Mogroside V total synthesis yeast engineering bacterium for enhancing UDPG pathway and application of mogroside V total synthesis yeast engineering bacterium

Abstract

The invention relates to the field of microbial engineering, in particular to mogroside V total synthesis yeast engineering bacteria for enhancing a UDPG (uridine diphosphate glycosyl) pathway and application of the yeast engineering bacteria. According to the mogroside V total synthesis yeast engineering bacterium for enhancing the UDPG pathway and the application thereof, by optimizing and transforming chassis cells, the metabolic pathway of microorganisms is changed or the expression level of related genes is regulated and controlled, so that the synthesis efficiency and the yield of a target product are increased, and the production efficiency is improved.

Description

Technical Field

[0001] The invention relates to the field of microbial engineering, and in particular to a yeast engineering bacterium capable of fully synthesizing mogroside V by enhancing a UDPG pathway and application thereof. Background Art

[0002] Monk fruit is a plant of the Cucurbitaceae family whose fruit is used as a traditional herbal medicine and contains a variety of bioactive components.

[0003] Mogrol and mogroside are the most commonly used active ingredients in monk fruit.

[0004] Among them, mogrosanol and its derivative mogroside are a type of cucurbitane-type triterpene glycosides, among which mogroside is a cucurbitane-type triterpene glycoside, and its aglycone is mogrosanol. The structure of mogrosanol is as follows:

[0005]

[0006] In recent years, the pharmacological effects of Mogrol have attracted widespread attention from researchers. Some studies have shown that Mogrol can inhibit the signaling pathways of ERK1 / 2 and STAT3, while reducing the activity of CREB and activating AMPK. It has the potential to be used for antioxidant, anti-inflammatory and hypoglycemic effects. In in vitro cell experiments, it was found that Mogrol induced G0 / G1 cycle arrest of the cell cycle in a dose-dependent manner and had effective anti-tumor cell proliferation activity.

[0007] Mogroside is a general term for a variety of mogrosides isolated and identified from monk fruit. The basic structure is as follows:

[0008]

[0009] Mogrosides share the same triterpene core of mogroside alcohol. The aglycone mogroside is glycosylated with different numbers of glucose moieties to form a variety of mogroside compounds. Different numbers of glucose moieties and connection methods produce different mogrosides, such as mogroside IIE, mogroside V, mogroside IV, and simoneoside I. These mogrosides have great differences in taste. For example, mogroside IIE is the main saponin component of immature monk fruit and tastes extremely bitter. As the monk fruit grows, it is successively transformed into mogroside II1, mogroside IV, etc., and finally becomes pentaglycosylated mogroside V with an extremely sweet taste.

[0010] The sweetness of mogroside V is about 300-400 times that of sucrose. It not only has antitussive, expectorant, and antioxidant effects, but can also be used as a sugar substitute. Compared with artificial saccharin, it is more natural, healthy, and has no side effects. It is a good additive for the food of diabetics and obese people. The structure of mogroside V is shown below:

[0011]

[0012] Traditionally, mogrosanol and mogroside are obtained by water extraction of the fruit of monk fruit, followed by concentration and separation. Generally, the monk fruit is chopped or crushed, soaked in water or other solvents, and then filtered and concentrated, separated and further purified to obtain high-purity mogrosanol or mogroside. This method can maintain the naturalness of the product, but the content of mogrosanol and mogroside in monk fruit is extremely low, usually only about 1%. There are also many difficulties in the cultivation of monk fruit. Large-scale preparation is difficult and costly, and it is difficult to form mass production through plant extraction, which limits its wide application. Mogrosanol can also be prepared by acid / base hydrolysis using mogrosanol as raw material, but it is also very difficult to obtain mogrosanol, and the cost even exceeds that of mogrosanol. In addition, the conditions of the hydrolysis reaction are relatively violent, the stability is poor, and it is difficult to obtain a stable final product. In contrast, the use of biological total synthesis can reduce costs and prepare mogrosanol and mogroside on a large scale, with strong controllability and stable products.

[0013] Transcriptome and metabolomics analysis is an effective strategy to elucidate the biosynthetic pathways of natural products in plants. In 2016, Israeli researchers Itkin et al. achieved a complete analysis of the biosynthetic pathway of mogroside V based on the transcriptome and genome data of Luo Han Guo. In the initial stage of the metabolic pathway for de novo synthesis of mogrosides using glucose as the starting substrate, glucose undergoes glycolysis from pyruvate to produce acetyl-CoA, which is then converted into 2,3-oxidized squalene from acetyl-CoA via the MVA pathway, and is further metabolized into disaccharide-containing tetrahydroxycucurbitadienol, which is then oxidized to produce mogroside alcohol, and mogroside alcohol is branched and glycosylated to produce sweet mogroside IV, mogroside V, etc. Figure 1 This is a schematic diagram of the biosynthetic pathway of mogroside V, from "Progress in Synthetic Biology of Mogroside V" by Sun Zemin. This diagram basically explains the biosynthetic pathway of mogroside V. This application is also based on the optimization and improvement of this synthetic pathway.

[0014] Using glucose as the starting substrate, the synthesis of mogroside or mogroside from scratch by microorganisms can precisely control the synthesis steps and conditions to obtain the desired products, and the products are of high purity, safe and environmentally friendly, which cannot be achieved by chemical synthesis. However, the metabolic pathway of microbial de novo synthesis is long, the competitive path network is complex, and the stability and metabolic capacity of the chassis cells are required to be high. Therefore, the chassis cells need to be modified to produce specific compounds or increase the yield of specific metabolites.

