Small nucleic acid targeting androgen receptor as well as pharmaceutical composition and application thereof

Abstract

The invention discloses a small nucleic acid targeting androgen receptor AR, provides various modification methods, enhances sequence stability after modification, effectively knocks down AR mRNA, has a remarkable curative effect, and can be used together with various delivery prescriptions. The small nucleic acid provided by the invention can be efficiently delivered to a target spot through lipid nanoparticles, and also can be effectively delivered to cells without other delivery carriers by coupling an alkyl chain structure in a sequence. The small nucleic acid and the preparation method thereof provided by the invention can be used as a technical means for treating diseases caused by abnormal androgen expression or treating diseases related to androgen receptors, and the indications of the small nucleic acid include but are not limited to androgenetic alopecia, alopecia areata, neuropathic alopecia, scar alopecia, diffuse alopecia, acne and the like.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a small nucleic acid targeting an androgen receptor and a pharmaceutical composition and use thereof. Background Art

[0002] Androgenetic alopecia (AGA) is a hair loss disease that begins in adolescence or late adolescence and is characterized by progressive miniaturization of hair follicles. AGA is a multi-gene recessive genetic disease with a genetic predisposition.

[0003] Current studies have shown that androgens are a decisive factor in the onset of AGA; other factors, including inflammation around the hair follicles, increased stress in life, tension and anxiety, and bad living and eating habits, may aggravate the symptoms of AGA. Although androgens are a key factor in the onset of AGA, the level of androgens circulating in the blood of almost all AGA patients is maintained at a normal level. Studies have shown that due to the increased expression of the androgen receptor gene (AR) or the type II 5α reductase gene in the hair follicles in the hair loss area, the effect of androgens on susceptible hair follicles is increased. For AGA, the dermal cells in the susceptible hair follicles contain specific type II 5α reductase, which can catalyze the conversion of androgen testosterone circulating in the blood to this area into dihydrotestosterone (DHT), which causes a series of reactions by binding to the androgen receptors in the cells, thereby causing progressive miniaturization and hair loss of the hair follicles until baldness.

[0004] The main treatment methods for AGA include systemic medication and topical treatment. Among them, the most common drugs in systemic medication are finasteride and spironolactone, and the most common drugs in topical treatment are minoxidil topical preparations. These drugs need to be taken daily, and patient compliance still needs to be improved.

[0005] Androgen receptor (AR) is a hot target for drug research in the field of hair loss, and there have been many research reports on RNA therapies targeting AR. The results of these studies still have some shortcomings. For example, patent CN118726351A discloses a functional small interfering RNA and its products. The patent only reflects the in vitro experimental results of small interfering RNA and lacks in vivo experimental data support. Patent CN118421625A discloses an antisense oligonucleotide and an androgen receptor inhibitor and its use. The article only discloses the results of in vitro experiments and does not reflect the results of in vivo experiments. It can be seen that there is still a need to develop effective RNA therapies targeting AR. Summary of the invention

[0006] In view of the defects of the prior art, the present invention provides an AR-targeting siRNA and a corresponding siRNA containing modifications, which can effectively reduce the expression level of AR mRNA, thereby being used to treat diseases caused by abnormal androgen expression or diseases related to androgen receptors.

[0007] In one aspect, the present invention provides a small nucleic acid targeting an androgen receptor, wherein the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 1, and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 2; the small nucleic acid targeting an androgen receptor comprises one or more modifications; the sequence of the sense strand is t*t*AmUmUm(C16-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am (SEQ ID NO: 13), and the sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um (SEQ ID NO: 14),

[0008] Among them, u or U represents uracil nucleotide, g or G represents guanine nucleotide, c or C represents cytosine nucleotide, a or A represents adenine nucleotide, t represents thymine deoxynucleotide, φ represents pseudouridylic acid, m represents 2'-O-methyl modification, Cm-CH3 represents cytosine nucleotide containing 2'-O-methyl modification and 5-methyl modification, φm represents pseudouridylic acid containing 2'-O-methyl modification and N1 methyl modification, m represents 2'-O-methoxyethyl modification, f represents 2'-fluorine modification, L represents locked nucleic acid modification, GNA represents glycol nucleic acid modification, VP represents 5'-phosphorylation modification of ribose, * represents thio modification of a non-bridging oxygen atom of the phosphate group at the α-position of the nucleotide, and C16- represents 2'-O-n-hexadecyl modification.

[0009] In another aspect, the present invention provides a method for preparing a small nucleic acid targeting an androgen receptor as described in any embodiment herein.

[0010] Preferably, the method for preparing the small nucleic acid targeting androgen receptor is the phosphoramidite triester method.

[0011] In another aspect, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a small nucleic acid targeting an androgen receptor as described in any embodiment herein, and a pharmaceutically acceptable carrier, solvent or excipient.

[0012] In one or more embodiments, the carrier is a lipid nanoparticle or an exosome.

[0013] Preferably, the carrier is a lipid nanoparticle.

[0014] In one or more embodiments, the lipid nanoparticles are composed of an aqueous phase and an organic phase, and the volume ratio of the aqueous phase to the organic phase is 10:1 to 1:10.

[0015] Preferably, the volume ratio of the aqueous phase to the organic phase is 3:1 to 1:1. More preferably, the volume ratio of the aqueous phase to the organic phase is 3:1, 2:1 or 1:1. Further preferably, the volume ratio of the aqueous phase to the organic phase is 3:1.

[0016] In one or more embodiments, the organic phase is composed of cationic lipids, auxiliary lipids, steroids, and PEG-lipids, wherein the molar ratio of cationic lipids, auxiliary lipids, steroids and PEG-lipids is 40-60:3-20:25-55:0.1-10; the cationic lipids are selected from dilinoleyl methyl dimethylaminobutyrate (Dlin-M-C3-DMA), 9A1P9, trimethyl-2,3-dioleyloxypropylammonium chloride (DOTAP), trimethyl-2,3-dioleyloxypropylammonium bromide (DTOPA), dimethyl-2,3-dioleyloxypropyl-2-(2-sperminecarboxamido)ethylammonium trifluoroacetate (DOSPA), dioleylpropyl trimethylammonium chloride (DOTMA), C12-200, ATX-100, 98N 12-5, FTT5, heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), ((4-hydroxybutyl)azadialkyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (Lipid-319), bis(2-butyloctyl)10-(1-(3-(dimethylamino)propyl)-3-octylurea)nonadecanoate (OT13), Dlin-KC2-DMA, Lipid 29, 8-((2-hydroxyethyl)(8-(nonyloxy)8-oxooctyl)amino)octanoic acid heptadecan-9-yl ester) (Lipid5), Lipid A6, YSK12-C4 and CL4H6; the auxiliary lipid is selected from one or more of 1,2-distearoyl-sn-glycero-3-phosphatidylcholine (1,2-DSPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), dioleoylphosphatidylethanolamine (DOPE); the steroid lipid is selected from plant sterols or cholesterol; the PEG-lipid is selected from one or more of 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG2000), (DPG-PEG 2000), polyethylene glycol-distearoylphosphatidylethanolamine (PEG2000-DSPE), distearoyl-rac-glycero-polyethylene glycol 2000 (DSG-PEG 2000) and methoxypolyethylene glycol ditetradecyl acetamide (ALC-0159).

[0017] Preferably, the molar ratio of cationic lipid, helper lipid, steroid and PEG-lipid is 40-55:9-12:35-41:1-2.

