A feuC gene, method and application for enhancing 1-deoxynojirimycin biosynthesis

Abstract

The present invention belongs to the field of industrial biotechnology, and discloses a feuC gene, method and application for enhancing the biosynthesis of 1-deoxynojirimycin, the nucleotide sequence of which is shown in SEQ ID No. 1. The present invention aims to reveal the specific mechanism of action of the feuC gene in the biosynthetic process of DNJ, which can be used to improve the biosynthetic efficiency of 1-deoxynojirimycin and provide theoretical support for the development of a more efficient DNJ production strategy. At the same time, we also expect that through this research, we can break through the technical difficulties in increasing DNJ yield, bring new ideas and methods to the research in the field of industrial biotechnology, and promote the large-scale production and application of DNJ.

Description

Technical Field

[0001] The present invention belongs to the field of industrial biotechnology, and in particular relates to a feuC gene, method, and application for enhancing the biosynthesis of 1-deoxynojirimycin. The core of the present invention lies in overexpressing or regulating the feuC gene to promote the biosynthesis of DNJ. The invention also involves related biological materials, strain construction, specific implementation steps, and application directions, aiming to enhance the ability of Bacillus amyloliquefaciens to synthesize 1-deoxynojirimycin (DNJ). Background Art

[0002] 1-Deoxynojirimycin (DNJ) is a naturally occurring polyhydroxypiperidinyl iminosugar alkaloid with the chemical formula C6H 13 NO4, rich in hydroxyl groups, is highly water-soluble, especially in acidic conditions. DNJ's molecular structure is highly similar to glucose, enabling it to effectively bind to the active center of α-glucosidase, thereby inhibiting the enzyme's activity. This activity demonstrates diverse biological activities, including blood sugar regulation, anti-tumor, and antiviral properties, and has broad application prospects.

[0003] However, although DNJ can be synthesized by a variety of microorganisms, including Streptomyces lilacinus, Monascus purpurogenum, Bacillus subtilis, Escherichia coli, and Bacillus amyloliquefaciens, low yields and long fermentation cycles have plagued researchers, severely limiting the large-scale production and application of DNJ. Therefore, breeding high-DNJ-producing microbial strains to increase DNJ yield and reduce production costs has become a focus of current research. In B. amyloliquefaciens, a partial DNJ biosynthesis pathway has been elucidated, with the genes gabT1, yktC1, and gutB1 playing key roles in DNJ synthesis. However, current strain engineering efforts have primarily focused on these three genes, a single strategy that has limited further improvements in DNJ yield. To overcome this bottleneck, researchers have begun to explore potential targets for engineering feuC. One candidate gene in B. amyloliquefaciens is located near key DNJ biosynthesis genes and may play a crucial role in DNJ synthesis. However, the specific mechanism of action of feuC in DNJ synthesis remains unclear. In order to further explore the function of the feuC gene, the present invention adopted gene knockout and overexpression technologies to conduct a comprehensive functional analysis of the feuC gene in Bacillus amyloliquefaciens.

[0004] This study aims to reveal the specific mechanism of action of the feuC gene in DNJ biosynthesis, providing theoretical support for the development of more efficient DNJ production strategies. We also hope that this research will overcome the technical challenges of increasing DNJ yield, bring new ideas and methods to research in industrial biotechnology, and promote the large-scale production and application of DNJ. Summary of the Invention

[0005] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a feuC gene, method and application for enhancing the biosynthesis of 1-deoxynojirimycin.

[0006] The technical solution adopted by the present invention to solve its technical problem is:

[0007] A feuC gene for enhancing the biosynthesis of 1-deoxynojirimycin, characterized in that the nucleotide sequence of the feuC gene is shown in SEQ ID No. 1.

[0008] A protein that enhances the biosynthesis of 1-deoxynojirimycin and is encoded by the feuC gene as described above, wherein the amino acid sequence of the protein is shown in SEQ ID No. 2.

[0009] An expression cassette for enhancing the biosynthesis of 1-deoxynojirimycin comprising the feuC gene as described above, wherein the expression cassette comprises a promoter, the feuC gene and a terminator.

[0010] A vector for enhancing the biosynthesis of 1-deoxynojirimycin comprising the feuC gene as described above, wherein the vector is selected from a plasmid, a viral vector or an artificial chromosome.

[0011] A method for improving the ability of Bacillus amyloliquefaciens to synthesize 1-deoxynojirimycin using the feuC gene as described above, comprising introducing the feuC gene, an expression cassette containing the feuC gene, or a vector containing the feuC gene into Bacillus amyloliquefaciens.

[0012] Furthermore, the Bacillus amyloliquefaciens is Bacillus amyloliquefaciens LH-2, its name is: LH-2, its classification name is: Bacillus amyloliquefaciens, its preservation number is: CGMCC No.29550, its preservation date is: January 9, 2024, and its preservation unit is: General Microbiology Center of China Culture Collection Administration, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0013] A recombinant strain of Bacillus amyloliquefaciens comprising the feuC gene described above and having enhanced 1-deoxynojirimycin synthesis ability of Bacillus amyloliquefaciens.

[0014] The method for constructing the recombinant strain as described above comprises the following steps:

[0015] First, the plasmid pLH2389 carrying the feuC gene was introduced into Bacillus amyloliquefaciens LH-2 competent cells by electroporation, and preliminary transformants were obtained using LB medium containing 5 μg / mL chloramphenicol. The transformants were then passaged at 42°C, with transfer every 12 hours for a total of three times, to induce single crossover between the plasmid and the genome, and integration was confirmed by PCR. Subsequently, further high-temperature passage was performed to promote double crossover recombination, and double crossover strains were selected by coating LB medium containing 25 μg / mL 5-fluorouracil. The stable integration of the feuC gene overexpression construct was confirmed by PCR. Finally, sensitive strains were screened for residual plasmids using a chloramphenicol sensitivity test, and the accuracy of gene editing was verified by sequencing, ultimately successfully obtaining a genetically stable feuC overexpression recombinant strain.

[0016] Application of the recombinant strain described above in enhancing the fermentation production of 1-deoxynojirimycin.

