A nanocarrier-based dsRNA biopesticide formulation, its preparation method, and its application.

By using ZIF-8@PDA nanocarriers to load dsRNA targeting the CHS and V-ATPaseB genes and combining it with Serratia marcescens, the problems of dsRNA delivery efficiency and stability in pest control were solved, achieving efficient and environmentally friendly pest control and reducing the use of chemical pesticides and environmental pollution.

CN119979537BActive Publication Date: 2025-12-02SUN YAT SEN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510113702.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-24
Publication Date
2025-12-02
Estimated Expiration
2045-01-24

AI Technical Summary

Technical Problem

The insufficient delivery efficiency and stability of dsRNA in pest control limit the application of RNAi technology in pest control, and the long-term use of chemical pesticides has led to environmental pollution and pest resistance problems.

Method used

dsRNA was loaded onto ZIF-8@polydopamine (ZIF-8@PDA), a polymer nanocarrier based on a zeolite imidazole ester backbone, and targeted the chitin synthase gene (CHS) or the V-ATPase subunit B gene (V-ATPaseB). This combination with Serratia marcescens improved the delivery efficiency and stability of dsRNA, activated the endocytosis and phagocytic pathways of pest cells, and enhanced the pest control effect.

Benefits of technology

It significantly improved the effectiveness of pest control, reduced the cost of using dsRNA in the field, reduced the amount of chemical pesticides used, avoided environmental pollution and pesticide resistance problems, and enhanced the plant's defense capabilities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005257286470000091
    Figure BDA0005257286470000091
  • Figure BDA0005257286470000092
    Figure BDA0005257286470000092
  • Figure BDA0005257286470000111
    Figure BDA0005257286470000111
Patent Text Reader

Abstract

This invention belongs to the field of agricultural technology and discloses a dsRNA biopesticide formulation based on a nanocarrier, its preparation method, and its application. Specifically, it discloses a nanocomposite comprising a nanocarrier and dsRNA, wherein the dsRNA is loaded on the nanocarrier and targets the chitin synthase gene (CHS) or the V-ATPase subunit B gene (V-ATPaseB). This invention provides a nanocomposite containing dsRNA targeting the CHS gene or the V-ATPaseB gene. This nanocomposite, as a novel biopesticide formulation, exhibits good pest control and plant leaf protection effects. The nanocarrier used in this nanocomposite can effectively deliver dsRNA, preventing its degradation within pests and improving delivery efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural technology, specifically relating to a dsRNA biopesticide formulation based on a nanocarrier, its preparation method, and its application. Background Technology

[0002] Currently, pest control primarily relies on chemical pesticides. However, pesticide use has brought a series of problems, including environmental pollution, increased pest resistance, and impacts on non-target organisms. Long-term use of chemical pesticides leads to soil and water pollution, disrupting ecosystem balance and endangering human health. Furthermore, increasing pest resistance to chemical pesticides gradually reduces their effectiveness, necessitating continuously increasing pesticide dosages and creating a vicious cycle. Therefore, there is a need to seek new, green, and efficient pest control strategies.

[0003] RNA biopesticides utilize the principle of RNA interference (RNAi) to silence key genes within pests, inhibiting the expression of important functional genes, causing developmental arrest or death of the pests, thus achieving pest control. As a novel pest control technology, RNAi offers several advantages: firstly, its high specificity and biosafety enable precise control; secondly, it is simple to operate and has a short cycle, saving manpower and time; thirdly, it has strong targeting, minimal impact on non-target organisms, and dsRNA is easily degraded, unlikely to induce resistance, and has high environmental and ecological safety, making it suitable for large-scale field application. dsRNA biopesticides show great promise for application.

[0004] However, the application of RNAi in pest control is limited by the delivery efficiency and stability of double-stranded RNA (dsRNA), severely restricting the commercial use of dsRNA biopesticide formulations. dsRNA is extremely unstable in its natural state; isolated dsRNA completely degrades within 48 hours in soil and water environments, and its stability is highly susceptible to factors such as nucleases, precipitation, ultraviolet radiation, and microbial activity. Although current spray-based dsRNA delivery methods effectively avoid degradation by nucleases in the insect midgut, dsRNA remains unstable in the environment and is easily decomposed. Reliable dsRNA delivery technology and effective target genes are essential for effective RNAi pest control; therefore, it is urgent to develop a reliable dsRNA delivery technology to address the aforementioned problems associated with the use of dsRNA in pest control. Summary of the Invention

[0005] In order to provide a method that can enhance the efficiency of RNA interference in lethal genes of pests, improve the efficiency and stability of dsRNA transmission, and improve the pest control effect, this invention aims to develop a dsRNA biopesticide formulation based on a nanocarrier.

[0006] The first aspect of the present invention is to provide a nanocomposite.