[0018] Preferably, the aqueous phase is an acetic acid-sodium acetate buffer or a citric acid-sodium citrate buffer. More preferably, the aqueous phase is an acetic acid-sodium acetate buffer with a pH of 3.0 to 5.0. More preferably, the aqueous phase is a citric acid-sodium citrate buffer with a pH of 3.0 to 5.0. Further preferably, the aqueous phase is an acetic acid-sodium acetate buffer with a pH of 4.0 to 5.0. Further preferably, the aqueous phase is a citric acid-sodium citrate buffer with a pH of 4.0 to 5.0. Further preferably, the aqueous phase is an acetic acid-sodium acetate buffer with a pH of 4.5. Further preferably, the aqueous phase is a citric acid-sodium citrate buffer with a pH of 4.5.

[0019] In another aspect, the present invention provides a method for preparing a pharmaceutical composition as described in any embodiment herein, the method comprising adding a small nucleic acid targeting an androgen receptor as described in any embodiment herein, and a pharmaceutically acceptable carrier, solvent or excipient to a solvent.

[0020] Preferably, the method is ethanol injection.

[0021] In another aspect, the present invention provides use of a small nucleic acid or a pharmaceutical composition targeting an androgen receptor as described in any embodiment herein in the preparation of a drug for treating a disease associated with abnormal androgen expression.

[0022] Preferably, the disease associated with abnormal androgen expression is selected from androgenetic alopecia, alopecia areata, neurotic alopecia, scarring alopecia, diffuse alopecia or acne. More preferably, the disease associated with abnormal androgen expression is androgenetic alopecia.

[0023] In another aspect, the present invention provides a small nucleic acid targeting androgen receptor, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 1, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 2;

[0024] The small nucleic acid targeting the androgen receptor comprises one or more modifications; the small nucleic acid targeting the androgen receptor comprises one or more modifications; each modification is independently located at any nucleotide of the sense chain or the antisense chain; each modification is independently selected from thymidine deoxynucleotide substitution, pseudouridylic acid substitution, 2'-O-methyl modification, 2'-O-methyl modification and 5-methyl modification, 2'-O-methyl modification and N1 methyl modified pseudouridylic acid substitution, 2'-O-methoxyethyl modification, 2'-fluorine modification, locked nucleic acid modification, ethylene glycol nucleic acid modification, 5'-phosphorylation modification, 2'-O-Cn alkyl modification, thio modification, GalNAc modification, spherical nucleic acid modification, cholesterol modification, polyethylene glycol modification, cyclodextrin modification, cell penetrating peptide modification, antibody coupling, nucleic acid aptamer coupling and polypeptide coupling.

[0025] In one or more embodiments, the sequence of the sense strand is t*t*AmUmUmCfAmGfUfGfGmAmUmGmGmCmUm*Gm*Am, and the sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um; the small nucleic acid targeting the androgen receptor further comprises a 2'-O-Cn alkyl modification, wherein n=16 to 22 in the Cn alkyl;

[0026] Among them, u or U represents uracil nucleotide, g or G represents guanine nucleotide, c or C represents cytosine nucleotide, a or A represents adenine nucleotide, t represents thymine deoxynucleotide, φ represents pseudouridylic acid, m represents 2'-O-methyl modification, Cm-CH3 represents cytosine nucleotide containing 2'-O-methyl modification and 5-methyl modification, φm represents pseudouridylic acid containing 2'-O-methyl modification and N1 methyl modification, m represents 2'-O-methoxyethyl modification, f represents 2'-fluorine modification, L represents locked nucleic acid modification, GNA represents glycol nucleic acid modification, VP represents 5'-phosphorylation modification of ribose, Cn- represents 2'-O-Cn alkyl modification, and * represents thiolation modification of a non-bridging oxygen atom of the phosphate group at the α-position of the nucleotide.

[0027] Preferably, the Cn alkyl group is a C16-C22 saturated alkyl group or an unsaturated alkyl group. More preferably, the Cn alkyl group is a C16-C22 saturated alkyl group. Further preferably, the Cn alkyl group is a C16-C22 saturated normal alkyl group.

[0028] In one or more embodiments, the nucleotide sequence of the sense strand of the small nucleic acid targeting androgen receptor is t*t*AmUmUm(Cn-c) CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um; the nucleotide sequence of the sense strand is tta*u*u*c*c*a*gu*gga*u*gggc*u*ga, and the nucleotide sequence of the antisense strand is uuucagcccauccacuggaau; the nucleotide sequence of the sense strand is t*t*AmφφccAmgφggAmφgggcuga, and the nucleotide sequence of the antisense strand is (VPu)*uucagccca(φm-CH3)(Cm-CH3)(Cm-CH3)a(Cm-CH3) (φm-CH3)gga*a*(φm-CH3); the nucleotide sequence of the sense chain is tt(Cn-a)uuCLCLaguggaugggCLu*g*a, and the nucleotide sequence of the antisense chain is (VPu)uu(GNA-G)cc(GNA-C)au(GNA-C)ca(GNA-C)ug(GNA-G)aa(Cn-u); the nucleotide sequence of the sense chain is tt*a*u*u*(Cn-c)*c*a*gu*gga*u*gggcuga; the nucleotide sequence of the antisense chain is uuucagcccaucc acuggaau; the nucleotide sequence of the sense chain is t*t*auuccaguggaugggcu*g*a, and the nucleotide sequence of the antisense chain is u*Uf*UmCmAmGmCmCfcauccacugga*a*u; or, the nucleotide sequence of the sense chain is t*t*AmUmUmCmCfAmGfUfGfGmAmUmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense chain is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um.

[0029] Preferably, the Cn alkyl group is a saturated alkyl group or an unsaturated alkyl group. More preferably, the Cn alkyl group is a saturated alkyl group. Further preferably, the Cn alkyl group is a saturated normal alkyl group.

[0030] Preferably, the Cn alkyl group is n-hexadecyl group.

[0031] In one or more embodiments, the nucleotide sequence of the sense strand of the small nucleic acid targeting the androgen receptor is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmCmUm*Gm*Am, the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, n is 16; the nucleotide sequence of the sense strand is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGm CmUm*Gm*Am, the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, n is 18; the nucleotide sequence of the sense strand is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmCmUm*Gm*Am, the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUf GmGmAm*Am*Um, n is 20; the nucleotide sequence of the sense strand is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmCmUm*Gm*Am GfGmAmUmGmGmGmCmUm*Gm*Am, the nucleotide sequence of the antisense chain is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, n is 22; the nucleotide sequence of the sense chain is t*t*AmUmUmCmCfAmGfUfGfGmAmUmGmGmCmUm*(Cn-g)*Am, the nucleotide sequence of the antisense chain is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUf GmGmAm*Am*Um, n is 16; the nucleotide sequence of the sense chain is t*t*AmUmUmCmCmAmGf(Cn-u) GfGmAmUmGmGmGmCmUm*Gm*Am, the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, and n is 16; the nucleotide sequence of the sense strand is t*t*(Cn-a)UmUmCmCfAmGfUfGfGmAmUmGmGmCmUm*Gm*Am, the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUf GmGmAm*Am*Um, and n is 16;The nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUf GfGmAmUmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*(Cn-u), where n is 16; the nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUf GfGmAmUmGmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*(Cn-g), where n is 16; the nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUf GfGmAmUmGmGmGmCmUm*Gm*Am; the nucleotide sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCm(Cn-a)CmUfGmGmAm*Am*Um, and n is 16; or, the nucleotide sequence of the sense strand is t*t*AmUmUmCmCfAmGfUfGfGmAmUm GmGmCmUm*Gm*Am, and the nucleotide sequence of the antisense strand is (VPu)*UfUm(Cn-c) AmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um, and n is 16. ;

[0032] Preferably, the Cn alkyl group is a saturated alkyl group or an unsaturated alkyl group. More preferably, the Cn alkyl group is a saturated alkyl group. Further preferably, the Cn alkyl group is a saturated normal alkyl group.