[0017] The method for producing 1-deoxynojirimycin by fermentation using the recombinant strain described above comprises the following steps:

[0018] The recombinant strain was removed from the ultra-low temperature freezer and streaked onto LB solid medium. The culture was incubated at 37°C for 12 hours to grow a single strain. The single colony was transferred to 5 mL of fresh LB liquid medium and incubated at 37°C and 200 rpm for 12 hours to prepare a seed culture. The seed solution of the cultured bacteria was inoculated into the fermentation medium at an inoculum rate of 4% and incubated at 37°C and 100 rpm for 72 hours to ferment 1-deoxynojirimycin.

[0019] The formula of the fermentation medium is: (NH4)2SO4: 4g / L, lactose: 25g / L, K2HPO4: 14g / L, KH2PO4: 6g / L, MgSO4·7H2O: 0.2g / L, CaCl2: 0.15g / L, MnSO4·H2O: 1.9mg / L, FeCl3·6H2O: 37.8mg / L, ZnCl2: 7mg / L, the solvent is water, pH 7.0, and sterilization is at 121°C for 20 min.

[0020] The advantages and positive effects achieved by the present invention are:

[0021] 1. This invention aims to reveal the specific mechanism of action of the feuC gene in DNJ biosynthesis. The feuC gene can be used to improve the biosynthesis efficiency of 1-deoxynojirimycin, providing theoretical support for the development of more efficient DNJ production strategies. We also hope that this research will overcome the technical difficulties of increasing DNJ yield, bring new ideas and methods to research in industrial biotechnology, and promote the large-scale production and application of DNJ.

[0022] 2. Breakthrough Discovery of a Key Gene: This study identifies and reveals for the first time the core gene in the DNJ biosynthetic pathway—the feuC gene (nucleotide sequence, see SEQ ID No. 1). The protein it encodes possesses unique functionality (amino acid sequence, see SEQ ID No. 2), enhancing the efficiency of 1-deoxynojirimycin biosynthesis. This discovery fills a critical gap in the DNJ anabolic pathway, provides a new perspective for in-depth analysis of the molecular mechanisms of DNJ synthesis in microorganisms, and lays a solid molecular foundation for subsequent genetic engineering modifications.

[0023] 3. Systematic Verification of Gene Function: By utilizing gene knockout and overexpression techniques, this study clearly demonstrates the crucial role of the feuC gene in DNJ biosynthesis. Specifically, the feuC knockout strain completely lost its DNJ production capacity; however, the engineered strain with feuC restored increased DNJ production by 75% compared to the wild-type, a significant improvement compared to existing modification strategies. This experimental data, for the first time, functionally confirms that the feuC gene is essential for DNJ biosynthesis, providing a reliable gene target for the construction of industrial high-yield strains.

[0024] 4. Targeted Breakthrough of Technical Bottlenecks: This invention addresses core issues in current DNJ production, such as low yield and a lack of genetic modification targets. Specifically, an expression cassette (including a promoter and terminator) based on the feuC gene and a supporting vector system (plasmid vector) were developed. Both the expression cassette and vector are capable of improving the biosynthesis efficiency of 1-deoxynojirimycin. Furthermore, a genetic engineering method was established for Bacillus amyloliquefaciens LH-2 (CGMCC No. 29550), achieving targeted enhancement of DNJ biosynthesis.

[0025] 5. Strategic value of industrial application: The technical solution of the present invention is not only applicable to Bacillus amyloliquefaciens LH-2, but also has a wide range of applicability and can be extended to other Bacillus strains, providing broad application prospects and strategic value for the industrial production of DNJ. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1is the high performance liquid chromatography (HPLC) spectrum of DNJ in the fermentation broth of the present invention (variable wavelength detector, wavelength of 265 nm);

[0027] Figure 2 Schematic diagram of the relative positions of the DNJ synthesis gene cluster and the genes on both sides in the present invention;

[0028] Figure 3 This is the map of the knockout plasmid pLH2225 in the present invention;

[0029] Figure 4 This is the map of the overexpression plasmid pLH2389 in the present invention;

[0030] Figure 5 This is a PCR verification result of electroporation of the knockout plasmid pLH2223 into the LH-2 strain in the present invention; wherein, M represents a DNA marker (molecular weight standard); N is a negative control (used to exclude nonspecific amplification); P is a positive control using the pLH2225 plasmid vector as a template (confirming the effectiveness of the PCR reaction); 1, 2, 3, and 4 are, respectively, PCR amplification products using the genomes of different transformants obtained after successful electroporation of the knockout plasmid pLH2225 into the LH-2 strain as templates. The fragment size is 690 bp, verifying the successful introduction of the knockout plasmid;

[0031] Figure 6 This is a graph showing the PCR verification results of electroporation of the overexpression plasmid pLH2389 into the LH-2 strain; wherein M represents a DNA marker (as a molecular weight standard); N is a negative control (used to eliminate interference from nonspecific amplification); P is a positive control using the constructed pLH2389 plasmid vector as a template (used to confirm the effectiveness and accuracy of the PCR reaction); and 1, 2, 3, and 4 are PCR amplification products of transformants obtained after the overexpression plasmid pLH2389 was successfully electroporated into the LH-2 strain. The fragment size is 550 bp, which verifies the successful introduction of the overexpression plasmid.

