Recombinant humanized type iv collagen m2 or m4 and methods of making and using the same
Recombinant humanized type IV collagen M2 or M4 was prepared by genetic engineering and bio-fermentation, which solved the problems of expression difficulties and immune risks in existing technologies, and achieved high expression, good water solubility, and applicability to multiple fields.
Patent Information
- Application Number
- CN202510153746.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-12
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2045-02-12
AI Technical Summary
Existing technologies are insufficient for efficiently preparing type IV collagen with high expression, good water solubility, and better activity, and also pose challenges in terms of immune risks and industrialization.
Recombinant humanized type IV collagen M2 or M4 was expressed and purified by bio-fermentation using genetic engineering technology. The expression system of Pichia pastoris was used and exogenous amino acid residues were removed by KEX2 protease cleavage, thereby improving protein purity and activity.
It achieves high expression of recombinant humanized type IV collagen, good water solubility, and no immune risk, making it suitable for wide application in food, cosmetics, and pharmaceutical products.
Smart Images

Figure CN119979549B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of genetic engineering, and particularly relates to a recombinant humanized collagen type IV M2 or M4 as well as a preparation method and application thereof. BACKGROUND
[0002] Collagen is mainly distributed in the extracellular matrix (ECM) and is the main material basis of connective tissue. So far, 28 different types of collagen have been found. The members of the collagen family have a unique heterotrimer helical structure, and are divided into fibrillar collagen and nonfibrillar collagen according to whether they can form collagen fibrils with periodic cross striations. Common fibrillar collagens include collagen types I, II, III, V and XI, and common nonfibrillar collagens include collagen types IV and X. Collagen type IV is one of the members of the collagen family and belongs to nonfibrillar collagen. It also has a unique heterotrimer helical chain structure and mainly exists in the basement membrane (BM). Collagen type IV not only plays an important role in the formation of the basement membrane skeleton, but also has functions of participating in cell adhesion, migration, growth, proliferation and differentiation and other important physiological processes.
[0003] However, the structure of natural collagen is very complex, and its water-insoluble characteristics have caused certain limitations to its research, application and production. The main collagen production methods at present include acid-base treatment of animal tissues (such as pig skin, cow skin, donkey skin and fish, etc.) and enzymatic extraction. Although these methods perform well in recovery rate, the extracted collagen is still a mixture of peptides with different lengths, and the water solubility of each peptide segment differs greatly, which makes it difficult to separate and purify the peptides alone. In addition, since the extracted collagen is mostly heterologous, it is easy to cause rejection reaction in clinical application, which limits its application in the fields of biomedical materials or drug carriers, etc. At the same time, the collagen obtained by these methods is far inferior to human natural collagen in terms of biological activity, and cannot meet the needs of the medical, food and cosmetic industries.
[0004] Compared with animal-derived collagen, human collagen has better biological efficacy, but cannot be extracted from human tissues by extraction method, and there are virus and allergy risks in using the extraction method and the post-processing process is complicated, so it has become a trend to prepare human collagen with single component and high purity. Therefore, there is an urgent need in the field to develop a type IV collagen with high expression, good water solubility and better activity. The recombinant humanized type IV collagen expressed and purified by genetic engineering technology through biological fermentation method has the advantages of single end product component, less impurities, no animal virus, no immune risk and convenient industrialization, therefore, the recombinant humanized type IV collagen prepared by genetic engineering modification of yeast strain combined with fermentation engineering is urgently needed in the market. SUMMARY
[0005] In view of the deficiencies of the prior art, the purpose of the present application is to provide a recombinant humanized type IV collagen M2 or M4 and a preparation method and application thereof, so as to realize high expression, good water solubility, better activity, no immune risk and industrialization of the type IV collagen, and provide an important foundation for its application in biology and medicine.
[0006] In order to achieve the above purpose, the present application adopts the following technical solutions:
[0007] The present application provides a recombinant humanized type IV collagen M2 or M4, the nucleic acid molecule sequence encoding the recombinant humanized type IV collagen M2 is shown as SEQ ID NO. 1, and the nucleic acid molecule sequence encoding the recombinant humanized type IV collagen M4 is shown as SEQ ID NO. 3.
[0008] Preferably, the nucleic acid molecule sequence encoding the recombinant humanized type IV collagen M4 is shown as SEQ ID NO. 3.
[0009] The present application provides a vector comprising the nucleic acid molecule of the collagen M2 or M4 as described above.
[0010] The present application provides a host cell comprising the nucleic acid molecule of the collagen M2 or M4 as described above.
[0011] Preferably, the host cell is a prokaryotic cell or a eukaryotic cell.
[0012] Preferably, the eukaryotic cell is Pichia pastoris.
[0013] The present application provides a method for preparing the recombinant humanized type IV collagen M2 or M4 as described above, comprising the following steps:
[0014] The recombinant humanized type IV collagen M2 or M4 is expressed by using the host cell as described above, and then is separated and purified to obtain.
[0015] Another aspect of the present application provides the use of the recombinant humanized type IV collagen M2 or M4 as described above in the preparation of food, cosmetic or pharmaceutical products.