[0007] The second objective of this invention is to provide a method for preparing the nanocomposite of the first aspect of this invention.

[0008] The third aspect of this invention aims to provide the application of the nanocomposite of the first aspect of this invention in the prevention and control of pests or in the preparation of products for the prevention and control of pests.

[0009] The fourth aspect of this invention is to provide a product.

[0010] The fifth aspect of this invention aims to provide a method for preventing and controlling pests / protecting plant leaves.

[0011] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0012] RNAi achieves sustainable pest control by interfering with the expression of key genes in insect growth and development. Based on this, the inventors have creatively demonstrated that the chitin synthase gene (CHS) or the V-ATPase subunit B gene (V-ATPaseB) are potential gene targets. By silencing the CHS and V-ATPaseB genes using RNAi technology, the control effect against fall armyworm can be improved.

[0013] In a first aspect, the present invention provides a nanocomposite comprising a nanocarrier and dsRNA, wherein the dsRNA is loaded on the nanocarrier and the dsRNA targets the chitin synthase gene (CHS) or the V-ATPase subunit B gene (V-ATPaseB).

[0014] In some embodiments of the present invention, the nucleotide sequence of the chitin synthase gene (CHS) is shown in SEQ ID NO:11, and the nucleotide sequence of the V-proton ATPase subunit B gene (V-ATPaseB) is shown in SEQ ID NO:12.

[0015] In some embodiments of the present invention, the nucleotide sequence of the dsRNA is shown in SEQ ID NO:14 or SEQ ID NO:15.

[0016] In some embodiments of the present invention, the nanocarrier comprises a polymer nanocomposite material with a zeolite imidazole ester backbone.

[0017] In some embodiments of the present invention, the nanocarrier is ZIF@polydopamine.

[0018] In some embodiments of the present invention, the nanocarrier is ZIF-8@polydopamine (ZIF-8@PDA).

[0019] This invention develops a reliable vector to overcome the bottleneck of dsRNA delivery in the fall armyworm. By selecting genes encoding CHS and V-ATPaseB as target genes, an easily synthesized ZIF-8@polydopamine (ZIF-8@PDA) was constructed as a low-cost dsRNA nanocarrier. dsRNA loaded on ZIF-8@PDA is protected from degradation by external nucleases, exhibits good biocompatibility and adhesion, enhances stability, and can deliver dsRNA effectively. It significantly increases the uptake and intracellular transport of dsRNA by insect cells, improves the silencing efficiency of target genes, thereby inhibiting pest growth, activating endocytosis and macrophage phagocytosis pathways, and improving delivery efficiency. This results in significant control of lepidopteran pests and greatly reduces the cost of dsRNA use in the field.

[0020] Based on the porous structure and large specific surface area of ​​the ZIF-8@PDA nanocarrier, which has high adsorption properties, it provides abundant binding sites for drug molecules (such as dsRNA / pesticides), which can enhance the stability of dsRNA, activate its endocytosis and phagosome pathway, and improve transport efficiency.

[0021] The nanocarrier ZIF-8@PDA can enhance the slow-release properties of biological pesticide formulations, strengthen adhesion, increase the retention time of nanocarrier compound pesticides on plant leaves, and improve the utilization rate of pesticides and fertilizers.

[0022] A second aspect of the present invention provides a method for preparing the nanocomposite of the first aspect of the present invention, comprising the following steps: mixing ZIF@polydopamine and dsRNA, reacting them to obtain the nanocomposite.

[0023] In some embodiments of the present invention, when ZIF@polydopamine is not a finished product, the preparation method of the nanocomposite includes the following steps: mixing dsRNA with Zn(NO3)2 and 2-methylimidazole, reacting at 700-900 rpm for 15-25 min, separating the solid and liquid, taking the precipitate and mixing it with dopamine, reacting at 700-900 rpm for 4-6 hours to obtain the nanocomposite.

[0024] The nanocomposites prepared using ZIF@polydopamine, whether finished or unfinished, have similar effects.

[0025] A third aspect of the present invention provides the use of the nanocomposite of the first aspect of the present invention in the control of pests or in the preparation of products for the control of pests.

[0026] In some embodiments of the present invention, the nanocomposite achieves the purpose of pest control by inhibiting the development of pests and / or promoting the death of pests.

[0027] In some embodiments of the present invention, the pests include lepidopteran insects.

[0028] In some embodiments of the present invention, the pests include at least one of the following: fall armyworm, beet armyworm, cotton leafworm, armyworm, grain armyworm, cotton bollworm, tobacco hawk moth, diamondback moth, pink armyworm, grape leafroller, wheat moth, and soybean noctuid moth.

[0029] In some embodiments of the present invention, the pest is the fall armyworm.

[0030] In some embodiments of the present invention, the product includes biological pesticide formulations (such as insecticides).