[0033] Preferably, the nucleotide sequence of the sense chain is t*t*AmUmUm(Cn-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am, wherein n=16, and the nucleotide sequence of the antisense chain is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um.

[0034] In another aspect, the present invention provides a method for preparing a small nucleic acid targeting an androgen receptor as described in any of the embodiments herein.

[0035] Preferably, the method for preparing the small nucleic acid targeting the androgen receptor is the phosphoramidite triester method.

[0036] In another aspect, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of a small nucleic acid targeting an androgen receptor as described in any embodiment herein, and a pharmaceutically acceptable carrier, solvent or excipient.

[0037] In one or more embodiments, the carrier is a lipid nanoparticle or an exosome.

[0038] Preferably, the carrier is a lipid nanoparticle.

[0039] In one or more embodiments, the lipid nanoparticles are composed of an aqueous phase and an organic phase, and the volume ratio of the aqueous phase to the organic phase is 10:1 to 1:10.

[0040] Preferably, the volume ratio of the aqueous phase to the organic phase is 3:1 to 1:1. More preferably, the volume ratio of the aqueous phase to the organic phase is 3:1, 2:1 or 1:1. Further preferably, the volume ratio of the aqueous phase to the organic phase is 3:1.

[0041] In one or more embodiments, the organic phase is composed of cationic lipids, auxiliary lipids, steroids, PEG-lipids and aqueous phase, wherein the molar ratio of cationic lipids, auxiliary lipids, steroids and PEG-lipids is 40-60:3-20:25-55:0.1-10; the cationic lipids are selected from dilinoleyl methyl dimethylaminobutyrate (Dlin-M-C3-DMA), 9A1P9, trimethyl-2,3-dioleyloxypropylammonium chloride (DOTAP), trimethyl-2,3-dioleyloxypropylammonium bromide (DTOPA), dimethyl-2,3-dioleyloxypropyl-2-(2-sperminecarboxamido)ethylammonium trifluoroacetate (DOSPA), dioleylpropyl trimethylammonium chloride (DOTMA), C12-200, ATX-100, 98N 12-5, FTT5, heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), ((4-hydroxybutyl)azadialkyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (Lipid-319), bis(2-butyloctyl)10-(1-(3-(dimethylamino)propyl)-3-octylurea)nonadecanoate (OT13), Dlin-KC2-DMA, Lipid 29, 8-((2-hydroxyethyl)(8-(nonyloxy)8-oxooctyl)amino)octanoic acid heptadecan-9-yl ester) (Lipid5), Lipid A6, YSK12-C4 and CL4H6; the auxiliary lipid is selected from one or more of 1,2-distearoyl-sn-glycero-3-phosphatidylcholine (1,2-DSPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), dioleoylphosphatidylethanolamine (DOPE); the steroid lipid is selected from plant sterols or cholesterol; the PEG-lipid is selected from one or more of 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG2000), (DPG-PEG 2000), polyethylene glycol-distearoylphosphatidylethanolamine (PEG2000-DSPE), distearoyl-rac-glycero-polyethylene glycol 2000 (DSG-PEG 2000) and methoxypolyethylene glycol ditetradecyl acetamide (ALC-0159).

[0042] Preferably, the molar ratio of cationic lipid, helper lipid, steroid and PEG-lipid is 40-55:9-12:35-41:1-2.

[0043] Preferably, the aqueous phase is an acetic acid-sodium acetate buffer or a citric acid-sodium citrate buffer. More preferably, the aqueous phase is an acetic acid-sodium acetate buffer with a pH of 3.0 to 5.0. More preferably, the aqueous phase is a citric acid-sodium citrate buffer with a pH of 3.0 to 5.0. Further preferably, the aqueous phase is an acetic acid-sodium acetate buffer with a pH of 4.0 to 5.0. Further preferably, the aqueous phase is a citric acid-sodium citrate buffer with a pH of 4.0 to 5.0. Further preferably, the aqueous phase is an acetic acid-sodium acetate buffer with a pH of 4.5. Further preferably, the aqueous phase is a citric acid-sodium citrate buffer with a pH of 4.5.

[0044] In another aspect, the present invention provides a method for preparing a pharmaceutical composition as described in any embodiment herein, the method comprising adding a small nucleic acid targeting an androgen receptor as described in any embodiment herein, and a pharmaceutically acceptable carrier, solvent or excipient to a solvent.

[0045] Preferably, the method is ethanol injection.

[0046] In another aspect, the present invention provides use of a small nucleic acid or a pharmaceutical composition targeting an androgen receptor as described in any embodiment herein in the preparation of a drug for treating a disease associated with abnormal androgen expression.

[0047] Preferably, the disease associated with abnormal androgen expression is selected from androgenetic alopecia, alopecia areata, neurotic alopecia, scarring alopecia, diffuse alopecia or acne. More preferably, the disease associated with abnormal androgen expression is androgenetic alopecia.

[0048] The present invention provides siRNA targeting AR, and corresponding siRNA sequences comprising modifications, which can effectively reduce the expression of AR mRNA, so as to be used to treat diseases caused by abnormal androgen expression or to treat diseases associated with androgen receptors, and its indications include but are not limited to androgenetic alopecia, alopecia areata, neurotic alopecia, scarring alopecia, diffuse alopecia and acne. The present invention provides a variety of siRNA modification methods, and the sequence stability is enhanced after modification and AR mRNA is effectively knocked down. The siRNA provided by the present invention can be efficiently delivered to the target through lipid nanoparticles, or by adding alkyl chain modifications to the sequence, the siRNA can be effectively delivered to cells in the absence of other delivery carriers, and verified in cell experiments. Compared with existing small molecule drugs, the siRNA of the present invention has a longer duration of efficacy, a lower frequency of medication, and patients do not need to take medication every day, which effectively improves patient compliance. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 This is a graph showing the effect of naked sequence siRNA on the expression level of AR mRNA in cells.

[0050] Figure 2 This is a diagram of the enzymatic hydrolysis results of serum containing modified siRNA.

[0051] Figure 3 This figure shows the effect of modified siRNA on the expression level of AR mRNA in cells.

[0052] Figure 4 This is a graph showing the effects of modified siRNA delivered in different ways on the expression level of AR mRNA in cells.

[0053] Figure 5 This is a graph showing the effect of siRNA modified with alkyl chains Cn containing different carbon atoms on the expression level of AR mRNA in cells.

[0054] Figure 6 This is a graph showing the effect of siRNA modified with alkyl chains Cn at different sites on the expression level of AR mRNA in cells.

[0055] Figure 7 This figure shows the effect of modified siRNA on hair growth in male mice.