[0016] Compared with the prior art, the present application has the following beneficial effects:
[0017] The recombinant humanized type IV collagen M2 or M4 provided by the present application is expressed and purified by using genetic engineering technology and biological fermentation method, has the advantages of single end product composition, less impurities, no animal virus, no immune risk and convenient industrialization, can effectively improve the cell proliferation and migration activity, and can be widely applied in the fields of food, cosmetics, health products and pharmaceutical products. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 The figure is the map of the plasmid pPIC9K-M2 and pPIC9K-M4 in the embodiment 3 of the present application;
[0019] Figure 2 The figure is the map of the plasmid pPIC9K-6XCDS-M2 and pPIC9K-6XCDS-M4 in the embodiment 3 of the present application;
[0020] Figure 3 The figure is the map of the plasmid pPICZA-CPB+KEX2 in the embodiment 4 of the present application;
[0021] Figure 4 The figure is the expression situation diagram of the M2 protein in the embodiment 5 of the present application;
[0022] Figure 5 The figure is the expression situation diagram of the M4 protein in the embodiment 5 of the present application;
[0023] Figure 6 The figure is the non-reducing SDS-PAGE protein electrophoresis and reducing SDS-PAGE protein electrophoresis diagram of the small molecule collagen M2 and M4 in the embodiment 6 of the present application;
[0024] Figure 7 The figure is the liquid chromatography and mass spectrometry molecular weight map diagram of the M2 and M4 proteins after purification in the embodiment 7 of the present application;
[0025] Figure 8 The figure is the relative cell proliferation activity diagram of the recombinant humanized type IV small molecule collagen (M2 and M4) in the embodiment 8 of the present application;
[0026] Figure 9Figure 1 shows the cell migration activity of the recombinant human-derived type IV small molecule collagen (M2 and M4) in Example 9 of the present application;
[0027] Figure 10 Figure 2 shows the cell migration activity of the recombinant human-derived type IV small molecule collagen (M2 and M4) in Example 9 of the present application. DETAILED DESCRIPTION
[0028] The present application is further described in detail by specific preferred embodiments below, but the present application is not limited to the following embodiments.
[0029] It should be noted that, unless otherwise specified, the chemical reagents involved in the present application are purchased through commercial channels.
[0030] Example 1 Sequence analysis and obtaining of candidate small molecule collagen sequences
[0031] The amino acid sequence of human type IV collagen α2 chain is derived from the National Center for Biotechnology Information, accession number KAI4063798.1
[0032] (https: / / www.ncbi.nlm.nih.gov / protein / KAI4063798.1 / ), with a full length of 1712 aa. Integrins on the cell membrane bind to integrin recognition sites in extracellular matrix components and complete information exchange between cells and cells, and between cells and the external environment. Collagen is an important component of the extracellular matrix, so the number of integrin recognition sites in the collagen sequence will affect the life activities of cells, such as proliferation activity, adhesion activity and migration activity. Accordingly, we analyzed the presence of multiple integrin sites, such as GEK, GER, etc., in the 258-346 segment of the type IV collagen α1 chain amino acid sequence, which was named M micro COL VII α1- 2 (referred to as M2). At the same time, we analyzed the presence of multiple integrin sites, such as GEK, GER, etc., in the 583-681 segment of the type IV collagen α1 chain amino acid sequence, which was named M micro COL VII α1- 4 (referred to as M4).
[0033] Example 2 Codon optimization and synthesis of M2 and M4 collagen base sequences
[0034] In order to analyze the expression of M2 and M4 collagen protein sequence fragments, we used the Pichia pastoris expression system to try. Since the base sequence encoding M2 and M4 collagen protein sequence fragments is from human, considering that the expression host is Pichia pastoris, there is a preference for codon usage between the two, therefore we use GenSmartTM Codon Optimization (Version Beta1.0) online software to optimize the base sequence of M2 collagen protein sequence fragments, so that it is more suitable for yeast expression system, the optimized sequence is SEQ ID NO.1:
[0035] GGTGAGAAAGGCCAGAAGGGAGAACCAGGTTTTCAAGGTATGCCTGGTGTAGGGGAAAAAGGTGAGCCAGGGAAGCCTGGGCCGAGAGGGAAGCCCGGGAAAGATGGGGACAAAGGAGAAAAAGGATCCCCCGGATTCCCTGGCGAGCCGGGGTACCCAGGGCTCATTGGACGGCAAGGCCCCCAGGGAGAAAAGGGAGAGGCCGGCCCTCCGGGTCCTCCGGGCATCGTCATAGGTACAGGCCCATTAGGCGAAAAGGGTGAGCGATAA.
[0036] The natural sequence is shown in SEQ ID NO.2:
[0037] GGAGAAAAGGGCCAAAAAGGTGAACCTGGATTTCAGGGGATGCCAGGGGTCGGAGAGAAAGGTGAACCCGGAAAACCAGGACCCAGAGGCAAACCCGGAAAAGATGGTGACAAAGGGGAAAAAGGGAGTCCCGGTTTTCCTGGTGAACCCGGGTACCCAGGACTCATAGGCCGCCAGGGCCCGCAGGGAGAAAAGGGTGAAGCAGGTCCTCCTGGCCCACCTGGAATTGTTATAGGCACAGGACCTTTGGGAGAAAAAGGAGAGAGG. The homology of the optimized M2 nucleotide sequence and the unoptimized M2 nucleotide sequence is 77.65%.
[0038] Then the optimized sequence was sent to Kings River Technology Company for synthesis, and the synthesized sequence was integrated into pEASYT3 vector, named pEASYT3-M2.