[0031] A fourth aspect of the present invention provides a product comprising the nanocomposite of the first aspect of the present invention.

[0032] In some embodiments of the present invention, the product also includes Serratia marcescens.

[0033] The dsRNA biopesticide formulation based on nanocarriers uses the ZIF-8@PDA nanocarrier as its core, loaded with dsRNA (dsCHS and / or dsV-ATPase B), and then mixed with Serratia marcescens. ZIF-8@PDA can enhance the abundance of Serratia marcescens bacteria in the gut of fall armyworm, inhibit the insect's ROS immunity level, and thus increase the lethality of RNAi. In addition, pest populations infected with Serratia marcescens can enhance the plant's anti-insect immune response against herbivorous insects, induce increased activity of plant insect-resistant defense enzymes (such as polyphenol oxidase PPO), and thus produce phytochemicals that enhance damage to herbivorous pests and weaken the pests' ecological adaptability.

[0034] In some embodiments of the present invention, the product includes biological pesticide formulations (such as insecticides).

[0035] In some embodiments of the present invention, the product can be prepared into conventional dosage forms for use, such as dry powder, wettable powder, emulsifiable concentrate, microemulsion, paste, granules or suspension.

[0036] In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one of the following: solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, flow aids, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesion agents, integrators, penetration enhancers, pH adjusters, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, encapsulating agents, humectants, absorbents, diluents, flocculants and anti-flocculators, filter aids, release inhibitors, and carriers. These excipients can be diluents (e.g., starch, pregelatinized starch, dextrin, sucrose, lactose, mannitol, and microcrystalline cellulose), absorbents (e.g., calcium sulfate, dicalcium phosphate, light magnesium oxide, and calcium carbonate), wetting agents (e.g., water and ethanol), binders (e.g., hydroxypropyl methylcellulose, povidone, starch paste, and syrup), disintegrants (e.g., dry starch, sodium hydroxymethyl starch, low-substituted hydroxypropyl cellulose, effervescent disintegrants, and crospovidone), and lubricants (magnesium stearate, talc, hydrogenated vegetable oil, polyethylene glycol, and micronized powders). The following are examples of agents: silica gel, colorants (such as titanium dioxide, sunset yellow, methylene blue, and pharmaceutical iron oxide), coating materials (such as acrylic resin, hydroxypropyl methylcellulose, and povidone), solvents (such as water for injection, ethanol, propylene glycol, and glycerin), acid-base adjusters (such as hydrochloric acid, lactic acid, sodium hydroxide, tartaric acid, and sodium tartrate), antioxidants (such as sodium sulfite, sodium metabisulfite, and sodium thiosulfate), antibacterial agents (such as phenol, benzyl alcohol, and thimerosal), and isotonic adjusters (such as sodium chloride and glucose).

[0037] Spraying products containing nanocomplexes (biological pesticide formulations) interferes with pest growth and binds to Serratia marcescens (OD). 600 =0.1~0.5) for comprehensive spraying to enhance the plant's defense capabilities, enable Serratia marcescens to infect pests, and increase the mortality rate of biological pesticides against pests.

[0038] A fifth aspect of the present invention provides a method for controlling pests or protecting plant leaves, comprising the step of applying a nanocomposite of the first aspect of the present invention or a product of the fourth aspect of the present invention to pests or pest habitats.

[0039] In some embodiments of the present invention, the method includes treating pests, their food (such as corn or rice leaves), and their habitat (soil, area, material or environment where the pest is growing or can grow, or materials, cultivated plants, plant propagation materials (such as seeds), soil, surface or space) with the nanocomposite or product.

[0040] In some embodiments of the present invention, an effective dose of the nanocomposite of the first aspect of the present invention or the product of the fourth aspect of the present invention is applied to pests or pest habitats.

[0041] In some embodiments of the present invention, generally speaking, "effective amount" refers to the amount of active ingredient required to achieve observable effects on growth, including effects of necrosis, death, inhibition, prevention and removal, destruction or reduction of the presence and activity of target organisms. The effective amount can vary for the nanocomposite or product used in the present invention. The effective amount of the nanocomposite or product also varies depending on key conditions such as desired insecticidal effect and duration, climate, target type, location, application method, etc.

[0042] In some embodiments of the present invention, approximately 50 g of the nanocomposite is used per hectare, diluted at a ratio of 1:100 to 1:500. When applied in combination with Serratia marcescens, it is recommended to use 1 to 2 liters of bacterial suspension per hectare, at a concentration of 1 to 9 × 10⁻⁶. 8 CFU / mL, to better control pests.

[0043] In some embodiments of the present invention, the pests include lepidopteran insects.

[0044] In some embodiments of the present invention, the pests include at least one of the following: fall armyworm, beet armyworm, cotton leafworm, armyworm, grain armyworm, cotton bollworm, tobacco hawk moth, diamondback moth, pink armyworm, grape leafroller, wheat moth, and soybean noctuid moth.

