Application of BpSPL2 gene in regulating early flowering ability of plants

Abstract

This invention provides the application of the BpSPL2 gene in regulating the ability of plants to flower earlier, belonging to the field of genetic engineering technology. The nucleotide sequence of the BpSPL2 gene is shown in SEQ ID NO.1; the application involves inhibiting the BpSPL2 gene in plants to enhance their ability to flower earlier. This invention discovers that the BpSPL2 gene negatively regulates the germination of birch buds, and that inhibiting BpSPL2 gene expression can significantly improve the ability of birch to flower earlier. This invention is beneficial for shortening the time required for cultivating superior birch varieties, enabling birch plants to flower earlier, and providing a theoretical basis for the research of birch germplasm resources.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more particularly to... BpSPL2 Application of genes in regulating the ability of plants to flower earlier. Background Technology

[0002] SPL (Squamosa promoter-binding protein-like) is a class of plant-specific transcription factors found in all green plants, including single-celled green algae, mosses, gymnosperms, and angiosperms. SPL transcription factors were first discovered by Huijser et al. from snapdragons (…). Antirrhinum majus It was cloned from [a source], and at that time two closely related [sources] were discovered. AmSBP1 and AmSBP2 These genes, which can bind to the promoter of the floral meristem characteristic gene SQUAMOSA (SQUA), were named Squamosa promoter binding protein (SBP). Subsequently, cDNA cloning of the SBP transcription factor family was performed in Arabidopsis and mosses, revealing multiple copies of SBP transcription factor genes in both plants. In recent years, similar genes have also been found in birch, maize, tomato, and strawberry.

[0003] Studies have shown that SPL (Solar Plug) participates in regulating several important biological processes, such as developmental stage transitions, leaf growth, plant height and tillering, plant stress responses, and copper ion homeostasis, among other developmental and physiological biochemical processes. Current technology indicates that Arabidopsis thaliana... AtSPL9 and AtSPL10 Adjustable miR172 Expression, then miR172 target genes — TOE1 / 2 Gene suppression promotes the transition from juvenile to adulthood; Arabidopsis thaliana spl8 mutants have smaller anthers and reduced fertility; rice OsSPL14 and OsSPL16 It plays a decisive role in regulating the size, shape, and color of rice grains; Arabidopsis thaliana SPL8 It plays a local regulatory role in GA-dependent development, and overexpression AtSPL8 The transgenic plants exhibit altered GA responses, resulting in anther dehiscence and reduced fertility; overexpression AtSPL8 The gene was not sensitive to GA treatment; for example, GA treatment reduced seed germination rate and inhibited root elongation in seedlings. In the presence of insufficient copper, AtSPL7 Genes play a positive role in maintaining copper homeostasis in plants.

[0004] Birch ( Betula platyphyllaBirch, with its characteristics of rapid renewal, fast growth, strong adaptability, wide distribution, fine texture, and pure white color, is one of the preferred tree species for cultivating veneer-type engineered wood products and fast-growing, high-yield forests. However, due to long-term exploitative management, the germplasm resources of birch in its natural state have severely degraded, failing to meet the demand for superior birch varieties. Therefore, how to cultivate superior birch varieties in a relatively short period of time is a problem that urgently needs to be solved by those skilled in the art. In view of this, the purpose of this invention is to provide... BpSPL2 The application of genes in regulating the ability of plants to flower earlier provides a theoretical basis for the breeding of superior birch varieties. Summary of the Invention

[0005] The purpose of this invention is to provide BpSPL2 The application of genes in regulating the ability of plants to flower earlier provides a theoretical basis for shortening the plant growth cycle and cultivating superior plant varieties.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides BpSPL2 The application of genes in regulating the ability of plants to flower earlier, the aforementioned BpSPL2 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0008]

[0009] Preferably, the plant includes birch.

[0010] Preferably, the application is to inhibit in plants BpSPL2 Genes to enhance a plant's ability to flower earlier.

[0011] The present invention also provides a method for enhancing the ability of plants to flower earlier, comprising the following steps:

[0012] (1) Construct the aforementioned BpSPL2 Gene repression expression vectors were used and transferred into Agrobacterium to obtain engineered bacteria;

[0013] (2) After the engineered bacteria obtained in step (1) infect the plant tissue, plant tissue culture is carried out to obtain transgenic plants with the ability to flower earlier.

[0014] Preferably, the BpSPL2 The method for constructing the gene repressor expression vector is as follows: amplification using primers BpSPL2F and BpSPL2-SRDXR. BpSPL2 Genes containing restriction enzyme sites were obtained. BpSPL2 -SRDX target fusion segment; will BpSPL2 -SRDX target fusion fragment is ligated with plasmid vector to obtain BpSPL2 Gene repression vectors.

[0015] Preferably, the nucleotide sequence of BpSPL2F is shown in SEQ ID NO.3, and the nucleotide sequence of BpSPL2-SRDXR is shown in SEQ ID NO.4.