[0056] Figure 8 The figure shows the effect of modified siRNA on the phenotypes of hair growth in male mice. Figure 8 The figure a in the figure is the effect on hair length; Figure 8 b in the figure is the effect on the hair shaft diameter; Figure 8 The figure c in the figure shows the effect on the length of hair follicles; Figure 8 The figure d in the figure is the effect on hair follicle density; Figure 8 The figure e in the figure is the effect on the hair follicle diameter; Figure 8 The figure f is the effect of the ratio of the number of hair follicles in the growth phase to the resting phase; Figure 8 The g in the figure is the result of the effect on the area of ​​the hair bulb covered by melanin.

[0057] Fig. 9 The figure shows the effect of modified siRNA on the expression level of AR mRNA in the skin of male mice.

[0058] Fig.10 It is the content of each factor in the serum of male mice containing modified siRNA.

[0059] Fig.11 This figure shows the effect of modified siRNA on hair growth in female mice.

[0060] Fig.12 The figure shows the effect of modified siRNA on the phenotypes of hair growth in female mice. Fig.12 The figure a in the figure is the effect on hair length; Fig.12 b in the figure is the effect on the hair shaft diameter; Fig.12 The figure c in the figure shows the effect on the length of hair follicles; Fig.12 The figure d in the figure is the effect on hair follicle density; Fig.12 The figure e in the figure is the effect on the hair follicle diameter; Fig.12 The figure f is the effect of the ratio of the number of hair follicles in the growth phase to the resting phase; Fig.12 The g in the figure is the result of the effect on the area of ​​the hair bulb covered by melanin.

[0061] Fig.13 The figure shows the effect of modified siRNA on the expression level of AR mRNA in the skin of female mice. DETAILED DESCRIPTION

[0062] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0063] Unless otherwise specified, the reagents used in the following examples can be obtained from commercial sources.

[0064] In the present invention, RNA can play the role of one or more molecules of siRNA, ASO, saRNA, sgRNA, and miRNA to achieve a therapeutic effect.

[0065] In the present invention, RNA delivery methods include but are not limited to self-delivery, GalNAc, lipid nanoparticles, alkyl chains, cholesterol, phosphate groups, phosphate analogs, polyethylene glycol groups, cyclodextrin groups, cell-penetrating peptides, exosomes, antibody coupling, nucleic acid aptamers, polypeptide coupling, spherical nucleic acids (SNA), DNA nanostructures, etc.

[0066] In the present invention, the preparation method of lipid nanoparticles includes but is not limited to ethanol injection method, microfluidic mixing method, thin film hydration method, T-joint mixing method and the like.

[0067] In the present invention, the preparation method of some buffer solutions is as follows:

[0068] Sodium acetate solution (0.2 mol / L): Weigh 0.272 g of sodium acetate trihydrate and dissolve it in 10 g of water. Mix well.

[0069] Acetic acid solution (0.3 mol / L): Pipette 0.172 g of acetic acid into 9.828 g of water for injection and mix well.

[0070] Acetic acid-sodium acetate buffer (pH 4.5 at room temperature, 0.1368 mol / L): Pipette 2.65 mL of sodium acetate solution (0.2 mol / L) and 7.35 mL of acetic acid solution (0.3 mol / L) into a 50 ml centrifuge tube, add 10 mL of water for injection, mix well, and the pH value is about 4.5.

[0071] Citric acid-sodium citrate buffer (pH 4.0, 0.01 mol / L): Add 0.114 g citric acid and 0.104 g trisodium citrate to water for injection, dilute to 100 mL with water for injection and mix well.

[0072] Citric acid-sodium citrate buffer (pH 4.5, 0.14 mol / L): Add 1.223 g citric acid and 1.968 g trisodium citrate to water for injection, dilute to 100 mL with water for injection and mix well.

[0073] HEPES dilution buffer (containing 30 mM HEPES, 30 mM sodium chloride, and 6% sucrose): weigh 0.715 g HEPES, 0.175 g sodium chloride, and 6.0 g sucrose respectively, add 95.0 g water for injection, mix and dissolve, and adjust the pH to 7.4 with 0.5 M sodium hydroxide.

[0074] Example 1: siRNA sequence design and verification

[0075] This example discloses the design and screening of naked siRNA sequences targeting AR gene mRNA.

[0076] (1) siRNA sequence design

[0077] The NCBI gene ID of human AR (androgen receptor) is 367. Its transcript NM_000044.6 is used as a template, while avoiding the 5' untranslated region (5'UTR) and the 3' untranslated region (3'UTR) and the sequence near the start codon to design siRNA. The 5' and 3' ends of the sense strand and / or antisense strand of the siRNA may have no hanging nucleotides or several hanging nucleotides, and the bases of the hanging nucleotides do not participate in the base complementary pairing between the sense strand and the antisense strand; the 5' end of the sense strand, the 5' end of the antisense strand, the 3' end of the sense strand, and the 3' end of the antisense strand may independently have or not have hanging nucleotides. The number of the hanging nucleotides is preferably 0 to 10, more preferably 2 to 4, and even more preferably 2. Each pendant nucleotide is independently selected from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, thymine ribonucleotide, adenine deoxyribonucleotide, guanine deoxyribonucleotide, cytosine deoxyribonucleotide, uracil deoxyribonucleotide, and thymine deoxyribonucleotide.

[0078] According to the above principles, several pairs of siRNA sequences targeting AR gene mRNA (hereinafter referred to as siAR) were designed, and the sequence details are shown in Table 2.

[0079] Table 1 shows the representation of some special nucleotide monomers. In oligonucleotides, these special nucleotide monomers are linked to other nucleotide monomers via 5'-3'-phosphodiester bonds. The special nucleotide monomers in Table 1 can all be obtained commercially.

[0080] Table 1: Representation and meaning of special nucleotide monomers

[0081]

[0082] Table 2: siRNA sequences targeting AR

[0083]

[0084] (2) Synthesis of siRNA

[0085] The siRNA sequence was synthesized by the phosphoramidite triester method, which repeated the five procedures of "deprotection-activation-coupling-capping-oxidation". After each round of repetition, the oligonucleotide chain was extended by one nucleotide to finally obtain a crude synthetic product of the target length. The deprotection reagent was TCA Deblock, the activator was 5-benzylthiotetrazole, the capping reagents were CAPA and CAPB, and the oxidant was iodine solution or (E)-N,N-dimethyl-N'-(3-thio-3H-1,2,4-dithiazol-5-yl)formamidine.

[0086] The crude synthetic product is deprotected, annealed and purified to obtain different siRNA sequences; the annealed product is purified using HPLC.

[0087] Purification materials: anion exchange column Diamond Q Mustang (purchased from Bogelon) and eluent (a mixture of solution A and solution B in different proportions, solution A: 100 mM Tris, 10 mM EDTA, 300 mM NaCl, pH 9.0; solution B: 100 mM Tris, 10 mM EDTA, 1000 mM NaCl, pH 9.0).

[0088] Purification procedure: 5 CV (column volume) of solution A for elution; 50 CV of eluent (containing 0%-100% B) for elution; 5 CV of solution B for elution. The target elution peak product was desalted using a G25M column (purchased from Boglon), and the desalted product was concentrated by ultrafiltration to obtain the purified product, which was freeze-dried and vacuum-packed and stored at -20°C for future use.

[0089] (3) Verification of the effect of siRNA on cellular AR mRNA expression levels

[0090] Verification process: siRNA was dissolved and diluted to 100μM for later use. HaCat cells were inoculated into 12-well plates and transfected with siRNA 24h after inoculation. The transfection reagent was Lip3000 (Lipofectamine3000, purchased from Thermofisher). The final concentration of siRNA after transfection was 30nM and 100nM. The cells were cultured in a CO2 incubator for 48h. A control group without siRNA was set up. Cells were collected to extract RNA, reverse transcribed into cDNA, and qPCR was performed.

