Nucleic acid aptamers specifically binding to homocysteine and their applications

Abstract

The present invention discloses a nucleic acid aptamer that specifically binds to homocysteine and its applications, belonging to the field of molecular biomedicine technology. The nucleic acid aptamer SEQCR13-2 that specifically binds to homocysteine was screened in the present invention, and its nucleotide sequence is shown as SEQ ID NO.1. It has been verified that the nucleic acid aptamer SEQCR13-2 has a high affinity for homocysteine, and the binding dissociation constant (Kd) reaches the nanomolar level, and it has high selectivity. It can specifically distinguish homocysteine and cysteine in vitro, and is of great significance in the diagnosis and treatment of homocysteine-related diseases. The nucleic acid aptamer SEQCR13-2 can be applied to the auxiliary diagnosis of hyperhomocysteinemia and the evaluation of cardiovascular disease risk, or used in basic research related to the occurrence, development and progression of such diseases.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biomedicine, and particularly relates to a nucleic acid aptamer specifically binding to homocysteine and its application. Background Art

[0002] Homocysteine (Hcy), namely 2-amino-4-mercaptobutyric acid, is an intermediate product in the biosynthesis processes of methionine and cysteine. The normal reference value of Hcy in the human body is 5-15 μmol / L, and values higher than the reference value are often diagnosed as hyperhomocysteinemia. The total blood homocysteine index is an important index for judging health risks and is beneficial to the prevention and control of the occurrence and development of many chronic diseases. Hyperhomocysteinemia is a genetic disease caused by enzyme deficiency in the methionine metabolism process and is a rare syndrome involving the eyes, cardiovascular system, bones, and nervous system. Some studies have shown that more than a hundred diseases are related to the increase in the plasma total homocysteine concentration, including but not limited to cardiovascular diseases and central nervous system diseases.

[0003] Therefore, the timely determination of the Hcy content can play a great role in the auxiliary diagnosis of hyperhomocysteinemia and the prevention of cardiovascular diseases. Hcy has characteristics similar to those of cysteine (Cys). Cys is an essential amino acid and is involved in protein synthesis, detoxification, and metabolism. An increase in the Cys level is related to neurotoxicity, and a lack of Cys is related to a slow growth rate, hair pigment loss, edema, lethargy, liver damage, muscle and fat loss, skin lesions, and weakness. Since the Cys and Hcy levels are related to different diseases, their differentiation is necessary. The structural similarity between Cys and Hcy (only differing by one methylene group) poses a great challenge to the specific detection of homocysteine.

[0004] Methods for specifically detecting homocysteine include enzyme-linked immunosorbent assay, high-performance liquid chromatography, mass spectrometry, etc. Among them, in the enzyme-linked immunosorbent assay, Hcy is mainly converted into S-adenosylhomocysteine through an enzyme reaction, and the content of the sample is indirectly determined with an anti-S-adenosylhomocysteine antibody. However, the cost of the antigens and antibodies used is relatively high, and there are deficiencies such as poor repeatability and high false positives in the detection results; although high-performance liquid chromatography and mass spectrometry improve the detection accuracy, the operations are cumbersome, large-scale instrument equipment is required, and the cost is relatively high, which is not suitable for rapid detection. Although nucleic acid aptamers for homocysteine have been screened out at present, their specificity for homocysteine or the detection effect is not ideal in practical applications. Summary of the Invention

[0005] Object of the Invention: Aiming at the problems existing in the prior art, the present invention provides a nucleic acid aptamer that can specifically bind to homocysteine. The aptamer provided by the present invention can simply, rapidly, sensitively and specifically recognize and bind to homocysteine, which is of great significance for the auxiliary diagnosis of hyperhomocysteinemia, the risk assessment of cardiovascular diseases and basic research.

[0006] Technical Solution: In order to achieve the above object, for the nucleic acid aptamer that specifically binds to homocysteine in the present invention, the nucleic acid aptamer is nucleic acid aptamer SEQCR13-2, and its nucleotide sequence is as SEQ ID NO.1: 5'-TATAGCAATGGTACGGTACTTCCATGGCATTTGCTCCACTCCTGTTCACAGGCATCTTCATTACAAAAGTGCACGCTACTTTGCTAA-3'.