[0039] We used GenSmart™ Codon Optimization (Version Beta 1.0) online software to optimize the base sequence of the M4 collagen protein sequence fragment, making it more suitable for the yeast expression system. The optimized sequence is shown in SEQ ID NO. 3:
[0040] GGCGAGCGAGGGCCACCTGGCGGCGTCGGCTTCCCCGGATCACGGGGGGACACAGGTCCACCGGGTCCACCTGGGTACGGTCCGGCGGGACCCATAGGAGACAAAGGTCAAGCTGGCTTTCCTGGAGGACCCGGTTCGCCGGGCCTACCAGGCCCAAAGGGGGAACCTGGTAAGATCGTGCCGTTACCTGGCCCCCCCGGAGCCGAAGGCTTGCCTGGTAGCCCGGGGTTTCCCGGACCGCAGGGTGATAGAGGTTTCCCCGGGACTCCAGGACGTCCGGGGCTCCCAGGGGAGAAATAA.
[0041] The natural sequence is shown in SEQ ID NO. 4:
[0042] GGAGAGCGTGGCCCCCCTGGAGGAGTTGGATTCCCAGGCAGTCGTGGTGACACCGGCCCCCCTGGGCCTCCAGGATATGGTCCTGCTGGTCCCATTGGTGACAAAGGACAAGCAGGCTTTCCTGGAGGCCCTGGATCCCCAGGCCTGCCAGGTCCAAAGGGTGAACCAGGAAAAATTGTTCCTTTACCAGGCCCCCCTGGAGCAGAAGGACTGCCGGGGTCCCCAGGCTTCCCAGGTCCCCAAGGAGACCGAGGCTTTCCCGGAACCCCAGGAAGGCCAGGCCTGCCAGGAGAGAAG. The homology of the nucleotide sequence of the optimized M4 and the nucleotide sequence of the unoptimized M4 is 75.00%.
[0043] The optimized sequence was then sent to GenScript for synthesis, and the synthesized sequence was integrated into the pEASYT3 vector, named pEASYT3-M4.
[0044] Example 3 Construction of pPIC9K-M2 and pPIC9K-M4 vectors
[0045] (1) pPIC9K expression vector enzyme digestion: Extract the pPIC9K expression vector (Invitrogen, item number: V17520) plasmid and perform enzyme digestion by EcoRI (NEB, item number: R3104S) restriction enzyme, and the enzyme digestion system is as follows:
[0046] Enzyme digestion system (100 μL):
[0047]
[0048] 37°C enzyme digestion for 3 h, and the plasmid after enzyme digestion is purified by a general DNA product purification kit (DP204) and is ready for use.
[0049] (2) M2 exogenous fragment amplification: In order to ensure that the M2 protein secreted and expressed by Pichia pastoris is free of residual foreign amino acids, that is, humanized collagen protein; we use KEX2 protease in Pichia pastoris, KEX2 specifically recognizes double basic amino acid sequences such as RR, KR, and PR, so we connect the first amino acid of M2 to the back of the KEX2 protease recognition site KR, so that Pichia pastoris will cut at the C-terminal of KR when secreting and expressing the recombinant protein, so that the secreted and expressed M2 is free of residual foreign amino acids. In order to achieve this purpose, we design M2-L:
[0050] GTATCTCTCGAGAAAAGAGGTGAGAAAGGCCAGAAGGG and M2-R: GCGGCCGCCCTAGGGAATTCTTATCGCTCACCCTTTTCGCC primers. M4 exogenous fragment amplification: In order to ensure that the M4 protein secreted and expressed by Pichia pastoris is free of residual foreign amino acids, that is, humanized collagen protein; we use KEX2 protease in Pichia pastoris, KEX2 specifically recognizes double basic amino acid sequences such as RR, KR, and PR, so we connect the first amino acid of M4 to the back of the KEX2 protease recognition site KR, so that Pichia pastoris will cut at the C-terminal of KR when secreting and expressing the recombinant protein, so that the secreted and expressed M4 is free of residual foreign amino acids. In order to achieve this purpose, we design M4-L: GTATCTCTCGAGAAAAGAGGCGAGCGAGGGCCACCT and M4-R: GCGGCCGCCCTAGGGAATTCTTATTTCTCCCCTGGGAGCCC primers. The DNA sequences of M2 and M4 are amplified by TaKaRa R45Q DNA polymerase, and the PCR system is as follows:
[0051]
[0052] PCR program:
[0053] 98°C 10 sec
[0054] 55°C 5 sec
[0055] 72°C 30 sec
[0056] PCR program 28 cycles of amplification.
[0057] The target band was detected by agarose gel electrophoresis and then purified using a DNA gel recovery kit (DP204) for use.
[0058] (3) Ligation and positive clone verification: The pPIC9K linearized vector and M2 / M4 PCR exogenous from (1) and (2) were ligated using a TSINGKE TSV-S3 Seamless Cloning Kit, and the ligation system was as follows: Seamless Cloning Kit, and the ligation system was as follows:
[0059] Ligation system (10 μL):
[0060] pPIC9K (EcoRI) 2.5 μL
[0061] M2 / M4 PCR exogenous 2.5 μL
[0062] 2x Seamless Cloning Mix 5 μL
[0063] 50°C for 45 min, the ligation product was transformed into DH5a E. coli (purchased from Jinsha Biological), and cultured overnight at 37°C. The next day, single colonies were picked, expanded, and plasmids were extracted, verified by enzyme digestion, and sequenced to confirm the correct insertion position and sequence. The plasmid with correct sequencing was named pPIC9K-M2 and pPIC9K-M4. The plasmid map is shown in Figure 1 .