[0091] Verification results:

[0092] The cell validation results of each siRNA sequence are shown in Figure 1 As shown, the ordinate is the relative expression level of AR mRNA compared with the control group. Except for siAR-Luo5 and siAR-Luo6, which had poor knockdown effects on AR mRNA, the relative expression levels of AR mRNA corresponding to the other four sequences were all less than 0.6. Among them, siAR-Luo1, siAR-Luo2 and siAR-Luo3 all showed good knockdown effects at concentrations of 30 nM or 100 nM.

[0093] Example 2: Preparation of delivery vector LNP

[0094] This example discloses LNPs for delivering siRNA and methods for preparing the same.

[0095] (1) LNP composition

[0096] LNP is composed of an aqueous phase and an organic phase, wherein the organic phase includes cationic lipids, auxiliary lipids, steroids and PEG-lipids, and the molar ratio of the four lipids is 40-60:3-20:25-55:0.1-10. The aqueous phase buffer is selected from acetic acid-sodium acetate buffer and citric acid-sodium citrate buffer. The volume ratio of the aqueous phase to the organic phase is 1-100:1-100. Non-limiting examples of some LNP compositions are shown in Table 3.

[0097] Cationic lipids include, but are not limited to, dilinoleylmethyl dimethylaminobutyrate (Dlin-M-C3-DMA), 9A1P9, trimethyl-2,3-dioleyloxypropylammonium chloride (DOTAP), trimethyl-2,3-dioleyloxypropylammonium bromide (DTOPA), dimethyl-2,3-dioleyloxypropyl-2-(2-sperminecarboxamido)ethylammonium trifluoroacetate (DOSPA), dioleylpropyltrimethylammonium chloride (DOTMA), C12-200, ATX-100, 98N 12-5, FTT5, heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), ((4-hydroxybutyl)azadialkyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (Lipid-319), bis(2-butyloctyl)10-(1-(3-(dimethylamino)propyl)-3-octylurea)nonadecanoate (OT13), Dlin-KC2-DMA, Lipid 29, 8-((2-hydroxyethyl)(8-(nonyloxy)8-oxooctyl)amino)octanoic acid heptadecan-9-yl ester) (Lipid5), Lipid A6, YSK12-C4 and CL4H6.

[0098] Helper lipids include, but are not limited to, 1,2-distearoyl-sn-glycero-3-phosphatidylcholine (1,2-DSPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), and dioleoylphosphatidylethanolamine (DOPE).

[0099] Steroid lipids include, but are not limited to, plant sterols (such as campesterol, sitostanol, stigmasterol, spinasterol, β-sitosterol, etc.), and cholesterol.

[0100] PEG-lipids include, but are not limited to, 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG2000), (DPG-PEG 2000), polyethylene glycol-distearoylphosphatidylethanolamine (PEG2000-DSPE), distearoyl-rac-glycero-polyethylene glycol 2000 (DSG-PEG 2000), and methoxypolyethylene glycol ditetradecanoyl acetamide (ALC-0159).

[0101] Table 3: LNP composition

[0102]

[0103] (2) LNP preparation method

[0104] Taking LNP-001 as an example, the process of preparing small-sized LNP by ethanol injection method is as follows:

[0105] S1: Preparation of lipid ethanol solution

[0106] Weigh 34.4 mg of SM-102, 7.2 mg of DSPC, 16.0 mg of cholesterol, and 4.0 mg of DMG-PEG2000, respectively, add them to a 2 mL cryovial, add 1 mL of anhydrous ethanol, and vortex and shake to dissolve with a vortexer to obtain a lipid ethanol solution. Pipette each lipid ethanol solution in the required amount into a 1.5 mL centrifuge tube and mix evenly to obtain a final volume of 500 μL of an organic phase solution for standby use.

[0107] S2: Aqueous solution preparation

[0108] 0.4 mL of water for injection was used to dissolve 2 mg of siRNA lyophilized powder to obtain a 5000 ng / μL siRNA solution.

[0109] Take 1423 μL of acetic acid-sodium acetate buffer and 77 μL of siRNA solution into a 10 mL cryovial, slowly stir and mix to obtain an aqueous solution for later use.

[0110] Among them, V 水相 (Volume of aqueous solution) = V 缓冲液 (Volume of acetic acid-sodium acetate buffer) + V siRNA (siRNA solution volume), the volume ratio of aqueous phase to organic phase is 3:1; the mass of siRNA required is calculated to be 0.385 mg, and the volume of siRNA solution required in the aqueous phase solution can be calculated by the formula V siRNA = 385000 / C (μL), where C is the concentration of siRNA in the siRNA solution (ng / μL); the volume of acetic acid-sodium acetate buffer V required is calculated from this 缓冲液 = 1500-385000 / C (μL).

[0111] S3: Preparation of LNP-siRNA

[0112] About 500 μL of lipid ethanol solution was drawn and quickly injected into the aqueous solution to obtain LNP-001-siRNA. 50 μL of LNP solution was sampled and the particle size of the sample was measured using a Malvern particle size analyzer.

[0113] S4: Concentration and medium exchange

[0114] Add 3 times the volume of HEPES buffer to the sample and slowly invert to mix. Pour the diluted LNP solution into an ultrafiltration centrifuge tube, centrifuge and concentrate to 1.0-1.5 mL, fill with HEPES buffer, invert and mix, centrifuge and concentrate again to 0.3-0.5 mL, collect the sample and place it at 4°C for later use.

[0115] The preparation of LNP-002-siRNA to LNP-005-siRNA was carried out according to steps S1 to S4 and Table 3, respectively. The physical and chemical data are shown in Table 4. The particle size was good, the particle distribution was uniform (PDI < 0.1), and the encapsulation efficiency was high (> 90%).

[0116] Table 4: Physicochemical data of each LNP-siRNA

[0117]

[0118] Example 3: Design, synthesis and validation of modified siRNA

[0119] (1) Design and synthesis of modified siRNA

[0120] The RNA modifications in the present invention include, but are not limited to, phosphate backbone modifications, base modifications, ribose modifications, 5' end modifications, 3' end modifications, and bioconjugation modifications.

[0121] Phosphate backbone modifications include, but are not limited to, phosphorothioate, phosphorodithioate, peptide nucleic acid (PNA), and morpholinos (PMOs) modifications.

[0122] Base modifications include but are not limited to pseudouracil (φ), 2-thiouracil (s2U), 5-methylcytosine (5-methyl-cytosine), 2,6-diaminopurine, and 2-thiothymine (2-thio-thymine).

[0123] Ribose modifications include, but are not limited to, 2'-O-methyl (2ʹ-O-methyl), 2'-O-methoxyethyl (2ʹ-O-methoxyethyl), 2'-fluoro (2ʹ-F), locked nucleic acid (LNA), constrained ethyl (cEt), ENA (ethylene-bridged nucleic acid) and GNA (glycerolnucleic acid).

[0124] The 5'-end conjugation includes, but is not limited to, conjugation with cholesterol (cholesteryl), 5'-Vp (5'-vinylphosphonate), antibodies, polysaccharides, sterols, phospholipids or polypeptides.