[0045] In some embodiments of the present invention, the pest is the fall armyworm.

[0046] In some embodiments of the present invention, the plant includes at least one of corn, rice, wheat, sugarcane, sorghum, peanut, soybean, Arabidopsis thaliana, Chinese cabbage, kale, cabbage, and water bamboo.

[0047] The beneficial effects of this invention are:

[0048] This invention provides a nanocomposite containing dsRNA targeting the chitin synthase gene (CHS) or the V-ATPase subunit B gene (V-ATPaseB). This nanocomposite, as a novel biopesticide formulation, exhibits excellent pest control and plant leaf protection effects. The nanocarrier used in this nanocomposite effectively delivers the dsRNA, preventing its degradation within pests and improving delivery efficiency.

[0049] This invention demonstrates that the CHS and V-ATPaseB genes can serve as potential gene targets by feeding corn leaves containing nanocomplexes to fall armyworm. Silencing the CHS and V-ATPaseB genes through nanomaterial-mediated RNAi technology can significantly improve the control effect against fall armyworm.

[0050] Based on the nanocomposite, this invention creatively combines Serratia marcescens, the gut microbiome of pests, and the nanocarrier in the nanocomposite can increase the abundance of Serratia marcescens in the pest gut, inhibit the pest's immune level, improve the lethality of RNAi, increase the plant's defense response to herbivorous insects, and thus improve the effect of pest control.

[0051] The main component of the product provided by this invention is a nanocomposite containing dsRNA molecules, which is safe and harmless to humans or animals. It can effectively reduce the amount of chemical pesticides used, and there are no problems with pesticide resistance or environmental pollution, which is beneficial to environmental protection. Attached Figure Description

[0052] Figure 1 This is a SEM image of the dsGFP@ZIF-8@PDA nanocomposite.

[0053] Figure 2 This is a TEM image of the dsGFP@ZIF-8@PDA nanocomposite.

[0054] Figure 3 The average radius of the dsGFP@ZIF-8@PDA nanocomposite is shown.

[0055] Figure 4 In Example 2, the maximum loading of dsRNA in ZIF-8 or ZIF-8@PDA was determined by 1% agarose gel electrophoresis. In the figure, the red text SusdsRNA-ZIF-8 represents the suspension after synthesis and centrifugation; the red text dsRNA-ZIF-8 represents the products with different synthesis ratios.

[0056] Figure 5 The graph shows the variation of the Zeta potential of the dsGFP@ZIF-8@PDA nanocomposite.

[0057] Figure 6 The fluorescence intensity distribution of the gut and fat body tissue of the fall armyworm was measured after applying dsGFP / Cy3 and dsGFP / Cy3@ZIF-8@PDA to maize leaves.

[0058] Figure 7 Survival rate of fall armyworm larvae treated with different dsRNAs and materials within 4 days.

[0059] Figure 8 The images show the body size and intestinal phenotype of fall armyworm larvae treated with dsCHS@ZIP-8@PDA.

[0060] Figure 9 The survival rate of fall armyworm larvae treated with Serratia marcescens and Enterococcus faecalis combined with dsCHS@ZIF-8@PDA nanocomposite within 4 days.

[0061] Figure 10 To detect Serratia marcescens and Enterococcus dysenteriae (OD100) at 48 and 72 hours respectively. 600 =0.1)+dsCHS@ZIF-8@PDA aseptic ROS staining of intestinal tissue.

[0062] Figure 11 The bacteria were inoculated with sterile PBS, Serratia marcescens, and Enterococcus odextrin (OD100) respectively. 600 Phenotypic diagram of fall armyworm with a value of 0.1. Detailed Implementation

[0063] The present invention will be further described in detail below through specific embodiments.

[0064] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0065] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0066] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0067] Example 1: Preparation of dsCHS and dsV-ATPaseB from fall armyworm

[0068] In this embodiment, CHS refers to the chitin synthase gene of *Pteris vittata*. Chitin synthase is a key enzyme controlling the formation of chitin in the peritrophic membrane of the insect's epidermis and midgut, and is an essential enzyme for insect molting, immune, and digestive system functions. The nucleotide sequence of the CHS gene is shown in SEQ ID NO:11. V-ATPaseB refers to the V-ATPase subunit B gene of *Pteris vittata*. V-ATPaseB is a multi-subunit enzyme that hydrolyzes adenosine triphosphate (ATP) to transport protons across the cell membrane and has been shown to play an important role in many biological processes. The nucleotide sequence of the V-ATPaseB gene is shown in SEQ ID NO:12. dsRNA synthesized from the GFP gene sequence was used as a blank control. The nucleotide sequence of the GFP gene is shown in SEQ ID NO:13.