[0032] Figure 7 Figure 1 is a PCR verification result of the knockout plasmid pLH2225 in the present invention undergoing single crossover in the recombinant bacteria; wherein M represents a DNA marker (as a molecular weight standard); N is a negative control (used to exclude nonspecific amplification); 1, 2, and 3 are PCR amplification products of the transformants, and the fragment size is 1421 bp. This result confirms that the knockout plasmid pLH2225 has successfully undergone single crossover in the recombinant bacteria;

[0033] Figure 8Figure 1 is a PCR verification result of single crossover in the recombinant bacteria of the overexpression plasmid pLH2389 of the present invention; wherein, M represents DNA Marker (as a molecular weight standard); N is a negative control (used to eliminate the interference of nonspecific amplification); 1, 2, and 3 are PCR amplification products of the transformants, and the fragment size is 2567 bp. This result confirms that the overexpression plasmid pLH2389 has successfully undergone single crossover in the recombinant bacteria;

[0034] Figure 9 Figure 1 is a PCR verification result of double crossover in the recombinant bacteria of the knockout plasmid pLH2225 of the present invention; wherein, M represents DNA Marker (as a molecular weight standard); N is a negative control (used to eliminate interference from nonspecific amplification); WT represents the genome of wild-type Bacillus amyloliquefaciens LH-2, with a fragment size of 2059 bp, which serves as a reference; 1 is the PCR amplification product of the successfully knocked-out strain, with a fragment size of 1421 bp, which confirms that double crossover has successfully occurred in the recombinant bacteria of the knockout plasmid pLH2225;

[0035] Figure 10 Figure 1 is a PCR verification result of double crossover in the recombinant bacteria of the overexpression plasmid pLH2389 of the present invention; wherein M represents a DNA marker (as a molecular weight standard); N is a negative control (used to eliminate interference from nonspecific amplification); WT represents the genome of wild-type Bacillus amyloliquefaciens LH-2, with a fragment size of 1517 bp, which serves as a reference; 1 is the PCR amplification product of the strain with successful knock-in (or overexpression integration), with a fragment size of 2567 bp, which confirms that double crossover has successfully occurred in the recombinant bacteria of the overexpression plasmid pLH2389;

[0036] Figure 11 This is a comparison chart of the DNJ shake flask fermentation yields of strains LH-2, S4279 and S4459 in the present invention.

[0037] A Bacillus amyloliquefaciens is Bacillus amyloliquefaciens LH-2, its name is: LH-2, its classification name is: Bacillus amyloliquefaciens, its preservation number is: CGMCC No.29550, its preservation date is: January 9, 2024, and its preservation unit is: General Microbiology Center of China Culture Collection Administration, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. DETAILED DESCRIPTION

[0038] The present invention will be further described below with reference to the examples. It should be noted that the following examples are merely descriptive examples and are not restrictive descriptions, and the scope of protection of the present invention cannot be limited solely by these examples. The various experimental procedures involved in the specific examples are all conventional technical means in this field. For parts not particularly noted herein, those of ordinary skill in the art can refer to various commonly used reference books, scientific and technological literature or related specifications, manuals and other materials before the filing date of the present invention for implementation.

[0039] A feuC gene for enhancing the biosynthesis of 1-deoxynojirimycin, characterized in that the nucleotide sequence of the feuC gene is shown in SEQ ID No. 1.

[0040] A protein that enhances the biosynthesis of 1-deoxynojirimycin and is encoded by the feuC gene as described above, wherein the amino acid sequence of the protein is shown in SEQ ID No. 2.

[0041] An expression cassette for enhancing the biosynthesis of 1-deoxynojirimycin comprising the feuC gene as described above, wherein the expression cassette comprises a promoter, the feuC gene and a terminator.

[0042] A vector for enhancing the biosynthesis of 1-deoxynojirimycin comprising the feuC gene as described above, wherein the vector is selected from a plasmid, a viral vector or an artificial chromosome.

[0043] A method for improving the ability of Bacillus amyloliquefaciens to synthesize 1-deoxynojirimycin using the feuC gene as described above, comprising introducing the feuC gene, an expression cassette containing the feuC gene, or a vector containing the feuC gene into Bacillus amyloliquefaciens.

[0044] Preferably, the Bacillus amyloliquefaciens is Bacillus amyloliquefaciens LH-2, whose name is: LH-2, classification name: Bacillus amyloliquefaciens, preservation number: CGMCC No.29550, preservation date: January 9, 2024, preservation unit: General Microbiology Center of China Culture Collection Administration, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0045] A recombinant strain of Bacillus amyloliquefaciens comprising the feuC gene described above and having enhanced 1-deoxynojirimycin synthesis ability of Bacillus amyloliquefaciens.

[0046] The method for constructing the recombinant strain as described above comprises the following steps:

[0047] First, the plasmid pLH2389 carrying the feuC gene was introduced into Bacillus amyloliquefaciens LH-2 competent cells by electroporation, and preliminary transformants were obtained using LB medium containing 5 μg / mL chloramphenicol. The transformants were then passaged at 42°C, with transfer every 12 hours for a total of three times, to induce single crossover between the plasmid and the genome, and integration was confirmed by PCR. Subsequently, further high-temperature passage was performed to promote double crossover recombination, and double crossover strains were selected by coating LB medium containing 25 μg / mL 5-fluorouracil. The stable integration of the feuC gene overexpression construct was confirmed by PCR. Finally, sensitive strains were screened for residual plasmids using a chloramphenicol sensitivity test, and the accuracy of gene editing was verified by sequencing, ultimately successfully obtaining a genetically stable feuC overexpression recombinant strain.

[0048] Application of the recombinant strain described above in enhancing the fermentation production of 1-deoxynojirimycin.

[0049] The method for producing 1-deoxynojirimycin by fermentation using the recombinant strain described above comprises the following steps:

[0050] The recombinant strain was removed from the ultra-low temperature freezer and streaked onto LB solid medium. The culture was incubated at 37°C for 12 hours to grow a single strain. The single colony was transferred to 5 mL of fresh LB liquid medium and incubated at 37°C and 200 rpm for 12 hours to prepare a seed culture. The seed solution of the cultured bacteria was inoculated into the fermentation medium at an inoculum rate of 4% and incubated at 37°C and 100 rpm for 72 hours to ferment 1-deoxynojirimycin.

[0051] The formula of the fermentation medium is: (NH4)2SO4: 4g / L, lactose: 25g / L, K2HPO4: 14g / L, KH2PO4: 6g / L, MgSO4·7H2O: 0.2g / L, CaCl2: 0.15g / L, MnSO4·H2O: 1.9mg / L, FeCl3·6H2O: 37.8mg / L, ZnCl2: 7mg / L, the solvent is water, pH 7.0, and sterilization is at 121°C for 20 min.