[0015] With the advancement of synthetic biology research and the in-depth understanding of the biosynthesis mechanism of sweet glycoside molecules in Momordica, the use of microorganisms to synthesize mogroside has become a new way for large-scale production. In the biosynthesis of mogroside, UDPG (uridine diphosphate glucose) plays a key role as a donor of glucose groups to provide glucose molecules to triterpenoids. For example, UDP-glucosyltransferases (UGTs) use UDPG to connect glucose groups at the C3 and C24 positions of the triterpene core of mogroside, thereby forming mogroside V and giving it sweetness and biological activity. However, insufficient UDPG supply has become the main bottleneck limiting the synthetic flux. In synthetic biology, the high consumption rate of UDPG and the limited natural supply pathway make the glucosylation process unable to be completed efficiently, significantly affecting the synthetic efficiency and yield of mogroside. The main disadvantages of existing mogroside biosynthesis technology include: 1) insufficient supply of UDPG donors, resulting in low synthesis efficiency and limiting the synthetic flux; 2) the efficiency and specificity of UGT enzymes still have room for improvement. Summary of the invention

[0016] In view of this, the present invention provides a yeast engineered bacterium for the total synthesis of mogroside V with enhanced UDPG pathway and its application, which increases the synthesis efficiency and yield of the target product and improves production efficiency by optimizing and transforming the chassis cells, changing the metabolic pathway of the microorganism or regulating the expression level of related genes. In addition, the present invention also enhances the utilization rate of UDPG and the overall efficiency of biosynthesis by strengthening the UDPG pathway of the microorganism and optimizing the activity of UGT enzymes, thereby achieving efficient and sustainable production of mogroside.

[0017] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0018] The biosynthesis of mogroside involves multiple steps, among which UDPG plays a key role as a glycosyl donor in the glycosylation reaction. The insufficient supply of UDPG is the main factor limiting the synthesis of glycoside products. The present invention provides a total synthesis strain with enhanced UDPG pathway, which can enhance the synthesis flux of mogroside and improve the synthesis efficiency and yield. The main technical scheme is: by enhancing the UDPG pathway, increasing the supply of UDPG, thereby increasing the synthesis flux, using glucose as the starting material, and preparing simonoside I and / or mogroside V by total synthesis.

[0019] The specific technical means of the present invention are:

[0020] Knockout of G1P metabolic enzyme gene GAL7;

[0021] Overexpression of UDPG synthesis pathway gene HXK (increased copy number, PGAL1 promoter regulation);

[0022] Overexpression of PGM1 (increased copy number, PGAL10 promoter regulation);

[0023] Overexpression of PGM2 (increased copy number, PGAL10 promoter regulation);

[0024] Overexpression of UGP1 (regulated by PGAL1 promoter).

[0025] In summary, in a first aspect, the present invention provides the use of any one of the following or a combination thereof in the preparation of mogroside V;

[0026] (I), knocking out the G1P metabolic enzyme gene GAL7; and / or

[0027] (II), overexpression of UDPG synthesis pathway gene HXK1; and / or

[0028] (III), overexpression of PGM1; and / or

[0029] (IV), overexpression of PGM2; and / or

[0030] (V) Overexpression of UGP1.

[0031] In some embodiments of the invention, the use comprises enhancing the UDPG pathway.

[0032] In some specific embodiments of the present invention, any one of the following or a combination thereof further comprises:

[0033] (VI), screening and replacing CPR genes, selecting CPR1, CPR2, and CPR3;

[0034] The CPR1 sequence is shown as SEQ ID No.92;

[0035] The CPR2 sequence is shown as SEQ ID No.93;

[0036] The CPR3 sequence is shown as SEQ ID No.94;

[0037] and / or

[0038] (VII), increasing the copy number of P450 enzyme CYP87D18 to 2 to 4 copies; and / or

[0039] (VIII) Reducing the expression intensity of CPR by replacing a relatively weak constitutive promoter;

[0040] The relatively weak constitutive promoters include: PGI1p, HXT7p or PGK1p.

[0041] In some specific embodiments of the present invention, any one of (VI) to (VIII) or a combination thereof improves the catalytic efficiency of cytochrome P450 (CYP450).

[0042] In some specific embodiments of the present invention, any one of the following or a combination thereof further comprises:

[0043] (IX), integration into SgCDS, SgEPH3, CYP87D18 and / or SgCPR1; and / or

[0044] (X), integrated into UGT720-269-1; and / or

[0045] (XI), integrated into UGT94-289-3.

[0046] In some specific embodiments of the present invention, any one of the following or a combination thereof further comprises:

[0047] (XII), down-regulating the expression of endogenous gene ERG7; and / or

[0048] (XIII), knocking out the gene encoding the GAL4 inhibitory protein GAL80; and / or

[0049] (XIV), overexpression of squalene epoxidase SQE (GAL80) from Momordica grosvenori, cytochrome b5 (RsCyb5,511b) from Rubus sweetleaf, or yeast phospholipid biosynthesis regulatory gene INO2 (ER size regulator, replacement promoter).

[0050] In some specific embodiments of the present invention, any one of the following or a combination thereof further comprises:

[0051] (XV), overexpression of tHMG1 and IDI1 (308a), key rate-limiting genes for terpenoid synthesis in the MVA pathway; and / or

[0052] (XVI), a mutant gene upc2-1(416d) that overexpresses the global transcription factor UPC2; and / or

[0053] (XVII), overexpression of genes for acetaldehyde dehydrogenase ALD6 (1622b), pyruvate decarboxylase PDC1 (1021b), acetyl-CoA synthetase ACS1 (911b); and / or

[0054] (XVIII), knocking out the isocitrate dehydrogenase IDH1 gene; and / or

[0055] (XIX), a gene that overexpresses the citrate lyase ACL of Rhodosporidium toruloides; and / or

[0056] (XX), overexpression of the gene of alcohol dehydrogenase ADH2 (208a) from rice base rot pathogen.

[0057] In a second aspect, the present invention further provides a gene expression cassette, comprising any one or a combination of the following:

[0058] (I), knocking out the G1P metabolic enzyme gene GAL7; and / or

[0059] (II), overexpression of UDPG synthesis pathway gene HXK1; and / or

[0060] (III), overexpression of PGM1; and / or

[0061] (IV), overexpression of PGM2; and / or

[0062] (V) Overexpression of UGP1.