[0007] For the nucleic acid aptamer that specifically binds to homocysteine in the present invention, the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO.2: 5'-ATGGCATTTGCTCCACTCCTGTTCACAGGCATCTTCATTA-3'.

[0008] Wherein, the nucleic acid aptamer is modified with a labeling agent at the 5' end or 3' end of the sequence shown in SEQ ID NO.2.

[0009] Wherein, the labeling agent is a biotin labeling agent, a digoxin labeling agent, a fluorescent labeling agent, a nano-luminescent material labeling agent or an enzyme labeling agent.

[0010] Preferably, the nucleic acid aptamer is modified with a FAM group at the 5' end of the sequence shown in SEQ ID NO.2, and it is: 5'-FAM-ATGGCATTTGCTCCACTCCTGTTCACAGGCATCTTCATTA-3' (APT-FAM).

[0011] For the nucleic acid aptamer that specifically binds to homocysteine in the present invention, the nucleic acid aptamer includes any of the following sequences: 1) a nucleotide sequence having a homology of more than 80% with nucleic acid aptamer SEQCR13-2 and capable of specifically binding to homocysteine; 2) a nucleotide sequence hybridizing with the nucleotide sequence of any one of nucleic acid aptamer SEQCR13-2 and capable of specifically binding to homocysteine; 3) an RNA sequence reverse transcribed from the nucleotide sequence of any one of nucleic acid aptamer SEQCR13-2.

[0012] The nucleic acid aptamer specifically binding to homocysteine described in the present invention includes a nucleotide sequence that can specifically bind to homocysteine obtained by modifying the phosphate backbone, truncating, extending, transverting the nucleotide sequence of the nucleic acid aptamer SEQCR13-2, or chemically modifying the bases; or a nucleotide sequence that can specifically bind to homocysteine obtained by labeling the 5'-end or 3'-end of the nucleic acid aptamer SEQCR13-2 with a label.

[0013] Application of the nucleic acid aptamer specifically binding to homocysteine described in the present invention in the preparation of a homocysteine detection reagent or tool.

[0014] Preferably, application of the nucleic acid aptamer SEQCR13-2, APT-FAM, or the combination of APT-FAM and cDNA-BHQ1 in the preparation of a homocysteine detection reagent or tool.

[0015] Among them, APT-FAM is the product of the primer binding region before and after truncating the sequence SEQCR13-2, and the FAM group is modified at the 5'-end; the cDNA-BHQ1 sequence is the short complementary strand (cDNA) of the APT-FAM sequence, and the BHQ1 group is modified at the 3'-end. Among them, the cDNA-BHQ1 sequence: 5'-CAGGAGTGGAGCAAATGCCAT-BHQ1-3' (SEQ ID NO.3).

[0016] Furthermore, application of the present invention based on the nucleic acid aptamers APT-FAM and cDNA-BHQ1 in the preparation of a homocysteine detection reagent or tool by fluorescence competition method for detecting homocysteine.

[0017] Application of the nucleic acid aptamer specifically binding to homocysteine described in the present invention in the preparation of a homocysteine diagnostic reagent, test strip, or biosensor.

[0018] Application of the nucleic acid aptamer specifically binding to homocysteine described in the present invention in the preparation of a reagent or tool for assisting in the diagnosis of hyperhomocysteinemia or evaluating the risk of cardiovascular diseases.

[0019] The active ingredient of the homocysteine diagnostic reagent, test strip, or biosensor described in the present invention includes the nucleic acid aptamer specifically binding to homocysteine.

[0020] The reagent for assisting in the diagnosis of hyperhomocysteinemia or evaluating the risk of cardiovascular diseases described in the present invention, and the active ingredient of the reagent includes the nucleic acid aptamer specifically binding to homocysteine.