[0125] The 3'-end conjugation includes, but is not limited to, conjugation with cholesterol, polyethylene glycol, N-acetylglucosamine derivatives, biotin, polypeptides, phospholipids, and the like.

[0126] Bioconjugation modifications include, but are not limited to, one or more combinations of N-acetylgalactosamine (GalNAc), cholesterol, aptamers, and peptides.

[0127] Sequence-modified isomers include, but are not limited to, isomers introduced by different monomer configurations or obtained by synthetic reactions, including, but not limited to, isomerism introduced by thiophosphate (R / S) and GNA (R / S).

[0128] According to the above sequence modification principle, the siAR-Luo1 obtained in Example 1 was further modified, that is, the modified siRNA sequence was synthesized with reference to the siRNA synthesis method of Example 1, and the modified special nucleotide monomers can be obtained commercially. The modified siAR-Luo1 sequence is shown in Table 5.

[0129] Table 5: siRNA sequences containing modifications

[0130]

[0131] (2) Serum enzymatic hydrolysis test

[0132] Normally, siRNA degrades quickly in the blood. According to the reference (doi: 10.1038 / mt.2009.91), unmodified siRNA can be degraded within 1 minute in the blood. The effect of different modification schemes on the stability of siRNA was detected by serum enzymatic hydrolysis experiment. Take multiple 0.2mL PCR tubes, add 800ng of each modified siRNA and 1μL fetal bovine serum, add DEPC water to 10μL, and place at 37℃ for 0h or 24h to obtain serum enzymatic samples. The siRNA content in the serum enzymatic samples was detected by agarose gel electrophoresis, and the electrophoresis conditions were 140V and 15min.

[0133] After electrophoresis, clear bands were observed for siAR-1-mode1, siAR-1-mode2, siAR-1-mode3, and siAR-1-mode6 at 0 h and 24 h, indicating that siAR-1-mode1, siAR-1-mode2, siAR-1-mode3, and siAR-1-mode6 had good stability. Among them, siAR-1-mode1 and siAR-1-mode2 had relatively better stability. The electrophoresis results of the two were as follows: Figure 2 shown.

[0134] (3) Verification of the effect of modified siRNA on cellular AR mRNA expression levels

[0135] HaCat cells were used to evaluate the knockdown effect of modified siRNA on AR mRNA. The verification method can be referred to Example 1. Figure 3 It can be seen that compared with the control group, the AR mRNA expression levels corresponding to siAR-1-mode1, siAR-1-mode2, siAR-1-mode3 and siAR-1-mode6 were relatively low.

[0136] Example 4: Carrier-free delivery effect of siRNA modified with alkyl chain Cn

[0137] Adding alkyl chain modifications to siRNA can effectively increase the lipophilicity of siRNA, achieve the effect of delivering siRNA into cells and successfully knocking down target mRNA without other delivery vectors, and further reduce the adverse reactions caused by delivery vectors. This example investigates the effect of alkyl chain Cn on the delivery of siRNA into cells, taking n-hexadecyl (Cn, n=16) in the alkyl chain as an example. The siAR-1 in Example 3 was selected for modification to carry out the experiment, siAR-1-mode1a and siAR-1-mode1b were the experimental groups, and a control group without siRNA was set up, and no delivery vector was used. The sequence is shown in Table 6 below. The Cn modification in siAR-1-mode1a was replaced by the Cm modification; the same position of siAR-1-mode1b was Cn modified.

[0138] Table 6: siRNA names and sequences

[0139]

[0140] Effects of Cn (n=16)-modified siRNA on the expression level of AR mRNA in cells

[0141] HaCat cells were used to evaluate the knockdown effect of siRNA modified with Cn (n=16) on AR mRNA. The verification method can be referred to Example 1. Figure 4 It can be seen that compared with the control group, the relative expression of AR mRNA in the siAR-1-mode1a group was greater than 0.6 under the conditions of 30mM and 100mM siRNA, and the relative expression of AR mRNA in the siAR-1-mode1b group was less than 0.6. It can be seen that Cn (n=16) modification significantly improved the delivery performance of siRNA into cells. Therefore, by adding alkyl chain Cn modification, carrier-free delivery of siRNA can be achieved, and the delivery effect is excellent.

[0142] Example 5: Carrier-free delivery of siRNA modified with alkyl chains

[0143] In this example, an alkyl chain Cn (n=16-22) modification was introduced into the siRNA sequence to further investigate the effect of the number of carbon atoms in the alkyl chain on siRNA delivery. The siRNA sequences containing Cn modification are shown in Table 7.

[0144] Table 7: siRNA sequences containing Cn modification

[0145]

[0146] Effects of siRNA modified with alkyl chains containing different numbers of carbon atoms on the expression level of AR mRNA in cells

[0147] HaCat cells were used to verify the knockdown effect of siRNA on AR mRNA. The verification method can be referred to Example 1. Figure 5 It can be seen that compared with the control group, the relative expression of AR mRNA corresponding to the four Cn-modified siRNAs at 30mM and 100nM concentrations was less than 0.6, which shows that the addition of Cn-modified siRNA can still effectively knock down AR mRNA in the absence of carriers such as lipid nanoparticles. Therefore, the Cn conjugate of siRNA has a good cell delivery effect.

[0148] Example 6: Delivery effect of siRNA modified with alkyl chains Cn at different sites

[0149] The antisense strand of siRNA can generally be divided into four regions, namely, a seed region, a middle region, a supplementary region, and a 3' tail region. Corresponding to the siAR-1 and its modified sequence provided by the present invention, the nucleotide sites corresponding to the four regions are the seed region (4th to 10th positions), the middle region (11th to 14th positions), the supplementary region (15th to 19th positions), and the 3' tail region (20th position to the 3' end); the above sites are all calculated in the 5'-3' direction.

[0150] In this example, a site was selected in each of the above regions of the antisense strand to insert a Cn modification, or a Cn modification was added to the corresponding complementary pairing site of the sense strand, and the effect of the modified site of the siRNA alkyl chain on siRNA delivery was further investigated. In particular, the combination of the siAR-1-mode1 sequence and the Cn (n=16) modification was used as an example for illustration; wherein the base complementary pairing site of siAR-1-mode1 is located at positions 3 to 21 of the sense strand (positions 1 to 2 are hanging nucleotides), and positions 3 to 21 of the antisense strand (positions 1 to 2 are hanging nucleotides); the above sites are calculated independently in the 5'-3' direction of the sense strand or the antisense strand. The siRNA sequences containing Cn (n=16) modifications at different sites are shown in Table 8.

[0151] Table 8: siRNA sequences containing different site Cn modifications (n=16)

[0152]

[0153] Effects of siRNA modified with alkyl chains at different sites on AR mRNA expression in HaCat cells

[0154] HaCat cells were used to evaluate the knockdown effect of siRNA on AR mRNA. The verification method can be referred to Example 1. Figure 6 It can be seen that the 8 modified siARs have good silencing effects on AR. Among them, except for siAR-1-mode16, the relative expression of AR mRNA corresponding to the other 7 siARs is less than 0.6, and the effect is outstanding. After inserting Cn (n=16) in different regions of the siAR sequence, the carrier-free delivery of siRNA can be achieved, and a good gene silencing effect can be achieved.

[0155] Example 7: Effects of modified siRNA on hair growth in male mice

[0156] A male mouse model was used to verify the effect of the modified siRNA (preferably siAR-1-mode1, hereinafter referred to as siAR) on hair growth and AR mRNA knockdown in mice. The delivery vector used was the LNP prepared in Example 2 (preferably LNP-001).