[0069]

[0070]

[0071] (SEQ IDNO:13).

[0072] 1. Fall armyworm tested

[0073] The fall armyworm used in this embodiment is a laboratory-raised population. The larvae are fed on corn leaves for a long time under conditions of 28±3℃, light intensity of 14L:10D, and relative humidity of 60% to 65%, and are raised on fresh corn leaves.

[0074] 2. dsRNA synthesis

[0075] Total RNA was extracted from 10 fourth-instar fall armyworms and reverse transcribed into cDNA. Using the cDNA as a template, PCR amplification was performed using a 2×Taq PCR Mix kit to obtain a 476 bp dsCHS fragment and a 446 bp dsV-ATPaseB fragment. Primers used for dsRNA synthesis and qPCR are detailed in Tables 1 and 2. The PCR reaction system consisted of 1 μL template DNA, 1 μL each of 10 μM dsF / dsR primers, 25 μL of 2×Taq Master Mix (Dye Plus) with ddH2O added to a final volume of 50 μL. The PCR product was purified using magnetic beads to remove impurities. dsRNA synthesis was then performed using a HighYield T7 RNA transcription kit. The reaction system consisted of 1 μg of purified PCR product, 1 μL of T7 RNA polymerase / RNase inhibitor, 2.5 μL of 10× transcription buffer, 4.0 μL of NTP Mix, and ddH2O added to a final volume of 25 μL. After mixing the reaction solutions, the mixture was incubated at 37°C for 2–8 hours, followed by treatment with 2 μL of DNase I for 15 min to remove residual template DNA. dsGFP of the green fluorescent protein (GFP) gene was used as a negative control. The synthesized dsRNA product was purified using magnetic beads, freeze-dried, and stored at -20°C.

[0076] The nucleotide sequence of dsCHS is shown in SEQ ID NO:14, the nucleotide sequence of dsV-ATPaseB is shown in SEQ ID NO:15, and the nucleotide sequence of dsGFP is shown in SEQ ID NO:16.

[0077] TAAGACTGAGGACCTCGCAGAAATTGAAAAAGAAAAAGGCGATGAATACTATGAAACTATATCGGTTCACACGGATAACACTGGTTCTTCTCCGAAAGCTATTAAGTCATCAGATCAGATCACCAGGATATACGCATGCGCTACTATGTGGCACGAAACTAAAGACGAGATGATGGAGTTCTTGAAGTCTATTCTTCGGTTGGATGAGGATCAGTGCGCTCGGCGTGTGGCTCAAAAGTATTTACGAGTCGTTGACCCTGATTACTATGAATTCGAAACACATATTTTCTTAGACGACGCCTTCGAAATATCAGATCATAGTGACGATGATGCTCAAGTGAATCGTTTCGTGAAACTGCTTGTGGACACTATCGATGAAGCAGCTTCCGAAGTACATCAGACGAACATTCGCATTCGACCGCCCAAGAAGTATCCGGCGCCTTACGGAGGACGTTTGACTTGGGTACTGCCAGGAA(SEQ ID NO:14)。

[0078] TGCAGCTCAGACTCGCTGATGGCACTCTCCGCTCCGGTCAGGTGCTCGAGGTCAGCGGCACCAAGGCCGTGGTCCAGGTGTTCGAAGGTACATCAGGTATCGACGCCAAGAACACTCTCTGTGAGTTTACCGGCGACATCCTGCGTACTCCCGTGTCTGAAGATATGTTGGGTCGTGTATTCAACGGCTCCGGCAAGCCCATTGACAAGGGTCCCCCAATCCTCGCCGAGGACTTCTTGGACATCCAGGGACAACCCATCAACCCATGGTCCCGTATCTACCCCGAGGAGATGATCCAGACTGGTATCTCCGCTATTGACGTGATGAACTCCATCGCTCGTGGTCAGAAGATCCCCATCTTCTCCGCTGCTGGTCTGCCTCACAACGAAATTGCCGCCCAGATCTGTAGACAGGCCGGTCTTGTCAAGATCCCCGGCAAATCAGTG(SEQ ID NO:15)。

[0079] GCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAAC TACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTG(SEQID NO:16).

[0080] Table 1 Primer information for dsRNA synthesis

[0081]

[0082] Table 2 Primer information for real-time fluorescence quantitative PCR

[0083]

[0084] Example 2: Preparation of dsRNA@ZIF-8@PDA nanocomposite

[0085] 526.9 μL of a concentration of 10 mg / mL After the dsRNA solution was mixed with 50 μL of 0.84 M Zn(NO3)2·6H2O solution, 484.1 μL of 3.04 M 2-methylimidazole solution was added, and the mixture was rapidly shaken at 800 rpm for 20 min. The mixture was then centrifuged at 12000 rpm for 30 min at 4 °C. The precipitate was rinsed three times with DEPC water, and then 2.2 mL of 2.8 mg / mL dopamine (DA) solution was added. The reaction was terminated after stirring continuously at 800 rpm for 5 hours. The product was centrifuged at 5000 rpm for 10 min at 4 °C, rinsed three times with DEPC water, lyophilized, and stored at -20 °C to prepare dsRNA@ZIF-8@PDA nanocomposites, namely dsGFP@ZIF-8@PDA, dsCHS@ZIF-8@PDA, and dsV-ATPaseB@ZIF-8@PDA nanocomposites.