[0021] Preferably, the above-mentioned reagent includes the SEQCR13-2, APT-FAM, or APT-FAM and cDNA-BHQ1 described above.

[0022] Through the regioselective-SELEX screening strategy, the present invention uses homocysteine as the screening target and conducts multiple rounds of screening, successfully obtaining multiple specific nucleic acid aptamer candidate sequences. After verification, the nucleic acid aptamer SEQCR13-2 has excellent affinity and selectivity for binding to homocysteine, can specifically distinguish homocysteine and cysteine in vitro, and is of great significance in the diagnosis and treatment of Hcy-related diseases. Therefore, the nucleic acid aptamer SEQCR13-2 can be applied to the auxiliary diagnosis of hyperhomocysteinemia and the evaluation of cardiovascular disease risk, or used in basic research related to the occurrence, development, and progression of such diseases.

[0023] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0024] 1. In the present invention, homocysteine is used as the positive screening target and cysteine as the negative screening target. Based on the regioselective-SELEX technology, the nucleic acid aptamer SEQCR13-2 with high affinity for homocysteine is screened out for the first time. After verification, the KD value of SEQCR13-2 for homocysteine is 33 ± 2.74 nM, showing high affinity for homocysteine, which is about 10 times higher than that for cysteine. According to the principle of conformational change after the aptamer binds to the target, a fluorescence competition detection method based on the aptamer is designed. The detection limit for homocysteine is 10 nM, and the linear range is 10 - 25 nM, showing good application prospects.

[0025] 2. The nucleic acid aptamer SEQCR13-2 in the present invention has a high affinity for homocysteine. The nucleic acid aptamer SEQCR13-2 can be used as a detection reagent for Hcy in the blood or urine of patients with hyperhomocysteinemia, and can also be used for the prevention and control of cardiovascular diseases. It can also be used for basic research related to the occurrence and development process of cardiovascular diseases.

[0026] 3. The nucleic acid aptamer SEQCR13-2 in the present invention can simply, quickly, and sensitively recognize and bind to homocysteine, is suitable for the auxiliary diagnosis of hyperhomocysteinemia and the prevention of cardiovascular diseases, or can be directly used as a drug for the auxiliary treatment of patients with related diseases, having broad clinical application prospects and basic application values.

[0027] 4. The nucleic acid aptamer that specifically binds to homocysteine in the present invention can be directly artificially synthesized by biological and chemical methods, with good repeatability between production batches, low cost, and easy storage. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is a monitoring chart of the binding rate in the screening of nucleic acid aptamers;

[0029] Figure 2 It is a graph of the KD value and the binding curve of the nucleic acid aptamer binding to homocysteine;

[0030] Figure 3 It is a graph of the KD value and the binding curve of the nucleic acid aptamer binding to cysteine;

[0031] Figure 4 It is a schematic diagram of the principle of the fluorescence detection method established based on nucleic acid aptamers;

[0032] Figure 5 It is a schematic diagram related to the standard curve for the detection of homocysteine established based on the fluorescence detection method of nucleic acid aptamers;

[0033] Figure 6 It is a schematic diagram of the selectivity test based on the fluorescence assay of nucleic acid aptamers. DETAILED DESCRIPTION OF THE INVENTION

[0034] The technical solutions of the present invention will be further described below in conjunction with the accompanying drawings, but are not limited thereto. Any modification or equivalent replacement of the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention shall be covered by the protection scope of the present invention.

[0035] The materials, reagents, etc. used in the examples can be obtained from commercial sources without special instructions.

[0036] Example 1

[0037] Screening and Preparation of Nucleic Acid Aptamers Specifically Binding to Homocysteine

[0038] (1) Construction of the initial single-stranded nucleic acid library:

[0039] Both ends of the library are the binding sites of the forward primer and the reverse primer. The N in the middle of the library represents a random base among (A\T\G\C), and there are 21 random sites in total. The initial library is: 5'-TATAGCAATGGTACGGTACTTCC-(N21)-TTCACAGGCATCTTCATTACAAAAGTGCACGCTACTTTGCTAA-3' (SEQ ID NO.4).