[0052] Specifically, the relevant preparation and detection are as follows:

[0053] Example 1 Screening and identification of Bacillus amyloliquefaciens LH-2 strain

[0054] (1) Screening of DNJ-producing strains and fermentation testing

[0055] It was isolated from cattle dung at a cattle farm (address: Xiazhuanger Village, Wangcun Township, Laishui County, Baoding City, Hebei Province, China).

[0056] Grind the collected cow dung sample and pass it through a 60-100 mesh sieve. Take 1g of the sample and add it to 15-50mL LB liquid culture medium with glass beads. After thorough shaking, place it in 80-90℃ water for 10-15 minutes, and then culture it on a shaker at 28℃ (120rpm) for 24 hours. After the culture is completed, place the culture in an 80-90℃ water bath for 10-15 minutes again, dilute it appropriately by 10-fold dilution method, and take the diluted 10 5 , 10 6 and 10 7 Spread 0.1 ml of each of three dilutions (1 / 2 of the original) onto LB solid medium and incubate inverted at 28–37°C for 2–5 days, observing daily. Select colonies with white lamellae, irregular, bumpy, or ragged edges and purify them through 3–5 rounds of streaking to select candidate strains.

[0057] Use an inoculating loop to inoculate the selected strain into LB liquid medium in a test tube and incubate at 100-200 rpm and 28-37°C for 8-24 hours to prepare a seed culture. Inoculate 100-1000 μl of the seed culture into a 500 ml baffled shake flask (containing 50-200 ml of fermentation medium) and incubate at 28-37°C and 100-200 rpm for 2-3 days to obtain the primary screening fermentation broth. Take 1 mL of the fermentation broth and centrifuge it at 10,000 rpm for 10 minutes to remove the bacterial cells. The supernatant is used for 1-deoxynojirimycin detection.

[0058] The sample processing and detection methods referred to the national standard detection method "Detection of 1-deoxynojirimycin in mulberry leaf extract" (GB / T40642-2021), in which the liquid chromatography detection wavelength was set at 265 nm.

[0059] The LB medium formula consists of: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, the solvent is water, and the pH is adjusted to 7.0. The solid medium needs to add 2% agar powder.

[0060] The fermentation medium formula consists of: 0.1~100 g / L starch, 0.1~20 g / L soy peptone, 0.01~10.0 g / L (NH4)2SO4, 0.01~20.0 g / L K2HPO4, 0.01~20.0 g / L KH2PO4, 0.01~10 g / L MgSO4·7H2O or MgSO4, 0.01~5 g / L CaCl2, 0.01~100 mg / L MnSO4, 0.01~500 mg / L Fe2(SO4)3, 0.01~100 mg / L ZnCl2, the solvent is water, and the pH is adjusted to 4.0~9.0.

[0061] Experimental results: A total of 600 bacterial strains were isolated, and 50 strains producing 1-deoxynojirimycin were isolated, of which the highest 1-deoxynojirimycin content was 1.5 g / L. The HPLC profile is shown in FIG. Figure 1 As shown, the individual plant was picked out and numbered as LH-2.

[0062] (2) Strain species identification based on 16S rRNA gene sequencing

[0063] Strain LH-2 was inoculated into LB liquid medium and cultured at 28–37°C with shaking for 24 h. The cells were then harvested by centrifugation (8,000 × g, 10 min). Genomic DNA was extracted using a bacterial genomic DNA extraction kit (Tiangen, DP302). The 16S rRNA gene was amplified using universal primers 27F and 1492R (as shown in Table 1) (PCR conditions: initial denaturation at 94°C for 5 min; 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 90 s; final extension at 72°C for 10 min). The amplified product was verified by 1% agarose gel electrophoresis, purified, and sent to GeneWeizhi Biotechnology Co., Ltd. for bidirectional sequencing. The resulting 16S rDNA sequence (SEQ ID No. 3) was submitted to the NCBI database for BLASTn homology comparison (parameter settings: E-value ≤ 1e-50, coverage ≥ 95%). As shown in Table 2 (only the five strains with the highest homology are listed in the table), the sequence showed 100% similarity with the 16S rRNA gene of different Bacillus amyloliquefaciens strains, such as Bacillus amyloliquefaciens strain H, so the strain was identified as Bacillus amyloliquefaciens.

[0064] The Bacillus amyloliquefaciens LH-2 is named LH-2, classified as Bacillus amyloliquefaciens, with a deposit number of CGMCC No. 29550, a deposit date of January 9, 2024, and a depository unit of the General Microbiology Center of the China Culture Collection Administration, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0065] Table 1 Sequences of primers used

[0066]

[0067] Table 2 BLASTn homology comparison results of 16S rRNA sequences of strain LH-2

[0068]

[0069] Example 2: Discovery of the feuC gene based on genome sequencing of Bacillus amyloliquefaciens strain LH-2

[0070] The DNJ metabolic pathway in Bacillus amyloliquefaciens has been partially elucidated, with the gabT1, yktC1, and gutB1 gene clusters clearly identified as core components of DNJ biosynthesis. However, the potential roles of genes flanking these clusters in DNJ biosynthesis remain largely unexplored. To address this, we performed whole-genome sequencing of the DNJ-producing B. amyloliquefaciens strain LH-2 (CGMCC No. 29550) (sequencing performed by Suzhou GENEWIZ Biotechnology Co., Ltd.). This analysis revealed for the first time the feuC gene (SEQ ID No. 1) encoding a transporter protein (amino acid sequence shown in SEQ ID No. 2) within the flanking regions of the gabT1-yktC1-gutB1 gene cluster. Although the specific function of the feuC gene in DNJ biosynthesis remains to be elucidated, this study has begun to identify its role in DNJ biosynthesis by knocking out and complementing the feuC gene in Bacillus amyloliquefaciens LH-2, aiming to open up new avenues for increasing DNJ production. Figure 2 .