[0157] Construction of male male hair loss mouse model (modeling): C57BL / 6 male mice aged 6 to 8 weeks and weighing 20±2g were selected, and the hair on the back of each mouse was removed with a depilatory cream. 100 μL of 10 mg / mL dihydrotestosterone was subcutaneously injected at the depilatory site, 5 days a week, and the injection lasted for three weeks. The experiment lasted for 21 days. The experimental groups are shown in Table 9 below.

[0158] For male mice, siAR was administered via LNP or lip3000 carriers, recorded as LNP-siAR and lip3000-siAR. LNP-siAR or lip3000-siAR was injected intradermally (id) on days 0, 3, and 7, with an injection dose of 60 μg siRNA per mouse. Minoxidil was administered by smearing for 5 consecutive days per week. Among them, LNP-siAR was prepared by the method of reference Example 2, and lip3000-siAR was prepared by adding 10 μL lip3000 and 50 μL saline to tube A, and 50 μL saline and 60 μg siAR to tube B. All the liquid in tube B was transferred to tube A, mixed and set aside.

[0159] On the 21st day after hair removal, mice were killed, and the mouse skin was taken to detect the changes in AR mRNA expression, and serum samples were collected for later use; another skin tissue sample (2×3cm) was taken and fixed with 4% paraformaldehyde solution for 24h. After fixation, the skin tissue samples were dehydrated using low to high concentrations of ethanol (75%→85%→95%→anhydrous ethanol I→anhydrous ethanol II, 30min each), and the tissue samples were treated with xylene twice, each time for 10min. The skin tissue treated with ethanol and xylene was embedded in paraffin blocks, and longitudinal and horizontal sections of the skin with a thickness of 5.0μm were prepared.

[0160] The tissue sections were placed in xylene I for 30 min, xylene II for 30 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, 95% ethanol for 5 min, 85% ethanol for 5 min, and 75% ethanol for 5 min, dewaxed and stained with hematoxylin & eosin (H&E). The longitudinal sections were stained with Masson's trichrome stain to evaluate hair length, diameter, hair follicle density, growth phase / resting phase hair follicle ratio, and the area of ​​hair bulb covered by melanin.

[0161] Table 9: Experimental groups of male mice

[0162]

[0163] (1) Hair growth index

[0164] Changes in mouse phenotype over time Figure 7 As shown. On the 7th day after modeling, no obvious melanin plaques or new villi appeared in all groups, and the skin of the negative control group began to turn light gray, showing a trend of hair growth. On the 14th day after modeling, the negative control group grew hair normally, and the lip3000-siAR group had new hair, indicating that knocking down the AR gene can effectively promote hair growth, and lip3000 can be effectively used for siRNA delivery to skin tissue. On the 21st day after modeling, the negative control group had vigorous hair growth, the Minoxidil group had obvious new hair, and the LNP-siAR group had vigorous new hair and was significantly better than the Minoxidil group. It can be seen that knocking down the AR gene can effectively promote hair regeneration, and LNP can also be effectively used for siRNA delivery to skin tissue.

[0165] The analysis results of the phenotypic data of mouse skin sections on day 21 after modeling are as follows: Figure 8 As shown:

[0166] For hair length Figure 8 , a), hair shaft diameter of mice (hair shaft, Figure 8, b), length of hair follicle, Figure 8 , c), hair follicle density per view, Figure 8 , d), diameter of hair bulb, Figure 8 , e), the ratio of the number of hair follicles in the growth phase / telogen phase (anagen / telogen ratio, Figure 8 , f), melanin area in hair bulb, Figure 8 , g) The values ​​of each index in the DHT group were significantly lower than those in the negative control group, indicating that each index in the DHT group decreased significantly, while each index in the Minoxidil group and the three treatment groups was significantly higher than that in the DHT group, indicating that the treatment of Minoxidil, LNP-siAR, lip3000-siAR or lip3000-siAR and Minoxidil can significantly alleviate or reverse the effects of DHT modeling on hair and hair follicles. Figure 8 , f indicates that the treatment with Minoxidil, LNP-siAR, lip3000-siAR or lip3000-siAR and Minoxidil can effectively shorten the resting phase of hair follicles and make them enter the growth phase faster.

[0167] In the analysis of the above multiple indicators, the Minoxidil group showed similar efficacy to siAR, and was close to or only lower than the siAR treatment group in terms of various indicators. Compared with siAR alone, no obvious gain effect was observed in the lip3000-siAR+Minoxidil group. The results of this example suggest that the siRNA sequence siAR-1-mode1 has a significant promoting effect on hair growth.

[0168] (2) Expression level of androgen receptor mRNA in skin tissue

[0169] RNA from mouse skin tissue was extracted by Trizol method, and the expression level of target gene was detected by qPCR according to the kit instructions. The relative expression level of each group relative to the negative control group was as follows Fig. 9 As shown. It can be seen that the AR mRNA expression level in the DHT group was significantly higher than that in all treatment groups, and the AR mRNA expression level in the Minoxidil group and all treatment groups was lower than that in the negative control group.

[0170] Example 8: Safety Assessment of LNP-siAR

[0171] The expression levels of each factor TNF-α, TNF-γ, IL-1β, IL-6, CCL2, TGF-β and VEGF in the serum samples of the negative control group, DHT group and LNP-siAR group collected in Example 7 were detected by ELISA kit.

[0172] The expression levels of TNF-α, TNF-γ, IL-1β, IL-6, CCL2 and VEGF in serum were low, only at the pg level; the expression level of TGF-β was at the ng level. In order to better reflect the difference between the treatment group and the modeling group, this example investigated the relative expression changes of each factor in the LNP-siAR group and the DHT group relative to the negative control group. The results are shown in Figure 2. Fig.10 shown.

[0173] Depend on Fig.10 It can be seen that the expression levels of TNF-α, TNF-γ, IL-1β, IL-6 and CCL2 in the serum of the DHT group and the LNP-siAR group were relatively small, while the expression levels of TGF-β and VEGF were quite different. This may be due to the active role of TGF-β and VEGF in the LNP-siAR group in hair growth, and the expression levels of the two were significantly higher than those in the DHT group. Among them, TGF-β is involved in regulating cell division in hair follicles, activating hair follicle stem cells and proliferating them, stimulating hair growth; VEGF regulates angiogenesis, and the blood vessels around the hair follicles provide the necessary nutrients for hair growth.

[0174] Example 9: Effects of modified siRNA on hair growth in female mice

[0175] A female mouse model was used to verify the effect of the modified siRNA (preferably siAR-1-mode1, the same as siAR in this example) on mouse hair growth and AR mRNA knockdown, and the delivery vector used was the LNP prepared in Example 2 (preferably LNP-001).

[0176] Construction of female male depilatory mouse model (modeling): C57BL / 6 female mice aged 6 to 8 weeks and weighing 20±2g were selected, and the hair on the back of each mouse was removed with depilatory cream. 100 μL of 10 mg / mL dihydrotestosterone was subcutaneously injected at the depilatory site, 5 days a week, and the injection lasted for three weeks. The experiment lasted for 21 days. The experimental groups are shown in Table 10.

[0177] For male mice, the drug injection method, administration method, mouse skin collection method and processing method are the same as Example 7.