[0040] Forward primer (FP): 5'- TATAGCAATGGTACGGTACTTCC -3' (SEQ ID NO.5);

[0041] Reverse primer (RP): 5'- TTAGCAAAGTAGCGTGCACTTTTG -3' (SEQ ID NO.6);

[0042] Biotin-labeled reverse primer: Bio-RP: 5'- Biotin-TTAGCAAAGTAGCGTGCACTTTTG -3', which is the 5'-end of SEQ ID NO.6 modified with biotin; The above sequences were all purchased from GenScript Biotech Corporation.

[0043] (2) Preparation of solutions used in the experiment

[0044] 2× Binding buffer (2× HEPES Buffer): 50 mM HEPES, 100 mM NaCl, 1 mM MgCl2, 20 mM KCl, 1 mM CaCl2, 0.1% Tween-20, adjust the pH to 7.4. 1× HEPES Buffer is diluted from 2× HEPES Buffer.

[0045] Coupling buffer solution (0.1M MES Buffer): 976.18 mg of 4-morpholineethanesulfonic acid, add 50 mL of ultrapure water, adjust the pH to 6.

[0046] Preparation of positive and negative screening target solutions: Add 1 mL of 1× HEPES Buffer to 1.35 mg of Hcy to obtain a 10 mM Hcy stock solution; Add 925 μL of 2M HCl solution to 1.12 mg of Cys to obtain a 10 mM Cys stock solution. Take 1 μL of each stock solution and add 999 μL of 1× HEPES Buffer to prepare a 10 μM solution, store at 20 °C for later use.

[0047] 1-Ethyl-(3-dimethylaminopropyl)carbodiimide (EDC), N-Hydroxysuccinimide (NHS) solutions (both at a concentration of 10 mg / mL), prepared using 0.1M MES Buffer, freshly prepared before use.

[0048] 10× PBS Buffer: Weigh 2 g of KCl, 2.4 g of KH2PO4, 36.3 g of Na2HPO4·12H2O, 80 g of NaCl, add 700 mL of ultrapure water, dissolve by sonication and make up the volume to 1 L. 1× PBS Buffer is diluted from 10× PBS Buffer.

[0049] Preparation of single-stranded library and primer solutions: Centrifuge the library and primer lyophilized powder at 12000 rpm for 10 min, add the corresponding amount of 1× HEPES Buffer according to the labeled volume to prepare a 2 μM initial library solution and a 10 μM primer solution.

[0050] Carboxyl magnetic beads: MCE, catalog number HY-K0225.

[0051] 2×Taq Pro HS Master Mix: Nanjing Novoprotein Scientific Inc., catalog number P112-01.

[0052] Molecular weight standard Marker A (25 - 500 bp): Sangon Biotech (Shanghai) Co., Ltd., catalog number B600303.

[0053] Streptavidin agarose microspheres: Yeasen Biotech Co., Ltd., catalog number 20512ES08.

[0054] Chromatography column: BIO-RAD, catalog number 732-6204.

[0055] (3) Activation of carboxyl magnetic beads

[0056] Take 10 μL of carboxyl magnetic beads in an EP tube, centrifuge, and magnetically separate to aspirate the supernatant. Add 200 μL of MES Buffer to the EP tube to wash the magnetic beads, centrifuge, and magnetically separate to aspirate the supernatant, and repeat the washing 2 times. After washing, add 100 μL of freshly prepared 10 mg / mL EDC and NHS solutions to the EP tube respectively, and activate at room temperature for 1 h.

[0057] (4) Heat treatment of the library

[0058] Dilute the ssDNA library in 500 μL of binding buffer (50 mM HEPES, 100 mM NaCl, 1 mM MgCl2, 20 mM KCl, 1 mM CaCl2, 0.1% Tween-20, pH 7.4). Heat at 95 °C for 10 min, quickly cool on ice, keep for 5 min, and then place at room temperature for 5 min.