[0071] Example 3 Construction of feuC gene editing vector

[0072] (1) Construction of feuC gene knockout vector pLH2225

[0073] First, based on the sequenced genome of Bacillus amyloliquefaciens LH-2 (sequencing services provided by Suzhou GENEWIZ Biotechnology Co., Ltd. / GENEWIZ), two pairs of specific primers, feuCUP-F / feuCUP-R and feuCDN-F / feuCDN-R, were designed (primer sequences are detailed in Table 1). Subsequently, PCR was performed using genomic DNA from Bacillus amyloliquefaciens LH-2 (for extraction procedures, see Example 1) as a template and high-fidelity Phanta Max Super-Fidelity Polymerase (Nanjing Novozymes Biotechnology Co., Ltd., Cat. No. P505-d1). The upstream and downstream homology arms of the feuC gene (SEQ ID Nos. 4 and 5, respectively) were successfully amplified. The specific configuration of the PCR reaction system is shown in Table 3. The amplified product was then purified using a standard DNA product purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., Cat. No. DP204) to obtain a highly pure DNA fragment. Finally, the purified upstream and downstream homology arm sequences of the feuC gene were precisely ligated into the BamHI restriction site of the pKSU plasmid using the ClonExpress Ultra One Step Cloning Kit V (Nanjing Novogene Biotech Co., Ltd., Cat. No. C117-01). This successfully constructed the feuC gene knockout vector pLH2225 (see the schematic diagram of the vector structure for details). Figure 3 The specific configuration of the one-step cloning reaction system of ClonExpress Ultra One Step Cloning Kit V is shown in Table 4.

[0074] Table 3 Phanta Max Super-Fidelity Polymerase PCR amplification system

[0075]

[0076] Table 4 ClonExpress Ultra One Step Cloning Kit V one-step cloning system

[0077]

[0078] Special Note: The pKSU plasmid, a core tool for genetic manipulation in Bacillus amyloliquefaciens, has become a preferred system for gene editing in this species due to its high transformation efficiency, multiple cloning site compatibility, and stable replication. This plasmid was first reported by Zhang et al. in 2014 in Applied Microbiology and Biotechnology. Their developed markerless gene replacement technology was successfully applied to genome reduction and improvement of the poly-γ-glutamic acid biosynthesis pathway (Zhang, W., Gao, WX, Feng, J., Zhang, C., He, YL, Cao, MF, et al. (2014) A markerless gene replacement method for B. amyloliquefaciens LL3 and its use in genome reduction and improvement of poly-γ-glutamic acid production. Appl Microbiol Biotechnol 98: 8963–8973.). Currently, the genetic operating system based on pKSU has been included in the Bacillus Genetic Stock Center (BGSC).

[0079] (2) Construction of feuC gene overexpression vector pLH2389

[0080] Using pKSU as the starting vector, the feuC gene overexpression vector pLH2389 integrated into the pksJ gene target site (sequence identification number: SEQ ID No. 6) was designed and constructed. The specific construction process is as follows: First, using genomic DNA of Bacillus amyloliquefaciens LH-2 (for extraction steps, see Example 1) as a template, high-fidelity Phanta Max Super-Fidelity Polymerase (Nanjing Novozymes Biotech Co., Ltd., Cat. No. P505-d1) was used, and PCR was performed using pksJUP-F / pksJUP-R and pksJDN-F / pksJDN-R primers (primer sequences are shown in Table 1 for details). The upstream and downstream homology arm sequences of the pksJ gene (sequences of SEQ ID No. 7 and No. 8, respectively) were successfully amplified. Simultaneously, the amyS promoter sequence (SEQ ID No. 9) was amplified using amsy-F / asmy-R primers (see Table 1 for primer sequences), and the feuC gene sequence (SEQ ID No. 1) was amplified using feuC-F / feuC-R primers (see Table 1 for primer sequences). Subsequently, the PCR amplification products were purified using a standard DNA product purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., Cat. No. DP204) to obtain highly pure DNA fragments. Finally, the purified pksJ gene upstream and downstream homology arms, the amyS promoter, and the feuC gene were ligated simultaneously into the BamHI restriction site of the pKSU plasmid using the ClonExpress Ultra One Step Cloning Kit V3 (Nanjing Novozymes Biotech Co., Ltd., Cat. No. C117-01), thereby successfully constructing the feuC gene overexpression vector pLH2389 (see the schematic diagram of the vector structure for details). Figure 4 ).

[0081] Example 4 Construction of feuC gene knockout and overexpression recombinant strains

[0082] (1) Preparation of competent cells of Bacillus amyloliquefaciens LH-2

[0083] 1) Remove strain LH-2 from -80°C storage, streak three colonies onto LB solid medium, and incubate in a 37°C incubator for 12–24 hours until clear, single colonies appear. Select a single colony and inoculate it into LBS medium (containing 10.0 g / L tryptone, 5.0 g / L yeast extract, 10.0 g / L sodium chloride, 91.0 g / L sorbitol, and water as the solvent) for overnight culture.

[0084] 2) Transfer the bacterial suspension to a sterile centrifuge tube and place on ice for 30 minutes. Then, centrifuge at 8000 rpm and 4°C for 20 minutes to collect the cells.

[0085] 3) Add approximately 60 mL of eluent (containing 91.0 g sorbitol, 91.0 g mannitol, and 50 g glycerol, and dilute to 0.5 L with water), mix thoroughly, and centrifuge again under the same conditions for 20 minutes to collect the cells. Repeat this procedure twice.

[0086] 4) Add 500 μL of electroporation competent cell suspension (containing 0.91 g sorbitol, 0.91 g mannitol, 0.1 g glycerol, 1.4 g PEG6000, dilute to 10 mL with water) and gently resuspend the cells thoroughly.

[0087] 7) Aliquot 100 μL of the competent cells into sterile EP tubes and store at -80°C until use.

[0088] (2) Electroporation of feuC gene editing vector into Bacillus amyloliquefaciens

[0089] 1) Thaw the competent cells naturally on ice, add appropriate amounts of pLH2225 and pLH2389 plasmids (no more than 200 ng), and mix thoroughly.

[0090] 2) Transfer the above system to a pre-cooled sterile electroporation cuvette (2 mm size) and place on ice for 2-3 minutes.

[0091] 3) Perform electroporation at 2500 V. Then, add 1 mL of pre-chilled electroporation bacterial recovery liquid medium (0.38 mol / L mannitol dissolved in LBS medium) to the electroporation cuvette and mix thoroughly by pipetting.