[0178] Table 10: Experimental groups of female mice

[0179]

[0180] (1) Hair growth index

[0181] Changes in mouse phenotype over time Fig.11 As shown. On the 7th day after modeling, no obvious melanin plaques or new villi appeared in all groups. On the 14th day after modeling, the negative control group had obvious hair growth, and the skin of the Minoxidil group and the lip3000-siAR group began to turn light gray, showing a trend of hair growth. On the 21st day after modeling, the Minoxidil, lip3000-siAR and DHT groups all had obvious hair growth, and the hair growth effect of the lip3000-siAR group was significantly better than that of the DHT group, indicating that for female mice, knocking down the AR gene can also effectively promote hair growth.

[0182] The analysis results of the phenotypic data of mouse skin sections on day 21 after modeling are as follows: Fig.12 As shown:

[0183] For hair length Fig.12 , a), hair shaft diameter of mice (hair shaft, Fig.12 , b), length of hair follicle, Fig.12 , c), hair follicle density per view, Fig.12 , d), diameter of hair bulb, Fig.12 , e), the ratio of the number of hair follicles in the growth phase / telogen phase (anagen / telogen ratio, Fig.12 , f), melanin area in hair bulb, Fig.12 , g) The values ​​of each index in the DHT group were significantly lower than those in the negative control group, indicating that each index in the DHT group decreased significantly, while each index in the Minoxidil group and the lip3000-siAR group were significantly higher than those in the DHT group, indicating that the treatment with Minoxidil or lip3000-siAR can significantly alleviate or reverse the effects of DHT modeling on the hair and hair follicles of female mice.

[0184] (2) Expression level of androgen receptor mRNA in skin tissue

[0185] The mRNA extraction and detection methods were the same as in Example 7. The relative expression levels of each group relative to the negative control group were as follows: Fig.13As shown. It can be seen that the AR mRNA expression level in the DHT group was significantly higher than that in the treatment group, and the AR mRNA expression levels in the Minoxidil group and the lip3000-siAR group were lower than those in the negative control group.

[0186] In summary, the present invention provides siRNA sequences targeting AR, and corresponding siRNA sequences comprising modifications, which can effectively reduce the expression of AR mRNA, so as to be used to treat diseases caused by abnormal androgen expression or to treat diseases associated with androgen receptors, and its indications include but are not limited to androgenetic alopecia, alopecia areata, neurotic alopecia, scarring alopecia, diffuse alopecia and acne, etc. The present invention provides a variety of siRNA modification methods, and the modified sequence stability is enhanced and ARmRNA is effectively knocked down. The siRNA provided by the present invention can be efficiently delivered to the target through a delivery vector, or by adding steroids and alkyl chain modifications to the sequence, the siRNA can be effectively delivered to cells in the absence of other delivery vectors, and verified in cell experiments. Compared with existing small molecule drugs, the siRNA of the present invention has a longer duration of efficacy, a reduced frequency of medication, and patients do not need to take medication daily, which effectively improves patient compliance.

Claims

1. A small nucleic acid targeting androgen receptor, characterized in that: The small nucleic acid targeting the androgen receptor comprises a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence as shown in SEQ ID NO: 1, and the antisense strand comprises a nucleotide sequence as shown in SEQ ID NO: 2; the small nucleic acid targeting the androgen receptor comprises one or more modifications; the sequence of the sense strand is t*t*AmUmUm(C16-c)CfAmGfUfGfGmAmUmGmGmGmCmUm*Gm*Am (SEQ ID NO: 13), and the sequence of the antisense strand is (VPu)*UfUmCmAmGfCmCfCfAmUmCmCmAfCmUfGmGmAm*Am*Um (SEQ ID NO: 14), Among them, u or U represents uracil nucleotide, g or G represents guanine nucleotide, c or C represents cytosine nucleotide, a or A represents adenine nucleotide, t represents thymidine deoxynucleotide, φ represents pseudouridine acid, m represents 2'-O-methyl modification, Cm-CH3 represents cytosine nucleotide containing 2'-O-methyl modification and 5-methyl modification, φm represents pseudouridine acid containing 2'-O-methyl modification and N1 methyl modification, m represents 2'-O-methoxyethyl modification, f represents 2'-fluorine modification, L represents locked nucleic acid modification, GNA represents glycol nucleic acid modification, VP represents 5'-phosphorylation modification of ribose, * represents thiolation modification of a non-bridging oxygen atom of the phosphate group at the α-position of the nucleotide, and C16- represents 2'-O-n-hexadecyl modification.

2. A method for preparing the small nucleic acid targeting androgen receptor as claimed in claim 1.

3. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises a therapeutically effective amount of the small nucleic acid targeting the androgen receptor as claimed in claim 1, and a pharmaceutically acceptable carrier, solvent or excipient.

4. The pharmaceutical composition according to claim 3, characterized in that The carrier is lipid nanoparticles or exosomes.

5. The pharmaceutical composition according to claim 4, characterized in that The lipid nanoparticles are composed of an aqueous phase and an organic phase, and the volume ratio of the aqueous phase to the organic phase is 10:1 to 1:

10.

6. The pharmaceutical composition according to claim 5, characterized in that The organic phase is composed of cationic lipids, auxiliary lipids, steroids, and PEG-lipids, wherein the molar ratio of the cationic lipids, auxiliary lipids, steroids, and PEG-lipids is 40-60:3-20:25-55:0.1-10; the cationic lipids are selected from dilinoleyl methyl dimethylaminobutyrate (Dlin-M-C3-DMA), 9A1P9, trimethyl-2,3-dioleyloxypropylammonium chloride (DOTAP), trimethyl-2,3-dioleyloxypropylammonium bromide (DTOPA), dimethyl-2,3-dioleyloxypropyl-2-(2-sperminecarboxamido)ethylammonium trifluoroacetate (DOSPA), dioleylpropyl trimethylammonium chloride (DOTMA), C12-200, ATX-100, 98N 12 -5, FTT5, heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), ((4-hydroxybutyl)azadialkyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (Lipid-319), bis(2-butyloctyl)10-(1-(3-(dimethylamino)propyl)-3-octylurea)nonadecanoate (OT13), Dlin-KC2-DMA, Lipid 29, 8-((2-hydroxyethyl)(8-(nonyloxy)8-oxooctyl)amino)octanoic acid heptadecan-9-yl ester) (Lipid5), Lipid A6, YSK12-C4 and CL4H6; the auxiliary lipid is selected from one or more of 1,2-distearoyl-sn-glycero-3-phosphatidylcholine (1,2-DSPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), dioleoylphosphatidylethanolamine (DOPE); the steroid lipid is selected from plant sterols or cholesterol; the PEG-lipid is selected from one or more of 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG2000), (DPG-PEG 2000), polyethylene glycol-distearoylphosphatidylethanolamine (PEG2000-DSPE), distearoyl-rac-glycero-polyethylene glycol 2000 (DSG-PEG 2000) and methoxypolyethylene glycol ditetradecyl acetamide (ALC-0159).

7. A method for preparing the pharmaceutical composition according to any one of claims 3 to 6, characterized in that: The method comprises adding the small nucleic acid targeting androgen receptor as claimed in claim 1 and a pharmaceutically acceptable carrier, solvent or excipient into a solvent.

8. Use of the small nucleic acid targeting androgen receptor according to claim 1 or the pharmaceutical composition according to any one of claims 3 to 6 in the preparation of a drug for treating diseases related to abnormal androgen expression.

Images