeping the other amino acid residues of the HdpA protein unchanged.
[0201] Example 3, Application of the mutant SF6-11 in improving 1,3-dihydroxypropanone
[0202] I. Construction of the recombinant vector pSC100-SF6-11
[0203] The recombinant vector pSC100-SF6-11 was constructed according to the method in Example 1.
[0204] 1. Amplification of pSC100 vector backbone
[0205] 1. The same as 1 in Example 1.
[0206] 2. Amplification of the gene encoding the mutant SF6-11 of dihydroxyacetone phosphate phosphatase CgHdpA
[0207] 2. Basically the same as 2 in Example 1, except that:
[0208] The gene encoding the mutant SF6-11 of CgHdpA shown in SEQ ID NO: 3 was used as a template, and primer pair HdpA-CF / HdpA-CR was used for PCR amplification, to obtain an 878 bp SF6-11 gene fragment.
[0209] HdpA-CF:
[0210] 5'-TATAATTGAGCCTCTCGCCCCACCAATTCGGTTTAAACCAGGAAACAGCTATGACAGTAAACATATCATACCTAACTGA-3'
[0211] HdpA-CR:
[0212] 5'-AGTTCCCTACTCTCGCATGGGGTTAATCGGTAAATTGCTGTTCGTC-3'.
[0213] 3. Construction of plasmid pSC100-SF6-11
[0214] The SF6-11 gene fragment of 2 above and the vector backbone of 1 above were ligated according to the method of 3 in Example 1, to obtain the recombinant vector pSC100-SF6-11.
[0215] The recombinant vector pSC100-SF6-11 is a recombinant expression vector in which the nucleotide sequence of the protein shown in SEQ ID NO: 3 (mutant SF6-11 gene) is inserted into the P 10 The promoter downstream, while keeping the other sequences of the pSC100 vector unchanged, is named pSC100-SF6-11.
[0216] II. Construction of recombinant bacteria
[0217] The recombinant vector pSC100-SF6-11 and the recombinant plasmid pSC100-HdpA in Example 1 were introduced into the host strain TZ-238 constructed in Example 2, respectively, to obtain recombinant bacteria TZ-238 / pSC100-SF6-11 and TZ-238 / pSC100-HdpA.
[0218] III. Fermentative production of 1,3-dihydroxyacetone
[0219] The specific steps are as follows:
[0220] 1. Seed culture: Single colonies of the recombinant bacteria TZ-238 / pSC100-SF6-11 and TZ-238 / pSC100-HdpA were picked and inoculated into small test tubes (15 mm x 100 mm) containing 3 ml of LB liquid medium containing ampicillin (final concentration 50 μg / ml) and incubated at 37°C and 250 rpm overnight to obtain seed liquid for inoculation of fermentation medium.
[0221] 2. Subculture: Each seed liquid was inoculated into 50 ml of CM9 medium (250 ml flask) at an inoculation amount of 1% (V / V) and incubated at 37°C and 250 rpm for 48 h, and the bacterial liquid was collected.
[0222] 3. Analysis method: 2 ml of the bacterial liquid after step 2 was centrifuged at 13,000 rpm for 2 min to collect the supernatant, 100 μl of which was transferred into 900 μl of sterile water and diluted 10-fold. The supernatant was filtered using a 0.22 μm inorganic filter membrane, and the yield of 1,3-dihydroxyacetone was analyzed using high performance liquid chromatography (HPLC) (same as 5 of Example 2).
[0223] The growth rates of the recombinant bacteria TZ-238 / pSC100-SF6-11 and TZ-238 / pSC100-HdpA were detected according to the method of 3 of Example 2.
[0224] The results are as follows: The yield of 1,3-dihydroxyacetone of the recombinant bacteria TZ-238 / pSC100-SF6-11 was the highest, reaching 4.54 ± 0.09 g / L, which was 1.65 times higher than that of TZ-238 / pSC100-HdpA (Table 3). The specific growth rate μ of the recombinant bacteria TZ-238 / pSC100-SF6-11 was also the highest, reaching 0.39 ± 0.002 h -1 , which was 1.86 times higher than that of TZ-238 / pSC100-HdpA. The difference between the two strains was only in the coding genes of HdpA gene (sequence 2) and HdpA mutant SF6-11 (sequence 3).
[0225] Therefore, it can be seen that the HdpA mutant SF6-11 can produce or increase the yield of 1,3-dihydroxyacetone, and the mutation of the HdpA gene into the HdpA mutant SF6-11 coding gene can increase the yield of 1,3-dihydroxyacetone and also increase the growth rate of the strain.
[0226] The application has been described in detail above. For those skilled in the art, the application can be implemented in a wider range under equivalent parameters, concentrations and conditions without departing from the purpose and scope of the application and without unnecessary experiments. Although the application gives a specific example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the present application intends to include any change, use or improvement of the application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in the present application. Some basic features can be applied within the scope of the following attached claims.
Claims
1. A mutant protein of dihydroxyacetone phosphate phosphatase, which is obtained by mutating M at position 21, N at position 36, L at position 42, T at position 49, I at position 64, S at position 82, T at position 150 and H at position 244 to V, D, P, A, V, G, S and R, respectively, in the amino acid sequence shown in SEQ ID NO: 1, while keeping other amino acid residues unchanged, and which has dihydroxyacetone phosphate phosphatase activity.
2. A biological material related to the mutant protein of claim 1, characterized in that: The relevant biological material is any one of the following B1) to B8): B1) a nucleic acid molecule encoding the mutant protein; B2) an expression cassette containing the nucleic acid molecule of B1); B3) a recombinant vector containing the nucleic acid molecule of B1); B4) a recombinant vector containing the expression cassette of B2); B5) a recombinant microorganism containing the nucleic acid molecule of B1); B6) a recombinant microorganism containing the expression cassette of B2); B7) a recombinant microorganism containing the recombinant vector of B3); B8) a recombinant microorganism containing the recombinant vector of B4).
3. The biological material of claim 2, wherein: The recombinant microorganism is Escherichia coli.
4. The biological material of claim 2 or 3, wherein: The recombinant microorganism is prepared by introducing the gene encoding the mutant protein of claim 1 into a host bacterium to obtain a recombinant microorganism.
5. Use of the mutant protein of claim 1 in the preparation of 1, 3-dihydroxyacetone or for increasing the production of 1, 3-dihydroxyacetone.
6. Use of the relevant biological material of claim 2 in the production of 1, 3-dihydroxyacetone or for increasing the production of 1, 3-dihydroxyacetone.
7. A method for producing 1, 3-dihydroxyacetone or for increasing the production of 1, 3-dihydroxyacetone, comprising the step of fermenting the recombinant microorganism of claim 2 to obtain 1, 3-dihydroxyacetone.
Citation Information
Patent Citations
L-valine producing strain as well as construction method and application thereof
CN117844728A