[0064] M2 multi-copy exogenous fragment amplification: To improve the expression of M2 protein in Pichia pastoris, 5 copies of CDS were inserted after the original CDS sequence in pPIC9K-M2, and amino acid sequences KREAEA were used to connect between each CDS. In order to avoid misconnection, according to the degeneracy of codons, 5 different KREAEA base sequences were selected for insertion, which were: Aaacgagaggctgaagcc, Aaacgagaagcggaggcc, Aagagggaagcagaggcc, Aagcgtgaagcagaggct, Aaaagagaggcggaagcc. The primers were designed as follows:
[0065] 2x M2-L:
[0066] GGCGAAAAGGGTGAGCGAAAACGAGAGGCTGAAGCCGGTGAGAAAGGCCAGAAGGG;
[0067] 2xM2-R: GGCGAAAAGGGTGAGCGAAAACGAGAGGCTGAAGCCGGTGAGAAAGGCCAGAAGGG;
[0068] 3xM2-L: AAACGAGAAGCGGAGGCCGGTGAGAAAGGCCAGAAGGG;
[0069] 3xM2-R: GGCGAAAAGGGTGAGCGAAAACGAGAGGCTGAAGCCGGTGAGAAAGGCCAGAAGGG;
[0070] 4xM2-L: AAGAGGGAAGCAGAGGCCGGTGAGAAAGGCCAGAAGGG;
[0071] 4xM2-R: GGCGAAAAGGGTGAGCGAAAACGAGAGGCTGAAGCCGGTGAGAAAGGCCAGAAGGG;
[0072] 5xM2-L: AAGCGTGAAGCAGAGGCTGGTGAGAAAGGCCAGAAGGG;
[0073] 5xM2-R: GGCGAAAAGGGTGAGCGAAAACGAGAGGCTGAAGCCGGTGAGAAAGGCCAGAAGGG;
[0074] 6xM2-L: AAAAGAGAGGCGGAAGCCGGTGAGAAAGGCCAGAAGGG;
[0075] 6xM2-R: GGCGAAAAGGGTGAGCGAAAACGAGAGGCTGAAGCCGGTGAGAAAGGCCAGAAGGG.
[0076] M4 multi-copy exogenous fragment amplification: In order to improve the expression amount of M4 protein in Pichia pastoris, 5 copies of CDS were inserted after the original CDS sequence in pPIC9K-M4, and amino acid sequences KREAEA were used to connect each CDS. In order to avoid misconnection, according to the degeneracy of codons, 5 different KREAEA base sequences were selected for insertion, which are: Aaacgagaggctgaagcc, Aaacgagaagcggaggcc, Aagagggaagcagaggcc, Aagcgtgaagcagaggct, Aaaagagaggcggaagcc. Thus, the primers were designed:
[0077] 2xM4-L: GGGCTCCCAGGGGAGAAAAAACGAGAGGCTGAAGCCGGCGAGCGAGGGCC;
[0078] 2xM4-R: GGCCTCCGCTTCTCGTTTTTTCTCCCCTGGGAGCCC;
[0079] 3xM4-L: AAACGAGAAGCGGAGGCCGGCGAGCGAGGGCC;
[0080] 3xM4-R: GGCCTCTGCTTCCCTCTTTTTCTCCCCTGGGAGCCC;
[0081] 4xM4-L: AAGAGGGAAGCAGAGGCCGGCGAGCGAGGGCC;
[0082] 4xM4-R: AGCCTCTGCTTCACGCTTTTTCTCCCCTGGGAGCCC;
[0083] 5xM4-L: AAGCGTGAAGCAGAGGCTGGCGAGCGAGGGCC;
[0084] 5xM4-R: GGCTTCCGCCTCTCTTTTTTTCTCCCCTGGGAGCCC;
[0085] 6xM4-L: AAAAGAGAGGCGGAAGCCGGCGAGCGAGGGCC;
[0086] 6xM4-R: TAATTCGCGGCCGCCCTAGGGAATTCTTATTTCTCCCCTGGGAGCCC.
[0087] The TaKaRa R45Q DNA polymerase was used to amplify the DNA sequences of 5 M2 by PCR, and the PCR system was as follows:
[0088]
[0089] The PCR program was as follows:
[0090] 98℃ 10sec
[0091] 55℃ 5sec
[0092] 72℃ 30sec
[0093] The PCR program was amplified for 28 cycles.
[0094] The target bands were detected by agarose gel electrophoresis, and then the five amplified fragments were mixed and purified by a common DNA product purification kit (DP204) for use.