[0063] In some specific embodiments of the present invention, the gene expression cassette further comprises:

[0064] (VI), CPR1, CPR2, CPR3;

[0065] The CPR1 sequence is shown as SEQ ID No.92;

[0066] The CPR2 sequence is shown as SEQ ID No.93;

[0067] The CPR3 sequence is shown as SEQ ID No.94; and / or

[0068] (VII), P450 enzyme CYP87D18; and / or

[0069] (VIII), relatively weak constitutive promoter;

[0070] The relatively weak constitutive promoters include: PGI1p, HXT7p or PGK1p.

[0071] In some specific embodiments of the present invention, the gene expression cassette further comprises:

[0072] (IX), SgCDS, SgEPH3, CYP87D18 and / or SgCPR1; and / or

[0073] (X), UGT720-269-1; and / or

[0074] (XI), UGT94-289-3.

[0075] In some specific embodiments of the present invention, the gene expression cassette further comprises:

[0076] (XII), down-regulated endogenous gene ERG7; and / or

[0077] (XIII) does not include a gene encoding the GAL4 inhibitory protein GAL80; and / or

[0078] (XIV), overexpressed squalene epoxidase SQE (GAL80) from Momordica grosvenori and cytochrome b5 (RsCyb5,511b) from Rubus sweetleaf, interacted with yeast phospholipid biosynthesis regulatory gene INO2 (ER size regulator, replacement promoter).

[0079] In some specific embodiments of the present invention, the gene expression cassette further comprises:

[0080] (XV), overexpression of tHMG1 and IDI1 (308a), key rate-limiting genes for terpenoid biosynthesis in the MVA pathway; and / or

[0081] (XVI), overexpression of a mutant gene of the global transcription factor UPC2, upc2-1(416d); and / or

[0082] (XVII), overexpressed genes of acetaldehyde dehydrogenase ALD6 (1622b), pyruvate decarboxylase PDC1 (1021b), acetyl-CoA synthetase ACS1 (911b); and / or

[0083] (XVIII), genes excluding isocitrate dehydrogenase IDH1; and / or

[0084] (XIX), the gene for citrate lyase ACL of overexpressed Rhodosporidium toruloides; and / or

[0085] (XX), overexpressed gene of alcohol dehydrogenase ADH2 (208a) from rice base rot fungus.

[0086] In a third aspect, the present invention also provides a construct comprising the gene expression cassette.

[0087] In a fourth aspect, the present invention further provides a host, comprising any of the following:

[0088] (i), the gene expression cassette; and / or

[0089] (ii) the construct.

[0090] In some specific embodiments of the present invention, the host includes but is not limited to yeast.

[0091] In some specific embodiments of the present invention, the host comprises Saccharomyces cerevisiae.

[0092] In a fifth aspect, the present invention also provides a method for constructing a yeast engineering bacterium, comprising the following steps:

[0093] (I), knocking out the G1P metabolic enzyme gene GAL7; and / or

[0094] (II), overexpression of UDPG synthesis pathway gene HXK1; and / or

[0095] (III), overexpression of PGM1; and / or

[0096] (IV), overexpression of PGM2; and / or

[0097] (V) Overexpression of UGP1.

[0098] In some specific embodiments of the present invention, the method for constructing an engineered yeast strain further comprises the following steps:

[0099] (VI) Screening and replacing CPR genes, using artificially synthesized CPR1, CPR2, and CPR3;

[0100] The CPR1 sequence is shown as SEQ ID No.92;

[0101] The CPR2 sequence is shown as SEQ ID No.93;

[0102] The CPR3 sequence is shown as SEQ ID No.94;

[0103] and / or

[0104] (VII), increase the copy number of P450 enzyme CYP87D18 to 2-4 copies;

[0105] (VIII) Reduce the expression intensity of CPR by replacing a relatively weak constitutive promoter.

[0106] In some specific embodiments of the present invention, the method for constructing an engineered yeast strain further comprises:

[0107] (IX), integration into SgCDS, SgEPH3, CYP87D18 and / or SgCPR1; and / or

[0108] (X), integrated into UGT720-269-1; and / or

[0109] (XI), integrated into UGT94-289-3.

[0110] In some specific embodiments of the present invention, the method for constructing an engineered yeast strain further comprises:

[0111] IPP and DMAPP generate squalene under the action of endogenous ERG20 and ERG9, and then catalyzed by ERG1 to generate 2,3; 22,23-diepoxysqualene; and / or

[0112] (XII), down-regulating the expression of endogenous gene ERG7; and / or

[0113] (XIII), knocking out the gene encoding the GAL4 inhibitory protein GAL80; and / or

[0114] (XIV), overexpressing squalene epoxidase SQE (GAL80) from monk fruit, cytochrome b5 (RsCyb5,511b) from sweet leafed raspberry, and yeast phospholipid biosynthesis regulatory gene INO2 (ER size regulator, replacement promoter) to expand the space of the endoplasmic reticulum.

[0115] In some specific embodiments of the present invention, the method for constructing an engineered yeast strain further comprises:

[0116] (XV), overexpression of tHMG1 and IDI1 (308a), key rate-limiting genes for terpenoid synthesis in the MVA pathway; and / or

[0117] (XVI), a mutant gene upc2-1(416d) that overexpresses the global transcription factor UPC2; and / or

[0118] (XVII), overexpression of acetaldehyde dehydrogenase ALD6 (1622b), pyruvate decarboxylase PDC1 (1021b), acetyl-CoA synthetase ACS1 (911b); and / or

[0119] (XVIII), knocking out isocitrate dehydrogenase IDH1; and / or

[0120] (XIX), overexpression of citrate lyase ACL from Rhodosporidium toruloides; and / or

[0121] (XX), overexpression of alcohol dehydrogenase ADH2 (208a) from rice base rot pathogen.

[0122] In a sixth aspect, the present invention further provides the use of any one of the following or a combination thereof in the preparation of mogroside V;

[0123] (i), the gene expression cassette; and / or

[0124] (ii), the construct; and / or

[0125] (iii), the host; and / or

[0126] (iv) The engineered yeast obtained by the above scheme.

[0127] In a seventh aspect, the present invention also provides a method for preparing mogroside V, comprising:

[0128] (i), integrating the gene expression cassette; and / or

[0129] (ii), transforming the construct; and / or

[0130] (iii), fermentation culture of the host; and / or

[0131] (iv) fermenting and culturing the engineered yeast obtained by the method;

[0132] The fermentation broth was collected and purified.