[0059] (5) Binding of the target to the single-stranded library

[0060] 1) Positive screening

[0061] Add the heat-treated initial library in step (4) to the activated magnetic bead solution (excess magnetic beads) in step (3), mix well and incubate at room temperature for 30 min, centrifuge, and collect the supernatant by magnetic separation. Add a certain amount of Hcy (see Table 1) to the supernatant, incubate at room temperature for 1 h, then transfer it to a newly activated magnetic bead solution, mix well and incubate at room temperature for 30 min, and discard the supernatant by magnetic separation. The aptamer combined with Hcy is captured on the magnetic beads. Add 120 μL of HEPES Buffer, heat at 95 °C for 20 min, collect the supernatant, keep 20 μL as a sample, and use the rest for PCR amplification as a standby, and proceed according to the subsequent steps (6)-(8), and repeat 7 rounds (R1-R8).

[0062] 2) Negative screening

[0063] Take a certain amount of Cys (see Table 1) and add it to the library heat-treated in step (4) (the library screened in the 8th round), incubate at room temperature for 30 min, add it to the activated magnetic bead solution, mix well and incubate at room temperature for 30 min, centrifuge, and collect the supernatant by magnetic separation. Add a certain amount of Hcy (see Table 1) to the supernatant, incubate at room temperature for 1 h, then transfer it to a newly activated magnetic bead solution, mix well and incubate at room temperature for 30 min, and discard the supernatant by magnetic separation. The aptamer combined with Hcy is captured on the magnetic beads. Add 120 μL of HEPES Buffer, heat at 95 °C for 20 min, and collect the supernatant while it is hot. Keep 20 μL as a template in step (9), and use the rest for PCR amplification as a standby, and proceed according to the subsequent steps (6)-(8), and repeat 4 rounds (CR9-CR13). Table 1 contains the targets and library feeding amounts in 13 rounds of screening, where R1 represents the first round of positive screening, CR9 represents the ninth round of negative screening, and so on.

[0064] Table 1 Feeding amounts for positive and negative screening

[0065]

[0066] (6) PCR amplification

[0067] Prepare a PCR solution system of 2 μL of 10 μM FP; 2 μL of 10 μM Bio-RP; 5 μL of the ssDNA-containing supernatant after screening in step (5); 25 μL of 2×Taq Pro HS Master Mix; 16 μL of ddH2O. Take 5 μL of the ssDNA-containing supernatant after each round of screening in step (5) and perform small-scale PCR amplification according to the instruction manual of the 2×Taq Pro HS Master Mix reagent.

[0068] (7) Monitor the screening process by gel electrophoresis

[0069] Electrophoretic characterization was performed on 6 μL of DNA molecular weight standard Marker A, 3 μL of the blank solution of 1×HEPES Buffer in step (2), and the small-scale PCR product in step (6) using an 8% non-denaturing polyacrylamide gel. The electrophoresis voltage was set at 120 V and the electrophoresis duration was 25 min. The gel was stained with a nucleic acid dye and imaged to compare the blank solution and the small-scale PCR product in step (6). The clear bands obtained from monitoring the small-scale PCR product were used for large-scale PCR according to the instructions of the 2×Taq Pro HS Master Mix reagent based on the number of PCR amplification cycles.

[0070] (8) Preparation of ssDNA

[0071] Take 200 μL of streptavidin agarose microspheres and place them in a chromatography column. Let it stand for 5 - 10 min for layering, wash 3 times with 1×PBS Buffer. After mixing the amplified double-strands in step (7) evenly, add them to the chromatography column for immobilization. Add the eluate back to the chromatography column and repeat 5 times. Then wash 10 times with 200 μL of 1×PBS Buffer. Add 400 μL of 0.2 M NaOH to the chromatography column for elution, collect the eluate, adjust the pH to neutral with HCl, ultrafiltrate and concentrate to 100 μL, measure the concentration using Nano Drop-100, and store it at -20 °C as the library for the next round of screening.