[0086] Taking the dsGFP@ZIF-8@PDA nanocomposite as an example, the composite was characterized and analyzed. Scanning electron microscopy (SEM) images of the dsGFP@ZIF-8@PDA nanocomposite are shown below. Figure 1 As shown, the transmission electron microscope (TEM) image is as follows: Figure 2 As shown, the characterization images of dsGFP@ZIF-8@PDA reveal that the dsRNA@ZIF-8@PDA nanocomposite possesses a polyhedral spherical structure. Figure 3 As shown, statistical analysis using a Gaussian probability distribution model revealed that the average diameter of the dsRNA@ZIF-8@PDA nanocomposite is 109.08 ± 0.8 nm.

[0087] To investigate the binding mechanism of dsRNA loaded into ZIF-8, intermolecular forces were measured using a microcalorimetric isothermal titration calorimeter (ITC). ZnI at a concentration of 0.84 mM was used to measure these forces. 2+ 10 mM 2-mIm solution and 0.5 mM dsGFP were added dropwise to 5 mM ZIF-8. The interaction heat of each titration peak was calculated using Origin software by integrating the results. The test temperature was set to 25 °C, and ΔG was calculated using the following formula: ΔG = ΔH - TΔS.

[0088] The potential changes of ZIF-8, dsGFP@ZIF-8 and dsGFP@ZIF-8@PDA are as follows: Figure 5As shown, electrostatic interactions were found between ZIF-8, dsGFP, and PDA. Positive values ​​of the thermodynamic parameters ΔH and TΔS indicate that the self-assembly process of ZIF-8 is endothermic, primarily driven by electrostatic interactions and entropy changes. The low dissociation constant (Kd) and negative ΔG value further confirm the strong, spontaneous interaction between dsGFP and ZIF-8.

[0089] To investigate the maximum dsRNA loading rate in dsRNA@ZIF-8@PDA, the dsRNA loading rates in dsRNA@ZIF-8 and dsRNA@ZIF-8@PDA were calculated. Specifically: First, 50 mg of dsGFP@ZIF-8 was dissolved in 50 mL of hydrochloric acid solution (DEPC water, pH = 1), and the dsRNA concentration was determined by measuring 1 μL of the supernatant. The concentration is represented by c. Then, 50 mg of dsGFP@ZIF-8 was dispersed in 10 mL of DEPC water and 10 mL of DA solution (containing 0.1% Tris hydrochloric acid), mixed and stirred for 5 hours. After centrifugation at 13000 rpm for 20 min at 4℃, the supernatant was discarded, and the mixture was lyophilized and weighed. The mass of dsGFP@ZIF-8@PDA is represented by m. The loading rates of dsRNA@ZIF-8 (LR1) and dsRNA@ZIF-8@PDA (LR2) were calculated as follows:

[0090] The results show Figure 4 The loading rate of dsRNA@ZIF-8@PDA reached 10.25%, and the loading rate of dsRNA@ZIF-8 was approximately 8.3%.

[0091] Example 3: Determination of the stability and delivery efficiency of the dsGFP@ZIF-8@PDA complex in Fall Armyworm.

[0092] This embodiment utilizes nanofluorescence to detect the stability and dsRNA delivery efficiency of the dsGFP@ZIF-8@PDA complex in the fall armyworm. Details are as follows:

[0093] 1. Stability

[0094] Hemolymph and intestinal fluid were collected separately from fourth-instar fall armyworms and placed in 1.5 mL centrifuge tubes. 500 μL of pre-chilled PBS buffer was added, and the tubes were centrifuged at 3000 rpm for 3 min at 4 °C. The supernatant was transferred to a new centrifuge tube to remove tissue contaminants. In the degradation experiment, hemolymph and intestinal fluid were mixed with 1 μg dsGFP, respectively. Simultaneously, dsGFP@ZIF-8 and dsGFP@ZIF-8@PDA containing 1 μg dsGFP were treated with hemolymph and intestinal fluid under the same conditions. The mixtures were incubated at 37 ± 1 °C for 1 h, and then 10 μL of each mixture was analyzed by 1% agarose gel electrophoresis.