[0095] The linearized vector pPIC9K-M2 and the five copies of M2 PCR exogenous were connected by TSINGKE TSV-S3 PCR Cloning Kit. The connection system was as follows:
[0096] Connection system (10 μL):
[0097] pPIC9K-M2 (EcoRI) / pPIC9K-M4 (EcoRI) 2.5 μL
[0098] M2 PCR exogenous / M4 PCR exogenous 2.5 μL
[0099] 2x Seamless Cloning Mix 5 μL
[0100] 50°C for 45 min, and the connection product was transformed into DH5α E. coli (purchased from Jinsha Biological) and cultured at 37°C overnight. The next day, single colonies were picked, expanded, and plasmids were extracted. The plasmids were verified by enzyme digestion and sequenced to confirm the correct insertion position and sequence. The plasmids with correct sequencing were named pPIC9K-6XCDS-M2 and pPIC9K-6XCDS-M4. The plasmid map is shown in Figure 2
[0101] Example 4 Preparation of yeast strain GS115 competence and electroporation
[0102] (1) Preparation of yeast strain GS115 competence: pick a single colony of GS115 yeast and inoculate into a 50 mL conical flask containing 5 mL YPD medium (yeast extract 10 g / L; peptone 20 g / L; glucose 20 g / L) (purchased from Thermo Fisher), 30°C, 250 rpm culture overnight; on the second day, inoculate the overnight culture into a 200 mL conical flask containing 50 mL YPD medium at a ratio of 1:100, 30°C, 250 rpm culture overnight. On the third day, centrifuge the overnight culture at 4°C, 5000 rpm for 5 min, resuspend the pellet with 50 mL of ice-precooled sterile water, centrifuge at 4°C, 5000 rpm for 5 min, discard the supernatant; then resuspend the pellet with 50 mL of ice-precooled sterile water, centrifuge at 4°C, 5000 rpm for 5 min, discard the supernatant; resuspend the pellet with 25 mL of ice-precooled 1M sorbitol solution, centrifuge at 4°C, 5000 rpm for 5 min, discard the supernatant; resuspend the pellet with 1 mL of ice-precooled 1M sorbitol solution, aliquot 80 μL / tube, and store on ice for use. The remaining competent cells are stored in a -80°C ultra-low temperature refrigerator.
[0103] (2) Electroporation: Take 10 μg of Sall (NEB Company, Catalog No: R0138S) restriction endonuclease (enzyme system: buffer 20 μL, enzyme 5 μL, plasmid 20 μg) linearized pPIC9K-M2 and pPIC9K-M4 plasmids into 80 μL of GS115 competent cells, mix well, and transfer to a 0.2 cm ice-precooled electroporation cup, and ice-bath the electroporation cup for 5 min. Use the Gene PulserXcell TM electroporation system (BIO-RAD Company) with voltage 1.5 kV; capacitance 25 μF; resistance 200 Ω; pulse time 4-10 msec; after the pulse, immediately add 1 mL of 1M pre-cooled sorbitol solution, mix well, transfer to a 1.5 mL EP tube, and incubate at 30°C, 250 rpm for 1-2 h.
[0104] (3) Positive transformant screening: the cultured bacteria liquid was spread on the yeast histidine-deficient medium plate (SD-HIS 8 g / L; glucose 20 g / L; agar 20 g / L, pH 6.0) (purchased from China Pharmaceutical Group), and the plate was inverted and cultured in a 30°C incubator. Generally, single colonies were grown after 4-5 days, and G418 (BBI, JC26BA0002) gradient concentration screening was carried out, and a sterile pipette tip was used to pick single colonies from the SD-HIS plate and streaked on a YPD plate (yeast extract 10 g / L; peptone 20 g / L; glucose 20 g / L; agar 20 g / L; 1 mg / mL G418) containing 1 mg / mL G418 (purchased from China Pharmaceutical Group) and cultured in a 30°C incubator until single colonies were grown, and then a sterile pipette tip was used to pick single colonies from the 1 mg / mL G418 plate and streaked on a YPD plate containing 5 mg / mL G418 and cultured. In this way, a 10 mg / mL G418 concentration gradient screening was continued.
[0105] Example 4 Construction of yeast chassis strain
[0106] (1) pPICZA expression vector digestion: the pPICZA plasmid was extracted and digested with EcoRI+XhoI (NEB Company, item number: R0146S) restriction endonuclease, and the enzyme digestion system was as follows:
[0107] Enzyme digestion system (100 μL):
[0108]
[0109] 37°C enzyme digestion for 3 h, and the digested plasmid was purified using a general DNA product purification kit (DP204) for use.
[0110] (2) Chassis strain exogenous fragment amplification: to avoid the possibility of incomplete enzyme digestion forming protein multimers when expressing the target protein, CPB and KEX2 exogenous sequences were inserted into the chassis strain, and the two sequences were connected in series with a P2A linker peptide to construct pPICZA-SP+CPB+P2A+KEX2, and the protein multimers were subjected to secondary cleavage by expressing CPB and KEX2 proteases. The primers were designed as follows:
[0111] GZ-1F: ACTAATTATTCGAAACGAGGAATTCATGTACCTTCCTGCACTAAGGC;
[0112] GZ-1R: AGAGAAGTTTGTTGCCAAGGCAGCACGTTTAGGGTGC;
[0113] GZ-2F:AAACGTGCTGCCTTGGCAACAAACTTCTCTCTGCTGA;
[0114] GZ-2R: GGCCGGAAGATACATCGGTCCAGGATTCTCTTCGACA;
[0115] GZ-3F: GAGAATCCTGGACCGATGTATCTTCCGGCCCTACGTT;
[0116] GZ-3R: CAAGCTGGCGGCCGCCGCGGCTCGAGTCAAAGCGCAGCCCGTTTCGGA. Using TaKaRa R45Q DNA polymerase, three DNA sequence fragments, SP+CPB, P2A, and KEX2, were amplified by PCR. The PCR system is as follows:
[0117]
[0118] The PCR procedure is as follows:
[0119] 98℃ 10sec
[0120] 55℃ 5sec
[0121] 72℃ 3min / 30sec
[0122] The PCR program was used for 28 cycles of amplification.