[0072] (9) Monitoring the enrichment degree by qPCR

[0073] Prepare a qPCR solution system containing 0.2 μL of 10 μM FP; 0.2 μL of 10 μM RP; 1 μL of the template solution obtained in step (5); 5 μL of Sybrgreen; 3.6 μL of ddH2O. Prepare a calibration curve for the library in parallel. Dilute the initial single-stranded library with ultrapure water to prepare a series of concentrations, take 1 μL and amplify according to the qPCR solution system. Plot a calibration curve with the Ct value as the ordinate and the logarithm of the series concentration (logC) as the abscissa. Take the supernatant of the sample retained after each round of screening as the template solution for amplification, calculate the amount of eluted ssDNA according to the calibration curve, and calculate the binding percentage by dividing the amount of eluted DNA by the amount of Hcy input to detect the binding rate of the enriched library in each round. The results are as Figure 1 shown. As the number of screening rounds increases, the library shows obvious enrichment in the 10th round and then the enrichment degree tends to be stable.

[0074] (10) High-throughput analysis of the enriched library

[0075] During the entire screening process, starting from the 9th round, the library was subjected to reverse screening, and the reverse screening agent was cysteine. The binding rate results showed a further increase in the enrichment level of the library. High-throughput sequencing was performed on the enriched libraries of the 10th and 13th rounds to determine the candidate nucleic acid aptamer sequences. The results of high-throughput sequencing showed that the total number of sequences was 119415 and 122178 respectively, containing 90050 and 32855 unique sequences. The data of high-throughput sequencing indicated that the sequence richness of the 13th round was greatly reduced, and high enrichment had been achieved, so it was determined as the screening endpoint. The sequencing results of the 13th round were analyzed, and the high-abundance sequences were selected as candidate sequences.

[0076] In this example, nucleic acid aptamer sequences were screened by the Systemic evolution of ligands by exponential enrichment (SELEX) technique. Specifically, homocysteine was used as the positive screening target, and cysteine was used as the reverse screening target. After multiple rounds of repeated incubation, elution, amplification, and single-strand preparation, multiple nucleic acid aptamer sequences were screened. By performing sequence alignment and homology analysis on these nucleic acid aptamer sequences, candidate nucleic acid aptamer sequences were determined and their specificity and affinity were verified.

[0077] Specificity and affinity were determined by isothermal titration calorimetry to evaluate the binding ability of the candidate nucleic acid aptamers to homocysteine and cysteine. Among them, the nucleotide sequence of the nucleic acid aptamer SEQCR13-2 is as shown in SEQ ID NO.1: 5'-TATAGCAATGGTACGGTACTTCCATGGCATTTGCTCCACTCCTGTTCACAGGCATCTTCATTACAAAAGTGCACGCTACTTTGCTAA-3'. After truncating the primer binding sites at both ends, the FAM group was modified at the 5' end to obtain the APT-FAM sequence: 5'-FAM-ATGGCATTTGCTCCACTCCTGTTCACAGGCATCTTCATTA-3'. Using 1×HEPES Buffer as the buffer solvent, the target Hcy and the reverse target Cys solutions were diluted to 200 μM, and the nucleic acid aptamer APT-FAM was prepared into 10 μM. The Hcy and Cys solutions were respectively aspirated with a titration needle and titrated into the solution containing the candidate nucleic acid aptamer APT-FAM in the sample cell at 25°C. Data analysis was performed using the Microcal PEAQ ITC software, and the equilibrium dissociation constant (KD) of the candidate nucleic acid aptamer with Hcy or Cys was obtained by fitting. The test results are as Figure 2 and Figure 3 shown. Figure 2 It can be seen that the KD value of this nucleic acid aptamer for homocysteine is 33 ± 2.74 nM.Figure 3 It can be seen that the KD value of the nucleic acid aptamer for cysteine is 322 ± 72.83 nM. According to the KD value results, the nucleic acid aptamer has a better affinity for homocysteine than the reported nucleic acid aptamers for homocysteine, has excellent binding ability to Hcy, and has a nearly 10-fold difference from cysteine, and can specifically distinguish Hcy and Cys.