[0133] The present invention provides a yeast engineering bacterium for the full synthesis of mogroside V with enhanced UDPG pathway and its application, which increases the synthesis efficiency and yield of the target product and improves the production efficiency by optimizing and transforming the chassis cells, changing the metabolic pathway of the microorganism or regulating the expression level of related genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0134] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0135] Figure 1 Schematic diagram showing the biosynthetic pathway of mogroside V;

[0136] Figure 2 The CYP87D18 conversion rate in Example 1 is shown;

[0137] Figure 3 The output of mogrosanol in Example 10 is shown;

[0138] Figure 4 The yields of mogroside I-A1 and mogroside II E in Example 10 are shown;

[0139] Figure 5 The yields of mogroside III X, mogroside IV A, simenoside I and mogroside V in Example 10 are shown. DETAILED DESCRIPTION

[0140] The present invention discloses a yeast engineering bacterium for the total synthesis of mogroside V that enhances the UDPG pathway and its application. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It is particularly important to point out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0141] The metabolic pathway of de novo synthesis is long, with many steps and a complex metabolic network. The metabolic capacity of yeast itself can only produce trace amounts of non-specific compounds, which requires precise regulation and optimization to change the metabolic pathway of the microorganism or regulate the expression level of related genes, thereby increasing the synthesis efficiency and yield of the target product and improving production efficiency.

[0142] The main technical solution of the present invention is: chassis modification, by strengthening chassis cells to increase the supply of precursors, weaken competition pathways, screen for high gene expression, and thereby achieve the purpose of increasing the yield of the target product.

[0143] More specifically, first, in module 1, the supply of precursors is increased by strengthening the MVA pathway and the acetyl-CoA pathway, thereby achieving the purpose of increasing the yield of the target; second, in module 2, the metabolism of biosynthetic intermediates is reduced by weakening the expression of the competitive pathway, thereby achieving the purpose of increasing the yield of the target. Third, in module 2, the activity of the oxidoreductase (CPR) is increased to improve the efficient expression of cytochrome P450 (CYP450), thereby achieving the purpose of increasing the yield of the target.

[0144] Regarding the strategy of strengthening the MVA pathway and the acetyl-CoA pathway to increase the supply of precursors, the specific technical means are:

[0145] Overexpression of tHMG1 and IDI1 (308a), the key rate-limiting genes for terpenoid biosynthesis in the MVA pathway;

[0146] Overexpression of the mutant gene upc2-1(416d) of the global transcription factor UPC2 directly or indirectly upregulates the transcription efficiency of MVA pathway genes;

[0147] Overexpression of acetaldehyde dehydrogenase ALD6 (1622b), pyruvate decarboxylase PDC1 (1021b), acetyl-CoA synthetase ACS1 (911b), knockout of isocitrate dehydrogenase IDH1, overexpression of citrate lyase ACL from Rhodosporidium toruloides, overexpression of alcohol dehydrogenase ADH2 (208a) from basal rot of rice, to increase the supply of acetyl-CoA;

[0148] To reduce the expression of competing pathways, the specific technical means are:

[0149] Down-regulate the expression of the endogenous gene ERG7 and reduce the consumption of 2,3-epoxysqualene;

[0150] Knocking out the gene encoding the GAL80 inhibitory protein of GAL4 frees the expression of the GAL gene from the control of the costly galactose and responds to the glucose concentration in the culture medium;

[0151] Overexpression of squalene epoxidase SQE (GAL80) from monk fruit; overexpression of cytochrome b5 (RsCyb5,511b) from sweet leafed raspberry; overexpression of yeast phospholipid biosynthesis regulatory gene INO2 (ER size regulator, replacement promoter) to expand the space of the endoplasmic reticulum.

[0152] To improve the catalytic efficiency of cytochrome P450 (CYP450), the specific technical means are:

[0153] Screen and replace CPR genes, using artificially synthesized CPR1, CPR2, and CPR3.

[0154] Increase the copy number of P450 enzyme CYP87D18 to 2-4 copies.

[0155] By replacing a relatively weak constitutive promoter, the expression strength of CPR is reduced.

[0156] In the yeast engineering bacteria for the full synthesis of mogroside V by enhancing the UDPG pathway provided by the present invention and its application, the raw materials and reagents used can be purchased from the market.

[0157] Chassis cells: yeast cells.

[0158] Preferred: Saccharomyces cerevisiae, Yarrowia lipolytica, Kluyveromyces lactis, Ogataea polymorpha Preferred: Saccharomyces cerevisiae CEN.PK2-1C. Saccharomyces cerevisiae S.cerevisiae CEN.PK2-1C (From China Microbial Culture Bank, No. Bio-116324) For the starting strain Build, transform .

[0159] Table 1. Primer information

[0160]

[0161]

[0162]

[0163] Table 2. Main information of strains

[0164]

[0165] Table 3. Primer information

[0166]

[0167]

[0168] Table 4. Strain information and verification results

[0169] Strain name Target Recombinant expression plasmid MRO001 Expression of CPR1 pESC-HIS-CYP87D18-CPR1 MRO002 Expression of CPR2 pESC-HIS-CYP87D18-CPR2 MRO003 Expression of CPR3 pESC-HIS-CYP87D18-CPR3 MRO004 Expression of CaCPR1 pESC-HIS-CYP87D18-CaCPR1 MRO005 Expression of SgCPR1 pESC-HIS-CYP87D18-SgCPR1

[0170] Table 5. Strain information

[0171] Strain name Chassis Cell Target M24 Strain interM-02 Plasmid-based introduction of CPR1 M25 Strain interM-02 Plasmid-based introduction of CPR2 M26 Strain interM-02 Plasmid-based introduction of CPR3

[0172] Table 6. Primer information

[0173]

[0174]

[0175] Table 7

[0176]

[0177]

[0178] Table 8. Strain information

[0179]

[0180] Table 9. Primer information

[0181]

[0182]

[0183] Sequence information:

[0184] tHMG1 (NCBI Accession: NP_013636.1)