[0095] The results show that, compared to uncoated dsRNA, the ZIF-8@PDA nanocarrier effectively protects dsRNA from enzymatic degradation. This indicates that the ZIF-8@PDA nanocarrier significantly improves the environmental stability of dsRNA.

[0096] 2. dsRNA delivery efficiency

[0097] To test the dsRNA delivery efficiency, dsGFP / Cy3@ZIF-8@PDA nanocomplexes were synthesized according to the method in Example 2. The dsRNA was labeled with 0.1 μg / mL Cy3. 526.9 μL of 15 mg / mL Cy3-labeled dsGFP was added to a total synthesis system of 1.1 mL. The product was centrifuged at 5000 rpm for 10 min at 4 °C, then gently washed three times with DEPC water, and freeze-dried to obtain dsGFP / Cy3@ZIF-8@PDA. 1 mg of dsGFP / Cy3@ZIF-8@PDA powder was uniformly dispersed in 50 mL of DEPC water. 2 mL of the dsGFP / Cy3@ZIF-8@PDA solution was uniformly coated onto a 60 cm² plate. 2 On rectangular corn leaves, after drying, cut into 2cm pieces 2 Square leaves were used. Simultaneously, each square leaf was coated with naked dsGFP / Cy3 as a control. Fourth-instar fall armyworm larvae were fed with the treated maize leaves. Twenty-four hours after feeding, the intestinal tissue was dissected, fixed with 4% formaldehyde and DAPI solution for 15 min, and then washed three times with phosphate buffer (pH 7.4) for 5 min each time. The intestinal tissue was observed under a laser scanning confocal microscope.

[0098] To assess the uptake efficiency of dsRNA by the fall armyworm, naked dsGFP labeled with Cy3 was used as a control. The fluorescence intensity of dsGFP / Cy3 loaded with @ZIF-8@PDA was significantly higher than that of dsGFP / Cy3 in the intestinal tissue and hemolymph of the fall armyworm. The fluorescence intensity of dsGFP loaded with ZIF-8@PDA nanocarrier was increased by 12.33 times. Figure 6 The results indicate that the dsGFP / Cy3@ZIF-8@PDA nanocomposite has a high efficiency in delivering dsRNA. This result confirms that the ZIF-8@PDA nanocarrier promotes dsGFP uptake and effectively overcomes the bottleneck problem of low dsRNA delivery efficiency.

[0099] Example 4: Application and efficacy evaluation of the dsRNA@ZIF-8@PDA complex against the fall armyworm.

[0100] Five mg of dsV-ATPaseB@ZIF-8@PDA and dsCHS@ZIF-8@PDA (prepared in Example 2) were weighed and completely dispersed in 100 mL of DEPC-treated water to obtain the treatment solution. Similarly, 0.4 mg of lyophilized dsV-ATPaseB and dsCHS powder were weighed and completely dispersed in 100 mL of DEPC-treated water. Two mL of the treatment solution was applied to corn leaves, which were then cut into 1 cm² squares and dried twice. Leaves treated with DEPC-treated water were used as a control. To prevent fall armyworms from attacking each other, each larva was placed individually in a small plastic cell, with 36 larvae treated at a time. The leaves were placed in the center of each cell and replaced with fresh leaves every 12 hours. Mortality, body length, and weight were recorded for five consecutive days.

[0101] The survival rate (%) is calculated at specific time intervals.

[0102]

[0103] Where N_total represents the total number of fall armyworm larvae and N_t represents the number of larvae that died at time t.

[0104] By comparing the survival rate of fall armyworm larvae under different treatments within 4 days, the experimental results are as follows: Figure 7 As shown, feeding dsCHS@ZIF-8@PDA and dsV-ATPaseB@ZIF-8@PDA significantly reduced the survival rate of fall armyworm, with a survival rate of only 31% to 38%. In contrast, the absorption of naked dsRNA was limited and unstable, with no obvious insecticidal effect, and the survival rate of fall armyworm reached 91%.

[0105] ZIF-8@PDA loaded with dsCHS or dsV-ATPaseB increased insect mortality and RNAi efficiency. dsCHS and dsV-ATPaseB containing ZIF-8@PDA significantly reduced the survival rate of fall armyworm, while naked dsRNA had no obvious insecticidal effect due to its instability and limited uptake by fall armyworm. In particular, larvae fed with dsCHS@ZIF-8@PDA exhibited membrane lysis of the midgut perifeeding membrane, as shown in... Figure 8 As shown, RNAi of dsCHS and dsV-ATPaseB mediated by ZIF-8@PDA nanomaterials was significantly enhanced compared to naked dsCHS and dsV-ATPaseB.

[0106] Example 5 Serratia marcescens (OD) 600 =0.1)+dsCHS@ZIF-8@PDA nanobiochemical agents on fall armyworm

[0107] Preparation of nano-biological agents: Serratia marcescens (SM) and Enterococcus mundtii (EM) solutions were adjusted to OD values ​​using phosphate buffer (pH = 7.4). 600 =0.1, and 1 mg of dsCHS@ZIF-8@PDA lyophilized powder was added to 50 mL of bacterial solution to prepare a nano-biological agent.