[0078] Example 2

[0079] Establishment of a fluorescence detection method for Hcy based on nucleic acid aptamers

[0080] (1) Sequence modification includes: APT-FAM sequence: 5'-FAM-ATGGCATTTGCTCCACTCCTGTTCACAGGCATCTTCATTA-3'; cDNA-BHQ1 sequence: 5'-CAGGAGTGGAGCAAATGCCAT-BHQ1-3'; APT-FAM is the product of the primer binding region before and after truncation of SEQ ID NO. 1, and the FAM group is modified at the 5' end; the cDNA-BHQ1 sequence is the short complementary strand (cDNA) of the APT-FAM sequence, and the BHQ1 group is modified at the 3' end.

[0081] The above sequences were all purchased from GenScript Biotech Corporation.

[0082] (2) Preparation of experimental solutions

[0083] Binding buffer: 20 mM Tris-HCl (pH 7.5), 50 mM NaCl (analytical grade), 0.5 mM MgCl2 (analytical grade), prepared with ultrapure water.

[0084] APT-FAM solution: Take 1 nmol of APT-FAM and add it to 100 μL of binding buffer, and dilute it to a 250 nM solution with the binding buffer as the solvent.

[0085] cDNA-BHQ1 solution: Take 1 nmol of cDNA-BHQ1 and add it to 100 μL of binding buffer, and dilute it to a 250 nM solution with the binding buffer as the solvent.

[0086] Hcy solution: Dilute the Hcy stock solution to a 50 μM working solution.

[0087] (3) Fluorescence detection method based on nucleic acid aptamers

[0088] Solutions of different concentrations of Hcy (final concentration range from 10 nM to 1.5 μM), nucleic acid aptamer APT-FAM with a FAM label at the 5'-end, and complementary DNA (cDNA-BHQ1) with a BHQ1 label at the 3'-end were mixed in a solution containing 20 mM Tris-HCl (pH 7.5), 50 mM NaCl, and 0.5 mM MgCl2. The final concentration of APT-FAM was 25 nM, and the final concentration of cDNA-BHQ1 was 100 nM. All sample solutions were incubated at 25 °C for 1 h. The sample solution (30 μL) was transferred to the wells of a 384-well non-binding microplate. The fluorescence intensity was measured using a microplate reader (SpectraMax i3x multi-functional microplate reader, Molecular Devices, USA) at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. Each sample was measured in parallel three times, and the average value was taken. The detection principle is as Figure 4 shown. Among them, F0 represents the fluorescence intensity containing APT-FAM, F1 represents the fluorescence intensity containing APT-FAM and cDNA-BHQ1, and F2 represents the fluorescence intensity of the sample containing APT-FAM, cDNA-BHQ1, and Hcy solution. The fluorescence recovery rate is expressed as F2 / F1. The quenching efficiency is calculated as (1 - F1 / F0) × 100%.

[0089] The detection results are as Figure 5 shown. As the concentration of homocysteine increases, the fluorescence intensity of the system shows regular changes. This detection method exhibits excellent sensitivity. The detection limit of the nucleic acid aptamer SEQCR13-2 of the present invention for Hcy is 10 nM. In the concentration range of 10 - 25 nM, the fluorescence intensity shows a good linear relationship with the concentration of homocysteine, and the linear regression equation is y = 16x + 6382 (R 2 = 0.9947).

[0090] (4) Selectivity of the fluorescence detection method based on nucleic acid aptamers

[0091] To confirm the selectivity of the fluorescence detection method established based on aptamer structure conversion, several other amino acids including Cys were tested, including alanine (Ala), glycine (Gly), leucine (Leu), isoleucine (Ile), methionine (Met), phenylalanine (Phe), asparagine (Asn), glutamine (Gln), threonine (Thr), glutamic acid (Glu), lysine (Lys), arginine (Arg), and histidine (His). The blank sample was a solution containing 25 nM APT-FAM and 100 nM cDNA-BHQ1. The concentration of all tested amino acids was 5 μM, and the testing method was the same as in step (3) above. AsFigure 6 As shown, obvious fluorescence intensity was observed when Hcy was present, while other amino acids did not cause obvious fluorescence intensity changes compared with the blank sample. The results showed that the signal difference between Hcy and Cys of this method was more than 4 times, and it had excellent selectivity for Hcy.