[0016] SEQ ID NO.3: CGGGATCCATGGAGTCTTGGAGTTGCAG

[0017] SEQ ID NO.4: GGGGTACCTCAAGCGAAACCCAAACGGAGTTCTAGATCCAGATCCAGCACACCTTGTTGGTTGCAC

[0018] Preferably, the restriction enzyme sites are BamHI and KpnI restriction enzyme sites, and the plasmid vector is pROKⅡ.

[0019] Preferably, the infected part includes plant leaves.

[0020] This invention discovers BpSPL2 Genes negatively regulate the germination of birch buds by inhibiting... BpSPL2Gene expression can significantly enhance the ability of birch to flower earlier. This invention helps to shorten the time for cultivating superior birch varieties, enabling birch plants to flower earlier, and provides a theoretical basis for the research of birch germplasm resources. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0022] Figure 1 The growth of different plants in Example 2 is shown. Detailed Implementation

[0023] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0024] Example 1

[0025] BpSPL2 gene repression expression vector pROKII- BpSPL2 - SRDX construction:

[0026] As shown in SEQ ID NO.1 BpSPL2 The 1563bp sequence of the gene after removing the stop codon TGA was transformed into the pMD18-T plasmid to contain... BpSPL2 Using the pMD18-T plasmid of the gene as a template, and BpSPL2F (SEQ ID NO.3) and BpSPL2-SRDXR (SEQ ID NO.4) as primers, PCR amplification was performed to obtain the gene containing... Bam HI and Kpn I restriction site BpSPL2 -SRDX target fusion fragment. PCR bands were detected by 1% agarose gel electrophoresis to obtain... BpSPL2 -SRDX target fragment. The PCR amplification reaction system consisted of: 30.75 μL sterile water, 5 μL Taq Buffer, 3 μL MgCl2, 4 μL dNTPs, 2 μL each of primers F and R, 2 μL template, and 1.25 μL Taq enzyme. The reaction program was: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 2 min, and 72℃ extension for 7 min, for a total of 35 cycles.

[0027] Using a gel recovery kit for BpSPL2- The SRDX target band was purified and recovered, and the purified product was double-digested according to the restriction endonuclease instructions. Bam HI and Kpn I enzyme). Simultaneously, pROKⅡ plasmid was extracted using a plasmid extraction kit and subjected to double enzyme digestion (I enzyme). Bam HI and Kpn I enzyme), the enzyme digestion products were separated, detected and purified by 1% agarose gel electrophoresis.

[0028] Purified and recovered BpSPL2 The SRDX gene sequence and the pROKⅡ vector digestion product were ligated according to the T4 DNA ligase digestion system (10×T4 DNA ligase buffer 1.0 μL, T4 DNA ligase 1.0 μL, target fragment:vector (molar mass) = 3:1, ddH2O added to 10 μL). The reaction was carried out overnight at 4°C. The ligation product was then transformed into competent E. coli cells, single clones were picked and subjected to colony PCR to obtain positive single clones of pROKⅡ- BpSPL2 Plasmids were extracted from SRDX.

[0029] Example 2

[0030] pROKⅡ- BpSPL2 -SRDX and pGWB5- BpSPL2 Obtaining -GFP transgenic birch

[0031] pROKⅡ- prepared in Example 1 BpSPL2 The SRDX inhibitory expression vector plasmid was transformed into EHA105 Agrobacterium competent cells using liquid nitrogen. The specific steps are as follows:

[0032] Remove the competent Agrobacterium EHA105 strain and thaw it on ice. Add 2 μL of pROKⅡ- to 20 μL of the competent strain. BpSPL2 The SRDX plasmid was gently mixed with a pipette tip and incubated on ice for 10 min; then flash-frozen in liquid nitrogen for 5 min, immediately placed in a 37°C water bath for 5 min, and then incubated on ice for another 4 min. 800 μL of antibiotic-free LB liquid culture medium was added to a centrifuge tube and incubated at 28°C (180 rpm) with shaking for 2 h. After removing the centrifuge tube from the shaker, it was centrifuged at 5000 rpm for 5 min, and 100 mL of supernatant was gently mixed by pipetting. The mixture was then spread onto LB agar plates (50 mg / L Kan, 50 mg / L Rif) and incubated upside down at 28°C for 72 h until single colonies grew. Four single colonies were randomly selected for colony PCR testing. Agrobacterium that tested positive could be used for subsequent genetic transformation using the leaf disc method.

[0033] The prepared pROKⅡ- BpSPL2 -SRDX Agrobacterium single colony and overexpression pGWB5 preserved in our laboratory- BpSPL2 -GFP Agrobacterium single colonies were cultured overnight in LB liquid medium at 28°C. On the second day, when the OD600 of the bacterial solution was measured to be 0.8~1.0, the bacterial solution was diluted 20 times and cultured at 28°C until the OD600 of the bacterial solution was between 0.6~0.8. The bacterial solution was then resuspended in liquid WPM (6-BA 2.0 mg / L + NAA 0.2 mg / L) as the infection culture.