[0092] 4) Transfer the bacterial solution to an EP tube and incubate at 30 °C and 180 rpm for 3 h.

[0093] 5) Concentrate the cells by centrifugation at 8000 rpm for 2 minutes. Spread 100 μL of the culture onto LB solid medium containing chloramphenicol (5 μg / mL) and incubate at 30°C for 48 hours until transformants are visible.

[0094] (3) Screening and verification of feuC gene knockout and overexpression recombinant strains

[0095] 1) Inoculate the transformants obtained by electroporation in the previous step into LB liquid medium containing 5 μg / mL chloramphenicol and culture at 30°C overnight;

[0096] 2) PCR verification was performed on the overnight culture using primers p1 / p2 to ensure that the feuC knockout plasmid pLH2225 and the overexpression plasmid pLH2389 were successfully electroporated into the competent cells of Bacillus amyloliquefaciens LH-2. The enzyme preparation used for PCR amplification verification was 2× Rapid Taq Master Mix from Nanjing Novozymes Biotech Co., Ltd. The specific method is shown in Table 5. Figure 5 and Figure 6 As shown, the results showed that pLH2225 and pLH2389 were electroporated into Bacillus amyloliquefaciens LH-2.

[0097] 3) Transfer the correct transformants of the two plasmids into fresh LB liquid medium containing 5 μg / mL chloramphenicol and subculture at 42°C, transferring every 12 hours for a total of three times to promote single crossover of the plasmids within the strain.

[0098] 4) After appropriately diluting the bacterial suspensions of the two plasmids in step 3), 100 μL was spread on LB solid medium containing 5 μg / mL chloramphenicol. Incubate at 30°C for 48 h until a single colony was visible. PCR detection of a single colony containing the knockout plasmid pLH2225 was performed using primers p3 / p4. The results were as follows: Figure 7 As shown; primers p5 / p6 were used to perform PCR detection on single colonies of overexpression plasmid pLH2389, and the results were as shown Figure 8 The results are shown in Figure 7 and Figure 8 As shown, the results showed that pLH2225 and pLH2389 completed single crossover in Bacillus amyloliquefaciens LH-2, respectively, and single crossover transformants of the two plasmids were obtained through screening.

[0099] 5) Transfer the resulting single-crossover transformants of the two plasmids into LB liquid medium and subculture at 42°C, transferring every 12 hours for a total of three times to promote double crossover in the single-crossover transformants.

[0100] 6) Dilute the bacterial suspensions of the two plasmids from step 5) appropriately and spread them onto LB solid medium containing 25 μg / mL 5-fluorouracil. Incubate at 30°C for 48 hours until single colonies are visible. Perform PCR on the single colonies of each of the two plasmids to screen for double-crossover strains. PCR on the single colonies of the knockout plasmid pLH2225 using primers p7 / p8 is as follows: Figure 9 As shown; primers p9 / p10 were used to perform PCR detection on single colonies of overexpression plasmid pLH2389, and the results were as shown Figure 10 The results are shown in Figure 9 and Figure 10As shown, it was shown that double-exchange transformants of two plasmids were obtained, thereby obtaining feuC gene knockout and overexpression recombinant transformants.

[0101] 7) The feuC knockout and overexpression recombinant transformants obtained in step 6 were inoculated into LB liquid medium and cultured overnight at 30°C. The resulting strains were then diluted and plated onto LB solid medium and incubated at 30°C for 48 hours until single colonies developed. The single colonies were then spotted onto LB solid medium and LB solid medium supplemented with 5 μg / mL chloramphenicol to determine the sensitivity of the recombinant transformants to chloramphenicol. Chloramphenicol-sensitive strains were selected and verified by sequencing. The feuC knockout recombinant strain S4279 and the overexpression recombinant strain S4459 were finally obtained.

[0102] Table 5 PCR verification system

[0103]

[0104] Example 4 DNJ shake flask fermentation of strains LH-2, S4279 and S4459

[0105] (1) DNJ shake flask fermentation

[0106] Strains LH-2, S4279, and S4459 were removed from the ultra-low temperature freezer and streaked onto LB solid medium. The cultures were incubated at 37°C for 12 hours to grow single strains. Single colonies of each strain were transferred to 5 mL of fresh LB liquid medium and incubated at 37°C and 200 rpm for 12 hours to prepare seed cultures. DNJ fermentation was performed by inoculating 30 mL of fermentation medium (250 mL Erlenmeyer flasks) with 4% (v / v) inoculum of each strain. The fermentations were then incubated at 37°C and 100 rpm for 72 hours. Three shake flask replicates were performed for each strain. The fermentation medium used was: (NH4)2SO4: 4 g / L, lactose: 25 g / L, K2HPO4: 14 g / L, KH2PO4: 6 g / L, MgSO4·7H2O: 0.2 g / L, CaCl2: 0.15 g / L, MnSO4·H2O: 1.9 mg / L, FeCl3·6H2O: 37.8 mg / L, ZnCl2: 7 mg / L, the solvent was water, pH 7.0, and sterilized at 121°C for 20 min.

[0107] (2) Fermentation broth treatment and DNJ determination

[0108] The fermentation broth was centrifuged at 12,000 rpm for 5 minutes, and the supernatant was removed for later use. Next, 35 µL of the fermentation supernatant or DNJ standard solution was added to a 1.5 mL centrifuge tube. Then, 200 µL of 0.4 mol / L potassium borate buffer (pH 8.5) and 250 µL of a 5 mmol / L derivatization reagent, fluorenylmethoxycarbonyl chloride (FMOC-Cl), dissolved in 50% acetonitrile, were added sequentially. After thorough mixing, the mixture was incubated in a 25°C water bath for 20 minutes. After completion of the reaction, 25 µL of 1 mol / L glycine solution was added to terminate the reaction. 100 µL of 1% (v / v) acetic acid solution was then added, and the volume was adjusted to 800 µL with water. Finally, the solution was filtered through a 0.22 µm microporous filter membrane, and the filtrate was collected as the subsequent test sample.