[0092] Comparative Example 1

[0093] Existing patent CN116879370A, in which the disclosed nucleic acid aptamer: 5'-SH-(CH2)6-ACCAGCACATTCGATTATACCAGCTTATTCAATTCACAGCTATGTCCTATACCAGCTTATTCAATT-3′ (SEQ ID NO.7), has a sequence similarity of 52.04% with the nucleic acid aptamer SEQCR13-2 of the present invention. The electrochemical aptamer sensor constructed by it for the detection of homocysteine has a detection limit of 0.112 μM for homocysteine and it is difficult to specifically distinguish homocysteine and cysteine.

[0094] Comparative Example 2

[0095] Existing literature Development of a DNA aptamer for direct and selective homocysteine detection in human serum, Rsc Advances, 2013, in which the disclosed nucleic acid aptamer: 5'-ATACCAGCTTATTCAATTACCAGCACATTCGATTATACCAGCTTATTCAATTCACAGCTATGTCCTATACCAGCTTATTCAATTCAAAAGTGCACGCTACTTTGCTAA-3' (SEQ ID NO.8), has a sequence similarity of 57.98% with the nucleic acid aptamer SEQCR13-2 of the present invention. Its detection limit for homocysteine is 0.5 μM, its KD value is 0.6 ± 0.3 μM, and the signal enhancement ratio of the detected Hcy to Cys is less than 4 times.

[0096] The detection effects of the nucleic acid aptamers in Comparative Documents 1 and 2 for Hcy are significantly inferior to the nucleic acid aptamer SEQCR13-2 provided by the present invention.

[0097] In summary, the nucleic acid aptamer SEQCR13-2 provided by the present invention exhibits a strong specific binding ability to Hcy. The detection method established based on this aptamer has excellent sensitivity for the detection of Hcy and can specifically distinguish Hcy from its structural analog Cys. The aptamer of the present invention can be used as a specific detection reagent for Hcy in the blood or urine of patients with hyperhomocysteinemia and can also be used for the prevention and control of cardiovascular diseases, neurological diseases, etc.

Claims

1. An aptamer that specifically binds to homocysteine, characterized in that, The nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO.

2.

2. Nucleic acid aptamer specifically binding to homocysteine, characterized in that, The nucleic acid aptamer is modified with a label at the 5'-end or 3'-end of the sequence shown in SEQ ID NO.

2.

3. The nucleic acid aptamer specifically binding to homocysteine according to claim 2, wherein, The label is a biotin label, a digoxin label, a fluorescent label, a nano-luminescent material label or an enzyme label.

4. The nucleic acid aptamer that specifically binds to homocysteine according to claim 2, wherein The nucleic acid aptamer is modified with a FAM group at the 5'-end of the sequence shown in SEQ ID NO.

2.

5. Use of the nucleic acid aptamer specifically binding to homocysteine according to any one of claims 1-4 in the preparation of a homocysteine detection tool.

6. Use of the nucleic acid aptamer specifically binding to homocysteine according to any one of claims 1-4 in the preparation of a homocysteine diagnostic reagent, test strip or biosensor.

7. Use of the nucleic acid aptamer specifically binding to homocysteine according to any one of claims 1-4 in the preparation of a tool for assisting in the diagnosis of hyperhomocysteinemia or evaluating the risk of cardiovascular diseases.

8. A homocysteine diagnostic reagent, test strip or biosensor, characterized in that, The active ingredient of the homocysteine diagnostic reagent, test strip or the biosensor comprises the nucleic acid aptamer specifically binding to homocysteine according to any one of claims 1-4.

9. A reagent for auxiliary diagnosis of hyperhomocysteinemia or evaluation of cardiovascular disease risk, characterized in that, The active ingredient of the reagent comprises the nucleic acid aptamer specifically binding to homocysteine according to any one of claims 1-4.

Images