[0034] Leaves from rooted seedlings with bright green color and large leaf area (the third and fourth leaves from the top) were selected as explants. The leaves were cut at the point of strongest meristematic activity (approximately 0.3 cm from the base of the petiole, at the bifurcation of the main vein), ensuring minimal mechanical damage during cutting. The leaves were then infected with the prepared engineered bacterial solution for 10 minutes. Excess bacterial solution was removed and blotted away with sterile filter paper. The infected explants and Agrobacterium were then cultured in the dark for 2 days in a medium (WPM + 6-BA 2.0 mg / L + NAA 0.2 mg / L) to obtain co-cultured leaves.

[0035] The co-cultured leaves were washed in sterile water containing 200 mg / L cephalosporin, and excess water was absorbed with absorbent paper. The leaves were then placed on a selective medium (WPM + 6-BA 2.0 mg / L + NAA 0.2 mg / L + cefotaxime sodium 400 mg / L + Kan 50 mg / L) for culture. After approximately 20 days of culture, callus swelling was observed at the wound site. The callus was then transferred to a medium containing WPM + 6-BA 0.8 mg / L + NAA 0.02 mg / L + GA3 0.5 mg / L. Once resistant buds emerged from the callus and grew to 3-4 cm in size, they were cut and placed in a rooting medium (WPM + IBA 0.4 mg / L) for rooting culture, resulting in two pROKII- BpSPL2 -SRDX transgenic birch tissue culture seedlings (referred to as 35S::) BpSPL2 -SRDX-1 and 35S:: BpSPL2 -SRDX-4) and two pGWB5- BpSPL2 -GFP transgenic birch tissue culture seedlings (referred to as 35S::) BpSPL2 -3、35S:: BpSPL2 -5).

[0036] Cut 35S:: BpSPL2 -3、35S:: BpSPL2 -5、35S:: BpSPL2 -SRDX-1、35S:: BpSPL2- 3cm stem segments with apical buds from SRDX-4 transgenic birch tissue culture seedlings and wild-type birch (WT) tissue culture seedlings were inserted into WPM rooting medium and cultured at a temperature of 24±2℃, a relative humidity of 70%, and a light intensity of 46μmol / m². 2 The culture was carried out under a 16-hour light / 8-hour dark condition for 40 days. The WPM rooting medium, using distilled water as a solvent, contained 2.14 g / L WPM powder, 20 g / L sucrose, 0.56 g / L calcium salt, 0.4 mg / L IBA, and 8 g / L plant agar. The pH was adjusted to 5.8 with 5 mol / L NaOH, and the medium was dispensed into 100 mL bottles for later use.

[0037] Transgenic seedlings grown under normal culture conditions for 40 days were transplanted into a soil substrate of vermiculite:potting soil = 1:1 (the culture medium on the roots of the seedlings was washed clean before transplanting). After the seedlings stabilized indoors, they were transplanted into larger soil pots and moved outdoors (to the natural environment) for further cultivation.

[0038] For those moved outdoors BpSPL2 Transgenic and wild birch plants were tracked and observed. In spring (May), the overall growth of different plants was observed and statistically analyzed, and the results were recorded. BpSPL2 Comparison of inflorescences between transgenic and wild-type birch plants. Growth status of each plant is shown below. Figure 1 (The red box shows the inflorescence of the birch plant) As shown, 35S:: BpSPL2 -SRDX-1 and 35S:: BpSPL2 -SRDX-4 transgenic birch plants compared to wild-type birch plants, 35S:: BpSPL2 -3 and 35S:: BpSPL2 -5 The transgenic birch plantlets produced inflorescences, indicating that BpSPL2 Genes negatively regulate the germination of birch buds, through silencing or knockout. BpSPL2 Genes can enhance the ability of birch trees to flower earlier.

[0039] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. BpSPL2 The application of genes in regulating the ability of plants to flower earlier is characterized by, The BpSPL2 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the plant is birch; the application is to inhibit [something] in plants. BpSPL2 Genes to enhance a plant's ability to flower earlier.

2. A method for enhancing the ability of plants to flower earlier, characterized in that, Includes the following steps: (1) Construct the structure as described in claim 1 BpSPL2 Gene repression expression vectors were used and transferred into Agrobacterium to obtain engineered bacteria; The BpSPL2 The method for constructing the gene repressor expression vector is as follows: amplification using primers BpSPL2F and BpSPL2-SRDXR. BpSPL2 Genes containing restriction enzyme sites were obtained. BpSPL2 -SRDX target fusion fragment; Will BpSPL2 -SRDX target fusion fragment is ligated with plasmid vector to obtain BpSPL2 Gene repression expression vector; the nucleotide sequence of BpSPL2F is shown in SEQ ID NO.3, and the nucleotide sequence of BpSPL2-SRDXR is shown in SEQ ID NO.4; (2) After the engineered bacteria obtained in step (1) infect the plant tissue, plant tissue culture is carried out to obtain a transgenic plant with the ability to flower earlier; the plant is birch.

3. The method as described in claim 2, characterized in that, The enzyme cleavage site is Bam HI and Kpn I restriction site, the plasmid vector is pROKⅡ.

4. The method as described in claim 2 or 3, characterized in that, The infected parts include plant leaves.

Images