[0109] The samples were analyzed by high-performance liquid chromatography (HPLC). The chromatographic column was a ZORBAX SB-C18 (5 µm, 4.6 × 150 mm) and the detection wavelength was UV at 254 nm. The mobile phase consisted of acetonitrile and 0.1% acetic acid (1:1, v / v) at a flow rate of 1.0 mL / min, and the injection volume was 20 µL.

[0110] (3) Analysis of DNJ shake flask fermentation results

[0111] After 72 hours of shake flask fermentation, the starting strain Bacillus amyloliquefaciens LH-2 produced 1.5 g / L of DNJ. The recombinant strain S4279, which had the feuC gene knocked out, produced almost no DNJ. The strain S4459, which overexpressed feuC, produced 2.7 g / L of DNJ. Compared with the wild-type Bacillus amyloliquefaciens LH-2, the strain S4459 overexpressing feuC increased its DNJ production by 80% ( Figure 11 ), verifying the key role of the feuC gene in the biosynthesis of 1-deoxynojirimycin.

[0112] In summary, the present invention has made a breakthrough in identifying and revealing the core gene feuC for DNJ biosynthesis in Bacillus amyloliquefaciens, filling a key gap in the synthetic metabolic pathway; through gene knockout and overexpression technology, feuC was systematically verified as an essential gene for DNJ synthesis, and the yield was significantly improved after complementation; at the same time, an expression cassette and vector system based on feuC was developed, and a genetic engineering modification method for Bacillus amyloliquefaciens was established, which directed the enhancement of the DNJ synthesis ability; this technical solution has wide applicability and provides broad application prospects and strategic value for the industrial production of DNJ.

[0113] The sequences used in the present invention are as follows:

[0114] SEQ ID NO.1 feuC fragment:

[0115]

[0116] SEQ ID NO.2 feuC amino acid sequence:

[0117] VRKMAGIYIILIVLILLVSYFSMTSGSFSAKPGELLSTLFHIHPNPQYEILLFQLRLPRIVMAAAIGLGLGIAGTVIQAITKNGLADPGILGINAGAGAGIVAFMLLFQGQSEATALASAMGMPVFGLIGGLMAAVLIYIFAWHRGHLESGRIILVGIAMNSGFSALSLFLSLKMDPQDYEMAMVWKNGSIWSANWMTITAILPWLIVFIPLLMAKMSLLDTIRFDEDTVKSLGVSSNKEKTILLVACIALISACVTAAGSMAFVGLIAPHISRRLAGIEHRYSLPVSGLVGMLLVISADFAGKLFFQPSEVPAGIILAILGVPYFFFLLFKQKKGLDA

[0118] SEQ ID NO:3 16S rDNA sequence:

[0119]

[0120] SEQ ID NO.4 Nucleotide sequence upstream of feuC gene:

[0121] CGGACATAGTCTGCCGATTTTTCATACCAGAAGGACCCGGAGATACAGCCGATTCTGCCGAATATCTCAGGCTTCTGTAACATCGCGTACATTGAAAACAATCCGCCTAATGACGCGCCGATCAGTCCTCTTGTTTCCGGGTCCGGAGACATGTGATGCATATCTTCAACCGTTGGGATGATGGTATTTGTCAGGTCTTCAAGAAAGAGGCTCCCTTTGCCGCCGAAATCATGAAACGCAGGGCTCAGGGAAGGCGCAGGCCATGGTGTGTACTCATCGAGCCTGTTATCCGGTTTGATGCCGGCGAAAATCAATTCAGGAAGTGTTCCGTTCGCAAATTGGAATTCAAGCTTCTCCATCTGCTCTAAAAACAAAACACCCCCATCAAGTACGTAAACCCAGGGTAAAGCCTTGGTTTGAACCGAATAGGAGGGAGGAAGATACACCGTGCATTCCTTTCCGTTTATCCGGTGTTCTGTGAGTGTGCCTCTCATGCGTCCAATCCCTTTTTTTGTTTAAACAGCAGAAAAAAGAAATAAGGAACGCCGAG

[0122] SEQ ID NO.5 Nucleotide sequence downstream of feuC gene:

[0123] ATAGCTTACGAGCAATATGAGAACAATCAGTATGATATAAATTCCGGCCATTTTACGCACCGCGCTGATCCCCTCCTTTTCTTTTAATCAAATAAAGAAAGAAAGGAACACCGATGATAGAAGTAACAACTTCAATAGGTGTCTCAAACGGATAATTGATCAATCGGCTGGCAAGATCGCAAAAGGTCAGGAAGACGCCGCCGATGATGCACGCGCAGGGAATCAGCCTGCTGTAGTCTGATCCGACGAGAAAGCGTGTGATGTGCGGAACGACCAAACCGACAAAGGCAATTTTTCCGGCGAGCGCCACCGAGCTTCCGGTCAATATGACAACGGCCGCCATCGCCATGAGTTTGATAGTTCTTTTCTGCTGTCCCAGACTTTTTGAAATGTCGTCTCCTAATGATACGGCTGTAACCTTTTTGCTGAGAATCATGGCCGTGATGATTCCGATAGCGAAAAACGGGACGGCCAGTTTCAAAAAATCAGGGTTCATTTGATGCAGTCTCGCACTGTACCAAAAACTGAGATCCTGCGAGATTTGAAAATA

[0124] SEQ ID No.6 pksJ locus:

[0125]

[0126] SEQ ID No.7 upstream homology arm of pksJ:

[0127] CAGAAGACATTCAAAACCGGAAATGGGACTTATCCTCCATGCGTTACATGCTGAACGGAGGGGAGGCCACGGTTGCGAAAGTCGGGCGCAGAATTATGGAGCTTTTAGAGCCGCATGGTCTGCCGGCTAATGCCATCCGTCCCGCATGGGGAATGTCCGAAACATCTTCAGGCGTTATTTTCTCAGATGAGTTTACACTGGAAAACACGAGTGATGATGATCGTTTCGTGGAGATCGGTCTCCCGATTCCGGGGTTTAATATGAGAATTACGGATGACCGCAATCAGGTGGTGGAAGAAGGAGAAATCGGACGTTTCCAAGTGTCGGGTCTGACTGTAACAAGCGGTTATTATGAGCGTCCGGACTTAAACGAGAGTGTCTTTACAGAAGACGGCTGGTTTGAAACGGGAGATCTCGGCTTTCTGCGTGAAGGCCGCCTGACGATAACGGGCCGAACGAAAGATGCCATCATTATCAACGGTGTGAATTATTACAGCCAC