[0185] IDI1 (NCBI Accession: QHB12144.1)

[0186] CYP87D18>ON352538.1 Synthetic construct cytochrome P450-dependent monooxygenase (cyp87d18) gene (NCBI Accession: ON352538.1)

[0187] CPR1 synthetic sequence (as shown in SEQ ID No. 92)

[0188]

[0189] CPR2 synthetic sequence (as shown in SEQ ID No.93)

[0190]

[0191] CPR3 synthetic sequence (as shown in SEQ ID No.94)

[0192]

[0193] CaCPR1>MK737062.1Camptotheca acuminata cytochrome p450 reductase(CPR1)mRNA(NCBI Accession:MK737062.1)

[0194] SgCPR1>MH886510.1Siraitia grosvenorii NADPH:cytochrome P450 reductase(CPR1)

[0195] mRNA (NCBI Accession: MH886510.1)

[0196] SgCDS source Siraiti agrosvenorii (NCBI Accession: ON352536.1)

[0197] SgEPH3SourceSiraitiagrosvenorii (NCBI Accession: ON352537.1)

[0198] CYP87D18 source Siraiti agrosvenorii (NCBI Accession: ON352538.1)

[0199] UGT720-269-1 from Siraitiagrosvenorii (as shown in SEQ ID No.95)

[0200]

[0201] UGT94-289-3 from Siraitiagrosvenorii (as shown in SEQ ID No.96)

[0202]

[0203] GAL7 (shown in SEQ ID No.97)

[0204]

[0205] HXK1 (shown in SEQ ID No.98)

[0206]

[0207] PGM1 (as shown in SEQ ID No.99)

[0208]

[0209] PGM2 (as shown in SEQ ID No. 100)

[0210]

[0211] UGP1 (as shown in SEQ ID No.101)

[0212]

[0213] DPP1 (as shown in SEQ ID No. 102)

[0214] ATGAACAGAGTTTCGTTTATTAAAACGCCTTTCAACATAGGGGCGAAATGGAGATTAGAAGATGTCTTTTTGCTCATTATCATGATACTTCTTAACTACCCAGTGTATTACCAACAACCGTTCGAACGTCAGTTTTACATTAACGATCTCACTATATCGCATCCTTATGCGACAACTGAACGTGTAAATAACAACATGTTGTTTGTTTATAGTTTTGTCGTGCCATCTTTAACCATATTGATAATTGGTTCCATTTTGGCCGATAGAAGACATTTGATTTTTATTTTGTACACATCTCTCCTTGGTTTATCACTCGCTTGGTTCAGTACGAGTTTCTTTACAAACTTCATCAAGAATTGGATTGGAAGACTAAGACCAGATTTTCTAGATCGTTGCCAACCTGTTGAAGGCTTGCCATTGGACACTTTATTTACTGCAAAAGATGTGTGTACGACTAAGAATCACGAACGTCTGTTGGATGGGTTTAGGACAACTCCGTCAGGTCATTCAAGTGAAAGCTTTGCAGGACTGGGTTATTTGTACTTCTGGCTATGTGGGCAACTTTTGACTGAATCACCGTTGATGCCTTTATGGAGAAAAATGGTGGCCTTTCTACCACTGTTAGGAGCTGCACTAATTGCTCTATCCAGAACTCAAGATTACAGACATCATTTCGTCGATGTAATTTTAGGGTCTATGTTGGGTTATATAATGGCACACTTTTTCTACAGAAGAATCTTCCCACCCATTGATGATCCTCTTCCGTTCAAACCATTGATGGACGATTCAGATGTCACCCTGGAGGAAGCAGTCACCCATCAGAGGATCCCGGATGAGGAATTACATCCTTTGTCCGATGAAGGTATGTAA

[0215] The present invention will be further described below in conjunction with embodiments:

[0216] Example 1 Construction of MOG001 strain

[0217] Overexpression of tHMG1 and IDI1

[0218] 1) The target gene was integrated into the Saccharomyces cerevisiae genome using the GTR-CRISPR-Cas9 gene editing system, and a plasmid carrying a gene expressing the Cas9 protein and a sgRNA sequence targeting the corresponding site was constructed for targeted gene integration. First, the gRNA sequence of the 308a integration site was predicted using the online website Zhang Lab's CRISPOR (http: / / crispor.tefor.net / ), and a gRNA sequence with high efficiency and no off-target was selected; primers containing the gRNA sequence were designed (see Table 1), and PCR amplification was performed using the plasmid pScURA as a template to obtain a gene fragment containing the corresponding gRNA and the screening marker Ura, and then the DNA fragment was connected to the pCas9 plasmid using the Golden Gate Assembly kit to obtain the knockout plasmid pCas9-308a. Primers for Donor construction were designed (see Table 1 ), and the Donor DNA gene fragment contained 50 bp of upstream and downstream homology arms, the promoter, and the inserted gene sequence. Donor DNA was obtained by OE-PCR: up-GAL1p-tHMG1-GAL10p-IDI1-down;

[0219] 2) The up-GAL1p-tHMG1-GAL10p-IDI1-down and pCas9-308a plasmids were co-transformed into S.cerevisiae CEN.PK2-1C competent cells by electroporation, and the PGAL-target gene expression cassette was integrated using the homologous recombination ability of Saccharomyces cerevisiae itself. The SC-URA plates were coated and cultured at 30°C for 2-3 days. The positive clones were screened by colony PCR and sequenced. The single clones verified by PCR were re-streaked on SC plates containing 5-FOA (5-fluoroorotic acid) and cultured at 30°C to eliminate the Cas9 plasmid. The single clones grown on the SC (containing 5-FOA) plates were streaked on YPD and SC-URA plates respectively and cultured at 30°C. The bacteria that grew on the YPD plate but not on the SC-URA plate were gene-edited bacteria. The single clones were selected in YPD liquid culture medium and cultured at 30°C for 24 hours to preserve the strains (20% glycerol) to obtain the chassis strain MOG001. The strain information is shown in Table 2.