[0108] Leaf treatment and feeding: The above-mentioned nano-biological agent solution was evenly applied to sterile, naturally dried corn leaves, serving as the experimental group. Simultaneously, corn leaves coated with sterile PBS buffer served as the control group. Aseptically cultured third-instar fall armyworm larvae were placed on the leaves of both the experimental and control groups for feeding. After four consecutive days of feeding, the number of dead fall armyworms in each treatment group was recorded. Each group was treated with 30 larvae of uniform growth, and the experiment was repeated three times. The survival rate (%) was calculated at specific time intervals.

[0109] The results are as follows Figure 9 As shown, dsCHS@ZIF-8@PDA + Serratia marcescens (OD) 600 =0.1) The survival rate of sterile fall armyworm larvae feeding on leaves was significantly lower than that of dsCHS@ZIF-8@PDA + Enterococcus or PBS buffer. After four days of treatment with dsCHS@ZIF-8@PDA + Serratia marcescens, the survival rate of fall armyworms dropped to below 30%. The application of Serratia marcescens caused an initial increase followed by a decrease in the insect's intestinal ROS immunity level, which enhanced the synergistic insecticidal effect of dsRNA@ZIF-8@PDA and increased the mortality rate of the pest.

[0110] Serratia marcescens activates the immune response of the fall armyworm. For example... Figure 10 As shown, ROS content changed significantly, initially increasing significantly at 48 hours and then decreasing at 72 hours. dsCHS@ZIF-8@PDA-enriched *Serratia marcescens* in the gut of *Fall Armyworm* inhibited the ROS immune response and exhibited a significant synergistic insecticidal effect.

[0111] Example 6 Plant resistance to herbivorous response

[0112] Third-instar fall armyworm larvae from different populations, including sterile, *Serratia marcescens*-infected, and *Enterococcus*-infected populations, were inoculated onto healthy maize plants sprayed with 10 mg / L dsCHS@ZIF-8@PDA nanocomposite. Ten third-instar larvae were placed on each maize plant, with four plants used for each treatment, replicated three times. Mortality was recorded over four consecutive days. The levels of glucose oxidase (GOX) in the oral secretions of different fall armyworm populations were measured. Additionally, the levels of plant hormones jasmonic acid (JA), jasmonic acid isoleucine (JA-Ile), and salicylic acid (SA), as well as the activity of polyphenol oxidase (PPO), were measured.

[0113] The results are as follows Figure 11 As shown, the phenotypes of fall armyworms inoculated with sterile, Serratia marcescens, and Enterococcus species are different. Fall armyworms inoculated with sterile or Enterococcus species develop normally, while fall armyworms infected with Serratia marcescens show a red body.

[0114] Experimental studies have found that fall armyworms infected with *Serratia marcescens* enhance plant insect resistance by increasing glucose oxidase (GOX) activity and activating the jasmonic acid signaling pathway. Further inoculation experiments confirmed that fall armyworms inoculated with *Serratia marcescens* and consuming maize plants sprayed with dsCHS@ZIF-8@PDA had a lower survival rate than those inoculated with *Enterococcus* or sterile populations, indicating that the combination of *Serratia marcescens* and dsCHS@ZIF-8@PDA has great potential for pest control.

[0115] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A nanocomposite comprising a nanocarrier and dsRNA, wherein the dsRNA is loaded on the nanocarrier via charge adsorption and hydrogen bonding, and the dsRNA targets a chitin synthase gene. The nucleotide sequence of the dsRNA is shown in SEQ ID NO:14; The nanocarrier is ZIF-8@polydopamine.

2. The method for preparing the nanocomposite according to claim 1, comprising the following steps: The nanocomposite was obtained by mixing ZIF-8@polydopamine and dsRNA and reacting them.

3. The application of the nanocomposite according to claim 1 in the prevention and control of pests or in the preparation of products for the prevention and control of pests.

4. The application according to claim 3, characterized in that, The nanocomposite achieves the purpose of pest control by inhibiting the development of pests and / or promoting the death of pests.

5. A product comprising the nanocomposite of claim 1.

6. The product according to claim 5, characterized in that, The product also includes Serratia marcescens.

7. A method for controlling pests or protecting plant leaves, comprising the step of applying the nanocomposite of claim 1 or the product of claim 5 or 6 to the pest or the pest habitat.

Citation Information

Patent Citations

  • Serratia marcescens SfSm-1 with broad-spectrum toxicity and application thereof

    CN114181870A

  • Method for preventing and controlling spodoptera frugiperda based on RNAi

    CN115927301A