[0128] SEQ ID No.8 downstream homology arm of pksJ:

[0129] TCATTACATAATAACAAGCAAGAAGACGGCCGTTCAGAATCGGCTTCTGCGGAGAAAGAGATTGAACGGGATTTTATCCGTTTTCTGAAAGAGGAACTTTCTATCGCGGATGAACTCGTTGATCCGCATACACCGCTTCAAAGTCTTGGCGTCAATTCCATCAAGATGATGAAACTCGCCAGATCGATTGAAAAAACGTATCATATCCGGCTGACGGCGCGAGAGCTGCACAAGAACCCGACCATTGGCGCTTTAGCGGCTTATACCGCTGAAAAAGCGGGTAGCACCTCCGCTGATCATCATCCCGCAAAAGCCGAGCTGCCGGCAGAACGTGAGAAACAGAAAACGGCGCCAGCGCTTTCAGAAGTGCAAAAAGGGCTGTGGACATTGCAGAAAATGTCGCCTGAAACGACTGCATACCATGTCCCGCTCTGTTTCCGATTCACATCAGGAATCAACAAAGAGAAAATGAAGCAGGCGTTTCAGCTCGTATTAACACA

[0130] SEQ ID No.9 amyS promoter:

[0131] GAAATTAAAAAGCTGGCGGATGAAGGACGCATCCGCTGGATTCCCCGGAGAATTGAAATGAAAGATCTCAAGCCCGCTTTTTCATTATTGCCGCGACAAATGACCGAGGCGTGAATCAGGAGATAGCCGCAAACGCTTCTGAAACGCAGCTGGTCAACTGTGTAAGCAAGGCTGAACAAGGCAGCGTATATATGCCGAAGATCATCCGCAAAGGGCGCATTCAAGTATCAGTATCAACAAGCGGGGCAAG CCCCGCACATACGAAAAGACTGGCTGAAAACATTGAGCCTTTGATGACTGATGATTTGGCTGAAGAAGTGGATCGATTGTTTGAGAAAAGAAGAAGACCATAAAAATACCTTGTCTGTCATCAGACAGGGTATTTTTTATGCTGTCCAGACTGTCCGCTGTGTAAAAAATAGGAATAAAGGGGGGTTGTTATTATTTTACTGATATGTAAAATATAATTTGTATAAGAAAATGAGAGGGAGAGGAAACATG

[0132] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. Utilize fC A method for genetically enhancing the ability of Bacillus amyloliquefaciens to synthesize 1-deoxynojirimycin, characterized in that: The method comprises the fC Genes, including fC Gene expression cassette or containing fC The gene vector is introduced into Bacillus amyloliquefaciens; described fC The nucleotide sequence of the gene is shown in SEQ ID No. 1; Said inclusion fC The gene expression cassette comprises a promoter, the fC genes and terminators; Said inclusion fC The gene vector is selected from plasmid, viral vector or artificial chromosome; The Bacillus amyloliquefaciens is Bacillus amyloliquefaciens LH-2, its name is: LH-2, classification name is: Bacillus amyloliquefaciens , the deposit number is: CGMCC No.29550.

2. A kind of included fC A recombinant strain of Bacillus amyloliquefaciens that enhances the ability of Bacillus amyloliquefaciens to synthesize 1-deoxynojirimycin, fC The nucleotide sequence of the gene is shown in SEQ ID No. 1; The Bacillus amyloliquefaciens is Bacillus amyloliquefaciens LH-2, its name is: LH-2, classification name is: Bacillus amyloliquefaciens , the deposit number is: CGMCC No.29550.

3. The method for constructing a recombinant strain according to claim 2, wherein: The steps include: First, the fC The plasmid pLH2389 carrying the gene was introduced into Bacillus amyloliquefaciens LH-2 competent cells, and preliminary transformants were obtained by screening using LB medium containing 5 μg / mL chloramphenicol. The transformants were passaged at 42°C for three times, with transfer every 12 hours, to induce single crossover between the plasmid and the genome, and integration was confirmed by PCR. Subsequently, further high-temperature passage was performed to promote double crossover recombination, and double crossover strains were screened using LB medium containing 25 μg / mL 5-fluorouracil. PCR detection was used to confirm the integration of the transformants. fC Stable integration of gene overexpression structure; finally, sensitive strains were screened by chloramphenicol sensitivity test, residual plasmids were excluded, and the accuracy of gene editing was verified by sequencing, and finally genetically stable strains were successfully obtained. fC Overexpression recombinant strains.

4. Use of the recombinant strain according to claim 2 in enhancing the fermentation production of 1-deoxynojirimycin.

5. A method for producing 1-deoxynojirimycin by fermentation using the recombinant strain according to claim 2, characterized in that: The steps include: The recombinant strain was removed from the ultra-low temperature freezer and streaked onto LB solid medium. The culture was incubated at 37°C for 12 hours to grow a single strain. The single colony was transferred to 5 mL of fresh LB liquid medium and incubated at 37°C and 200 rpm for 12 hours to prepare a seed culture. The seed solution of the cultured bacteria was inoculated into the fermentation medium at an inoculum rate of 4% and incubated at 37°C and 100 rpm for 72 hours to ferment 1-deoxynojirimycin. The formula of the fermentation medium is: (NH4)2SO4: 4g / L, lactose: 25g / L, K2HPO4: 14g / L, KH2PO4: 6g / L, MgSO4·7H2O: 0.2g / L, CaCl2: 0.15g / L, MnSO4·H2O: 1.9mg / L, FeCl3·6H2O: 37.8mg / L, ZnCl2: 7mg / L, the solvent is water, pH 7.0, and sterilization is at 121°C for 20 min.

Images