[0220] Example 2 Construction of strains interM-01 and interM-02

[0221] 1. The same method as steps 1)-2) of “1. Overexpression of tHMG1 and IDI1 in Example 1” was used, and the primers involved are listed in Table 9.

[0222] The difference is that: step 2) is to co-transform the knockout plasmid pCas9-1309a and donor DNA: up-GAL1p-SgCDS-down into MOG001 chassis cells to obtain strain interM-01, and preserve the strain for later use (20% glycerol).

[0223] 2. The same method as steps 1)-2) of "overexpression of tHMG1 and IDI1 in Example 1" was used, and the primers involved are listed in Table 9. The difference is that in step 2), the knockout plasmid pCas9-106a and donor DNA: up-GAL10p-SgEPH3-down were co-transformed into interM-01 to obtain strain interM-02, and the strain was preserved for later use (20% glycerol).

[0224] Example 3 Screening and verification of CPR genes

[0225] 1. Strain Construction

[0226] (1). Full gene synthesis of CYP87D18, CPR1, CPR2, CPR3, CaCPR1, and SgCPR1 was performed, and recombinant expression plasmids were constructed using pESC-HIS as a vector.

[0227] Primers were designed (Table 3). First, the primers were used to amplify the CYP87D18 and linearized pESC-HIS vector fragments carrying homology arms. According to the instructions of the kit, the DNA fragment and the linearized vector fragment were subjected to homologous recombination reaction. After reacting at 50°C for 1 hour, E. coli DH5α competent cells were transformed and Amp-resistant plates were coated and cultured at 37°C overnight. Positive clones were screened by colony PCR, and positive clones were picked in 5 mL of LB medium containing Amp for sequencing verification. The plasmid pESC-HIS-CYP87D18 (MCS1) with correct sequencing was extracted for use.

[0228] (2) Use the corresponding primers to amplify the CPR1 carrying the homology arms and the linearized pESC-HIS-CYP87D18 (MCS1) vector fragment. The recombination reaction is the same as "(1)". Screen the positive clones by colony PCR, pick the positive clones and place them in 5 mL of LB medium containing Amp, sequence and verify, and extract the plasmid pESC-HIS-CYP87D18-CPR1 with the correct sequencing.

[0229] The construction process of CPR2 was the same as that of “(2)”, and the plasmid pESC-HIS-CYP87D18-CPR2 with correct sequencing was extracted.

[0230] The construction process of CPR3 was the same as that of “(2)”, and the plasmid pESC-HIS-CYP87D18-CPR3 with correct sequencing was extracted.

[0231] The construction process of CaCPR1 was the same as that of “(2)”, and the plasmid pESC-HIS-CYP87D18-CaCPR1 with correct sequencing was extracted.

[0232] The construction process of SgCPR1 was the same as that of “(2)”, and the plasmid pESC-HIS-CYP87D18-SgCPR1 with correct sequencing was extracted.

[0233] (3) Use electroporation to transform the recombinant expression plasmid pESC-HIS-CYP87D18-CPR1 into Saccharomyces cerevisiae CEN.PK2-1C competent cells, apply to SC-HIS plates, and culture at 30°C for 2-3 days. Screen positive clones by colony PCR, inoculate them into 10 mL of SC-HIS liquid culture medium, and culture at 30°C and 230 rpm for 24 hours to preserve strain MRO001.

[0234] In the same way, pESC-HIS-CYP87D18-CPR2 was transformed into S. cerevisiae CEN.PK2-1C to obtain strain MRO002;

[0235] pESC-HIS-CYP87D18-CPR3 was transformed into S. cerevisiae CEN.PK2-1C to obtain strain MRO003;

[0236] pESC-HIS-CYP87D18-CaCPR1 was transformed into S. cerevisiae CEN.PK2-1C to obtain strain MRO004;

[0237] pESC-HIS-CYP87D18-SgCPR1 was transformed into Saccharomyces cerevisiae CEN.PK2-1C to obtain strain MRO005.

[0238] The strain information is shown in Table 4.

[0239] 2. Verification experiment:

[0240] Take 1mL of the above bacterial solution and inoculate it into 50mL of fresh SC-HIS liquid medium, and culture it at 30℃ and 230rpm until the growth plateau phase. Centrifuge at 3,000rpm for 5min at room temperature, discard the supernatant, and collect the Saccharomyces cerevisiae cells. Add about 50mL of sterile water to resuspend and wash the cells, centrifuge at 3,000rpm for 5min at room temperature, and collect the cells. Repeat this step three times, resuspend the cells with about 2mL of YPGal liquid medium containing 2% galactose, and add it to 100mL of YPGal liquid medium containing 2% galactose, and induce and culture it at 28℃ and 230rpm for 24h. After the induction, centrifuge the bacterial solution at 3,000rpm and 4℃ for 5min to collect the cells. Resuspend the cells with Tris-HCl buffer (50mM, pH8.0), wash them three times, resuspend them according to 1g of cells with 3mL buffer, add glass beads to shake and break the yeast cells, let them stand, and collect the cell rupture liquid.

[0241] P450 catalytic activity test: 100 μL reaction system contains 50 mM Tris-HCl buffer (50 mM, pH 8.0), 1 mM 24,25-dihydroxycucurbitadienol, 5 mM NADPH and appropriate amount of cell disruption solution, 30 ° C, 230 rpm reaction for 2 h, adding an equal volume of methanol to quench the reaction, centrifuging at 12,000 rpm for 10 min, and filtering the supernatant with a 0.22 μm filter membrane and HPLC detection. The strain information and HPLC detection results are shown in Table 10.

[0242] Table 10. CYP87D18 conversion rate

[0243] strain 1con% 2con% 3con% average value SD MRO001 60.87 60.91 60.73 60.83666667 0.077172246 MRO002 87.39 88.01 88.32 87.90666667 0.38663793 MRO003 58.43 59.01 58.98 58.80666667 0.266624997 MRO004 23.45 24.12 22.98 23.51666667 0.467784376 MRO005 39.46 40.12 39.98 39.85333333 0.283940526

[0244] From the results in Table 10, it can be seen that the conversion rates of strains MRO001-003 using CPR1-3 are higher than those of strains CaCPR1 and SgCPR1, among which strain MRO002 using CPR2 has the best catalytic efficiency.