[0123] Purification was performed using a purification kit (DP204), and the product is ready for use.
[0124] (3) Ligation and positive clones: The pPICZA linearized vectors from 5.1 and 5.2, and the exogenous PCR material were respectively ligated using TSINGKE TSV-S3. The Seamless Cloning Kit is used for connection, and the connection system is as follows:
[0125] Connection system (10 μL):
[0126]
[0127] The reaction was carried out at 50℃ for 45 min. The ligation product was then transformed into DH5α *E. coli* (purchased from Jinsha Biotechnology) and cultured overnight at 37℃. Single colonies were picked the next day, amplified, and plasmids were extracted. Enzyme digestion was used for verification, and the plasmids were sequenced to confirm the correct insertion position and sequence. The correctly sequenced plasmid was named pPICZA-CPB+KEX2. The plasmid map is shown below. Figure 3 As shown.
[0128] Preparation of the chassis strain and electroporation
[0129] (1) Electroporation: 10 μg of Sac I (NEB, Cat No. R3156S) linearized pPICZA-CPB+KEX2 plasmid was added to 80 μL of Pichia pastoris GS115 competent cells, mixed well and then electroporated according to (5.2).
[0130] (2) Positive transformant screening: the cultured bacteria liquid after electroporation was spread on YPD plates (Yeast extract 10 g / L; Peptone 20 g / L; Glucose 20 g / L; Agar 20 g / L; 300 μg / mL Zeo) containing 300 μg / mL Zeo (Invitiogen, Cat No. R25001) and incubated in a 30°C incubator. Single colonies were generally grown after 4-5 days, and Zeo gradient concentration screening was carried out. Single colonies were picked up from the YPD plate containing 300 μg / mL Zeo with a sterile pipette tip and streaked on a YPD plate containing 1 mg / mL Zeo, and incubated in a 30°C incubator until single colonies were grown. Then single colonies were picked up from the 1 mg / mL Zeo plate with a sterile pipette tip and streaked on a YPD plate containing 2 mg / mL Zeo and incubated.
[0131] (3) Preparation of the chassis strain: fast-growing pPICZA-CPB+KEX2 colonies were picked up from the YPD plate containing 2 mg / mL Zeo, and the chassis strain was prepared and named GZ, which was divided into 80 μL per tube and stored on ice for use. The remaining competent cells were stored in a -80°C ultra-low temperature freezer.
[0132] (4) Electroporation: 10 μg of Sal I linearized pPIC9K-6XCDS-M2 plasmid and pPIC9K-6XCDS-M4 plasmid were added to 80 μL of chassis strain GZ competent cells, and electroporation was carried out.
[0133] (5) Positive transformant screening: the cultured bacteria liquid after electroporation was spread on yeast histidine-deficient medium plates, and the plates were incubated in a 30°C incubator. After the colonies were grown, G418 gradient concentration screening was carried out.
[0134] Example 6 Induction of expression and screening of high expression strains
[0135] (1) Induction of expression: fast-growing M2 colonies were picked from YPD plates containing 10 mg / mL G418: pPIC9K-M2 (GS115), pPIC9K-6XCDS-M2 (GS115), pPIC9K-6XCDS-M2 (GZ) colonies and M4 colonies: pPIC9K-M4 (GS115), pPIC9K-6XCDS-M4 (GS115), pPIC9K-6XCDS-M4 (GZ) colonies. Inoculated into 10 mL sterile centrifuge tubes containing 2 mL YPD medium, 30°C, 250 rpm overnight culture. The overnight culture was inoculated into 100 mL shake flasks containing 20 mL BMGY medium at a 1:100 inoculation ratio, 30°C, 250 rpm overnight culture. The remaining portion of the YPD overnight culture was glycerol-preserved and stored in a -80°C refrigerator. The overnight culture was transferred to a 50 mL sterile centrifuge tube, centrifuged at 8000 rpm for 5 min at room temperature, and the cells were resuspended in BMMY medium to a 150 mL shake flask, with a final OD value of about 2.0, and a final volume of 20 mL. Induction of expression was started at 30°C, 250 rpm, sampling every 24 h, and 1% volume of methanol was added daily to continue induction.
[0136] (2) SDS-PAGE detection: yeast co-induction expression for 10 days, 12000 rpm centrifugation for 5 min after sampling every day, 40 μL supernatant was taken, 10 μL 5x reduced protein loading buffer (Biosharp, Catalog No: BL502A) was added, mixed, placed in a metal bath at 95°C for 5 min for heat denaturation, 20 μL denatured sample was added to a 15% SDS-PAGE protein gel well (Kingsway Biological, Catalog No: M00930), electrophoresis at 160V for 1 h, then staining and destaining with a destainer (Kingsway Biological, Catalog No: M00930), and taking a picture on a white light plate.
[0137] According to the induction expression results Figure 4 , it was found that the pPIC9K-1XCDS-M2 strain could express small molecular collagen, but the protein expression amount was low, and after increasing the M2 copy number, the expression amount of pPIC9K-6XCDS-M2 was significantly improved. In the GS115 competent, the protein multimers expressed by pPIC9K-6XCDS-M2 were not completely cut into short peptides, while in the 6 clones picked from the GZ competent, the proteins of Nos. ③, ④, ⑤, and ⑥ were almost completely cut into short peptides, showing obvious single bands, and the expression amount of the protein of No. ⑤ seemed to be the highest. Therefore, pPIC9K-6XCDS-M2 ⑤ (GZ) was determined as the engineering strain for subsequent fermentation condition optimization.