[0245] Example 4 Expression and Optimization of CPR Genes

[0246] 1. The application of CPR1-3 in the de novo synthesis of mogroside alcohol was verified in plasmid form. P450 and CPR1-3 were separately transferred into strain interM-02 in plasmid form to obtain strains M24-M26.

[0247] The specific process is as follows:

[0248] (1) Using pIYC04-HIS as a vector, construct the recombinant expression plasmid pIYC04-HIS-P PGK1-CYP87D18. The primers involved are listed in Table 3. The primers were used to amplify the CYP87D18 fragment carrying the homology arm and the linearized pIYC04-HIS vector fragment. According to the instructions of the kit, the DNA fragment and the linearized vector fragment were homologously recombined, reacted at 50°C for 1h, transformed into E.coliDH5α competent cells, coated with Amp-resistant plates and cultured at 37°C overnight. Colony PCR screened positive clones, picked positive clones in 5mL LB medium containing Amp, sequenced and verified, and the recombinant plasmid pIYC04-HIS-P with correct sequencing was extracted. PGK1 -CYP87D18 spare.

[0249] (2) Using corresponding primers to amplify the CPR1 fragment carrying the homology arms and linearize

[0250] pIYC04-HIS-P PGK1 -CYP87D18 vector fragment. The recombination reaction is the same as "(1)". Colony PCR screens positive clones, picks positive clones in 5 mL LB medium containing Amp, and sequence verification is obtained.

[0251] pIYC04-HIS-P PGK1 -CYP87D18-P TEF1 -CPR1 recombinant plasmid for future use.

[0252] The construction process of CPR2 is the same as that of (2). The plasmid with correct sequencing was extracted.

[0253] pIYC04-HIS-P PGK1 -CYP87D18-P TEF1 -CPR2.

[0254] The construction process of CPR3 is the same as that of (2). The plasmid with correct sequencing was extracted.

[0255] pIYC04-HIS-P PGK1 -CYP87D18-P TEF1 -CPR3.

[0256] (3) Using electroporation, the recombinant expression plasmid pIYC04-HIS-P PGK1 -CYP87D18-P TEF1 -CPR1 was transformed into interM-02 competent cells, coated on SC-HIS plates, and cultured at 30°C for 2-3 days. Positive clones were screened by colony PCR, and positive clones were picked and inoculated into 10 mL of SC-HIS liquid medium, cultured at 30°C and 230 rpm for 24 h, and strain M24 was preserved;

[0257] In the same way, pIYC04-HIS-P PGK1-CYP87D18-P TEF1 -CPR2 was transformed into interM-02 to obtain strain M25;

[0258] In the same way, pIYC04-HIS-P PGK1 -CYP87D18-P TEF1 -CPR3 was transformed into interM-02 to obtain strain M26.

[0259] The strain information is shown in Table 5.

[0260] Verification experiment: Detection of Mogrol

[0261] Take out the glycerol bacteria from the -80℃ refrigerator, streak on the SC-HIS plate, and culture at 30℃ for 2-3 days; pick a single colony from the plate and place it in 10mL SC-HIS medium, 30℃, 250rpm, and culture overnight; transfer the seed liquid to a 250mL shake flask containing 25mL SC-HIS liquid medium at a 5% inoculation amount, and ferment and culture at 30℃, 250rpm, with 3 parallels per group; ferment for 120h, take 5mL of fermentation liquid, add glass beads to shake and break the cells for 30min, add an equal volume of ethyl acetate to extract, centrifuge at 12,000rpm for 5min to collect the organic phase, extract repeatedly 3 times, and finally place the organic phase in a 70℃ vacuum drying oven, evaporate the solvent, and re-dissolve with 200μL methanol (containing 1% formic acid) and perform HPLC detection. The results are detailed in Example 9.

[0262] 2. Integrate CPR1-3 strains into chassis cells and optimize promoters. The specific methods are as follows:

[0263] (1) Overexpression of CYP87D18 and CPR1:

[0264] 1) The target gene was integrated into the Saccharomyces cerevisiae genome using the GTR-CRISPR-Cas9 gene editing system, and a plasmid carrying a gene expressing the Cas9 protein and a sgRNA sequence targeting the corresponding site was constructed for targeted gene integration. First, the gRNA sequence of the 308a integration site was predicted using the online website Zhang Lab's CRISPOR (http: / / crispor.tefor.net / ), and a gRNA sequence with high efficiency and no off-target was selected; primers containing the gRNA sequence were designed (see Table 1), and PCR amplification was performed using the plasmid pScURA as a template to obtain a gene fragment containing the corresponding gRNA and the screening marker Ura, and then the DNA fragment was connected to the pCas9 plasmid using the Golden Gate Assembly kit to obtain the knockout plasmid pCas9-308a. Primers for Donor construction were designed (see Table 1 ), and the Donor DNA gene fragment contained 50 bp of upstream and downstream homology arms, the promoter, and the inserted gene sequence. Donor DNA was obtained by OE-PCR: up-GAL1p-tHMG1-GAL10p-IDI1-down;

[0265] 2) The knockout plasmid pCas9-720a and donor DNA: up-GAL1p-CYP87D18-GAL10p-CPR1-down were co-transformed into the strain interM-02, and the homologous recombination ability of Saccharomyces cerevisiae was used to achieve P GAL -Integration of the target gene expression cassette, coated on SC-URA plates, and cultured at 30°C for 2-3 days. Colony PCR screened positive clones and sequenced them. The single clones verified by PCR were re-streaked on SC plates containing 5-FOA (5-fluoroorotic acid) and cultured at 30°C to eliminate the Cas9 plasmid. The single clones grown on SC (containing 5-FOA) plates were streaked on YPD and SC-URA plates respectively, and cultured at 30°C. The bacteria that grew on YPD plates but not on SC-URA plates were gene-edited bacteria. Single clones were selected in YPD liquid culture medium, and the strains were preserved (20% glycerol) after culture at 30°C for 24 hours to obtain strain M27.