[0138] According to the induction expression results Figure 5, it was found that pPIC9K-1XCDS-M4 strain could express small molecule collagen, but the protein expression level was low. After increasing the copy number of M4, the expression level of pPIC9K-6XCDS-M4 was significantly improved. In GS115 competent cells, the protein multimers expressed by pPIC9K-6XCDS-M4 were not completely cut into short peptides, while in GZ competent cells, the proteins of ③, ④, ⑤ and ⑥ out of 6 clones were almost completely cut into short peptides, showing obvious single bands, and the expression level of ④ seemed to be the highest. Therefore, pPIC9K-6XCDS-M4 ④ (GZ) was selected as the engineering strain for subsequent fermentation condition optimization.
[0139] Example 6 Yeast strain fermentation, purification and thermal stability study
[0140] The fermentation process was carried out by inoculating yeast strain M2 and yeast strain M4 at a rate of 1% into a tank, adding YP solution (yeast extract powder 10 g / L, tryptone 20 g / L), and adding at a rate of 10 mL / L / day. The induction was started at 48 h and ended at 110 h.
[0141] The harvested yeast fermentation broth was first filtered and clarified using 0.1 μm hollow fiber (purchased from Hangzhou Kebaiter Filter Material Co., Ltd.) to collect the clarified filtrate. The clarified filtrate was diluted with purified water to a conductivity of 4.0-6.0 mS / cm and adjusted to pH 4.0 as the cation exchange chromatography sample. The cation exchange column (BXK26 / 20) was first equilibrated with cation buffer A (Borgolon SP Bestarose FF) ≥5 CV (column volume) until the UV210 absorbance and conductivity remained unchanged, then the sample was loaded, after the loading was completed, the column was washed with cation buffer A (20 mM sodium acetate, pH 4.0) ≥5 CV until the UV210 absorbance and conductivity remained unchanged, then eluted with 20% cation buffer B (20 mM sodium acetate, 1 M NaCl, pH 4.0), when the UV210 absorbance increased, the sample collection was started, and when the UV210 absorbance decreased to the lowest and remained unchanged, the sample collection was stopped. The cation exchange elution collection was dialyzed with anion buffer, and then used as the anion exchange chromatography sample. First, the anion exchange column (Borgolon Q Bestarose FF) was equilibrated with anion buffer ≥5 CV (column volume) until the UV210 absorbance and conductivity remained unchanged, then the sample was loaded, when the UV210 absorbance increased, the sample collection was started, after the loading was completed, the column was washed with anion buffer C (20 mM PB, 40 mM NaCl, pH 7.4) until the UV210 absorbance decreased to the lowest and remained unchanged, then the sample collection was stopped. The purified small molecule collagens M2 and M4 were subjected to non-reducing SDS-PAGE protein electrophoresis and reducing SDS-PAGE protein electrophoresis, and the results are shown in FIG. 6.Figure 6 As shown, the purity is ≥95%.
[0142] Example 7: Study on the quality of small molecule collagen protein
[0143] The purity and molecular weight of purified M2 and M4 proteins were studied using high-performance liquid chromatography-mass spectrometry (HPLC-MS). The chromatographic column used was an ACQUITY UPLC Peptide BEH C18 300A, 1.7 μm, 2.1 × 150 mm. The mobile phase was: MPA: 0.1% FA (formic acid), 2% ACN (acetonitrile), 98% H2O; MPB: 0.1% FA (formic acid), 98% ACN (acetonitrile), 2% H2O. The injection volume was 4 μg, the detection wavelength was UV 240 nm, and the column temperature was 40 °C. The chromatographic gradient conditions are shown in Table 1 below.
[0144] Table 1 Chromatographic gradient conditions
[0145]
[0146] After mass spectrometry ( Figure 7 The molecular weight of M2 was determined to be 5.6 kDa, consistent with the theoretical molecular weight. The molecular weight of M4 was also determined to be 9.1 kDa, consistent with the theoretical molecular weight.
[0147] Example 8: Cell Proliferation Activity Detection
[0148] NIH-3T3 cells in good growth condition with a confluence of 80%-90% were digested and counted. The digested NIH-3T3 cells were then diluted with complete medium containing 10% FBS at a concentration of 3 × 10⁻⁶ cells / mL. 4 cells / cm 2 Plate the cells in 96-well plates and incubate them in a CO2 incubator at 37°C and 5% CO2 concentration. After the NIH-3T3 cells have adhered, remove the liquid from the wells, wash once with 200 μL of DMEM basal medium, discard the washing solution, and then add the corresponding sample.
[0149] Under aseptic conditions, recombinant human type IV small molecule collagen samples M2 and M4 were weighed according to the specified proportions and diluted to 1 mg / mL with DMEM basal medium containing 1% FBS. 200 μL of the 1 mg / mL recombinant human type IV small molecule collagen solution was added to each well of the experimental group, 200 μL of DMEM basal medium containing 1% FBS was added to each well of the negative control group, and 200 μL of DMEM complete medium containing 10% FBS was added to each well of the positive control group. Each group was repeated in 5 replicates. The samples were incubated in a CO2 incubator at 37°C with a CO2 concentration of 5%.
[0150] After 48 hours of culture, the supernatant of the 96-well plate was removed, and 110 μL of CCK8 reagent (prepared by mixing CCK8 reagent and DMEM base medium at a ratio of 1:10) was added to increase the blank control group of CCK8 detection (containing only CCK8 reagent and DMEM base medium, without cells). The 96-well plate was incubated in a 37°C, 5% CO2 incubator for 1.5 hours, and the absorbance of each well was detected at a wavelength of 450 nm using a multifunctional enzyme label instrument. The cell proliferation levels of each group were statistically analyzed. The more the cell proliferation, the greater the absorbance OD value. The relative cell proliferation activity results are shown in Table 2 below.
[0151] Relative cell proliferation activity calculation formula:
[0152] Relative cell proliferation activity = [(OD 样品组 - OD 空白组 ) / (OD 阴性对照组 - OD 空白组 )] x 100%Table 2 Relative cell proliferation activity results
[0153]
[0154] The activity and proliferation rate of fibroblasts determine the tightness of the skin and thus affect the state of the skin. A decrease in the activity and number of fibroblasts will lead to skin aging. Therefore, the effect of a sample on the proliferation of fibroblasts can be tested to evaluate the tightening efficacy of the sample. The faster the proliferation rate, the better the biological activity of collagen. As shown in Table 2, recombinant human type IV small molecule collagen M2 and M4 have significant differences compared with the negative control, indicating that recombinant human type IV small molecule collagen M2 and M4 both have the effect of promoting cell proliferation. Figure 8
[0155] Example 9 Cell migration activity detection
[0156] Experimental preparation: First, use a marker pen to evenly draw four horizontal lines on the back of a 6-well plate with a ruler, about 0.5 cm apart. Well-grown NIH-3T3 cells with a confluence of 80%-90% were counted and diluted with 10% FBS-containing DMEM complete medium to 9 x 10 4 cells / cm 2 Poured into a 6-well plate and placed in a carbon dioxide incubator at a temperature of 37°C and a carbon dioxide concentration of 5% for culture.
[0157] Under sterile conditions, take the recombinant human type IV small molecule collagen M2 and M4 samples, and dilute to 1 mg / mL with DMEM basic medium after weighing according to the proportion. After 24±2 hours of culture in a 6-well plate, use the gun head to draw a line perpendicular to the back horizontal line as much as possible, and the gun head should be vertical and cannot be inclined. Then rinse the cells with DMEM basic medium twice to remove the scratched cells. Add 2 mL of recombinant human type IV small molecule collagen solution diluted to 1 mg / mL to the experimental group, add 2 mL of DMEM basic medium to the negative control group, and add 2 mL of 10% FBS DMEM complete medium to each well of the positive control group. Each group is repeated in two duplicate wells, and is placed in a carbon dioxide incubator for culture at a temperature of 37°C and a carbon dioxide concentration of 5%. After 0h and 24h of culture, take samples and take photos. Calculate the scratch area of each picture using ImageJ image processing software, and the cell migration rate results are shown in Table 3 below.
[0158] Cell migration rate calculation formula:
[0159] Cell migration rate = [(0h migration area-24h migration area) / 0h migration area] x 100%
[0160] Table 3 cell migration rate results
[0161]
[0162] The fibroblast cell migration experiment in vitro simulates the process of cell migration in vivo to some extent, and directly reflects the interaction between cells and extracellular matrix and between cells under the influence of the matrix. Cell migration activity is a more effective indicator of the biological activity of collagen. The higher the migration rate, the faster the speed, and the better the biological activity of collagen. As shown in Table 3, the recombinant human type IV small molecule collagen (M2 and M4) has a significant difference compared with the negative control, Figure 9 As shown in Table 3, the actual comparison of cell migration photographed at 0h and 24h shows that the recombinant human type IV small molecule collagen (M2 and M4) has the effect of promoting cell migration. Figure 10
[0163] Finally, it should be noted that the above examples do not limit the present application in any form. For those skilled in the art, some modifications and improvements can be made on the basis of the present application. Therefore, any modification or improvement made without departing from the spirit of the present application shall fall within the scope of the present application.
Claims
1. A recombinant humanized collagen type IV M2 or M4, characterized in that, The nucleic acid sequence encoding the recombinant humanized collagen type IV M2 is shown as SEQ ID NO. 1, and the nucleic acid sequence encoding the recombinant humanized collagen type IV M4 is shown as SEQ ID NO.
3.
2. A vector, characterized in that, The vector comprises the nucleic acid molecule of collagen M2 or M4 according to claim 1.
3. A host cell, characterized in that, The host cell comprises the nucleic acid molecule of collagen M2 or M4 according to claim 1.
4. The host cell of claim 3, wherein, The host cell is a prokaryotic cell or a eukaryotic cell.
5. The host cell of claim 4, wherein, The eukaryotic cell is Pichia pastoris.
6. A method of preparing the recombinant humanized collagen type IV M2 or M4 according to claim 1, characterized in that, The method comprises the following steps: The recombinant humanized collagen type IV M2 or M4 is expressed by using the host cell according to any one of claims 3-5, and then separated and purified.
7. Use of the recombinant humanized collagen type IV M2 or M4 according to claim 1 in the preparation of food, cosmetic or pharmaceutical products.
Citation Information
Patent Citations
Recombinant human IV type collagen and preparation method thereof
CN117801095A
Humanized IV type collagen, expression vector, preparation method and application
CN118852407A