[0266] The primers involved are listed in Table 6.

[0267] The same method as step 1)-2) of "overexpression of tHMG1 and IDI1 in Example 1" was used, and the primers involved are listed in Table 6. The difference is that in step 2), the knockout plasmid pCas9-720a and donor DNA: up-GAL1p-CYP87D18-PGI1p-CPR1-down were co-transformed into strain interM-02 to obtain strain M28, and the strain was preserved for later use (20% glycerol);

[0268] The same method as step 1)-2) of "overexpression of tHMG1 and IDI1 in Example 1" was used, and the primers involved are listed in Table 6. The difference is that in step 2), the knockout plasmid pCas9-720a and donor DNA: up-GAL1p-CYP87D18-HXT7p-CPR1-down were co-transformed into strain interM-02 to obtain strain M29, and the strain was preserved for later use (20% glycerol);

[0269] The same method as step 1)-2) of "overexpression of tHMG1 and IDI1 in Example 1" was used, and the primers involved are listed in Table 6. The difference is that in step 2), the knockout plasmid pCas9-720a and donor DNA: up-GAL1p-CYP87D18-PGK1p-CPR1-down were co-transformed into strain interM-02 to obtain strain M30, and the strain was preserved for later use (20% glycerol);

[0270] Using the same method, CYP87D18 and CPR2 and CPR3 regulated by different promoters were integrated into the genome of interM-02 chassis cells to construct strains M31-M38 that synthesize mogroside alcohol from scratch.

[0271] Please see Table 7 for strain information.

[0272] Verification experiment: Detection of Mogrol

[0273] Take out the glycerol bacteria from the -80℃ refrigerator, streak on the YPD plate, and culture at 30℃ for 2-3 days; pick a single colony from the plate and place it in 10mL YPD medium, 30℃, 250rpm, and culture overnight; transfer the seed liquid to a 250mL shaking flask containing 25mL YPD liquid medium at a 5% inoculation amount, and ferment and culture at 30℃, 250rpm, with 3 parallels per group; ferment for 120h, take 5mL of fermentation liquid, add glass beads to shake and break the cells for 30min, extract with an equal volume of ethyl acetate, centrifuge at 12,000rpm for 5min to collect the organic phase, repeat the extraction 3 times, and finally place the organic phase in a 70℃ vacuum drying oven, evaporate the solvent, and re-dissolve with 200μL methanol (containing 1% formic acid) and perform HPLC detection. The results are detailed in Example 6.

[0274] Example 5 Expression of P450 enzyme CYP87D18

[0275] Increase the number of copies of the P450 enzyme CYP87D18

[0276] 1) The GTR-CRISPR-Cas9 gene editing system was used to integrate the target gene into the Saccharomyces cerevisiae genome, and a plasmid carrying a gene expressing the Cas9 protein and an sgRNA sequence targeting the corresponding site was constructed for targeted gene integration. First, the gRNA sequence of the 308a integration site was predicted using the online website Zhang Lab's CRISPOR (http: / / crispor.tefor.net / ), and a gRNA sequence with high efficiency and no off-target was selected; primers containing the gRNA sequence were designed (see Table 1), and PCR amplification was performed using the plasmid pScURA as a template to obtain a gene fragment containing the corresponding gRNA and the screening marker Ura, and then the DNA fragment was connected to the pCas9 plasmid using the Golden Gate Assembly kit to obtain the knockout plasmid pCas9-308a. Donor construction primers were designed (see Table 1), and the Donor DNA gene fragment contained 50bp of upstream and downstream homology arms, a promoter, and an inserted gene sequence. Donor DNA was obtained by OE-PCR:

[0277] up-GAL1p-tHMG1-GAL10p-IDI1-down;

[0278] 2) The knockout plasmid pCas9-1114a and donor DNA: up-GAL1p-CYP87D18-down were co-transformed into strain M30, and the homologous recombination ability of Saccharomyces cerevisiae was used to achieve P GAL -Integration of the target gene expression cassette, coated on SC-URA plates, and cultured at 30°C for 2-3 days. Colony PCR screened positive clones and sequenced them. The single clones verified by PCR were re-streaked on SC plates containing 5-FOA (5-fluoroorotic acid) and cultured at 30°C to eliminate the Cas9 plasmid. The single clones grown on SC (containing 5-FOA) plates were streaked on YPD and SC-URA plates respectively and cultured at 30°C. The bacteria that grew on YPD plates but not on SC-URA plates were gene-edited bacteria. Single clones were picked in YPD liquid culture medium and cultured at 30°C for 24 hours to preserve the strain (20% glycerol) to obtain strain M39. The primers involved are listed in Table 6.

[0279] The same method as steps 1)-2) was used, and the primers involved are listed in Table 6. The difference is that in step 2), the knockout plasmid pCas9-1114a and donor DNA: up-GAL1p-CYP87D18-GAL10p-CYP87D18-down were co-transformed into strain M30 to obtain strain M40, and the strain was preserved for later use (20% glycerol);

[0280] The same method as steps 1)-2) was used, and the primers involved are listed in Table 6. The difference is that in step 2), the knockout plasmid pCas9-1114a and donor DNA: up-GAL1p-CYP87D18-down were co-transformed into strain M34 to obtain strain M41, and the strain was preserved for later use (20% glycerol);

[0281] The same method as steps 1)-2) was used, and the primers involved are listed in Table 6. The difference is that in step 2), the knockout plasmid pCas9-1114a and donor DNA: up-GAL1p-CYP87D18-GAL10p-CYP87D18-down were co-transformed into strain M34 to obtain strain M42, and the strain was preserved for later use (20% glycerol);

[0282] The same method as steps 1)-2) was used, and the primers involved are listed in Table 6. The difference is that in step 2), the knockout plasmid pCas9-1114a and donor DNA: up-GAL1p-CYP87D18-down were co-transformed into strain M38 to obtain strain M43, and the strain was preserved for later use (20% glycerol);

[0283] The same method as steps 1)-2) was used, and the primers involved are listed in Table 6. The difference is that in step 2), the knockout plasmid pCas9-1114a and donor DNA: up-GAL1p-CYP87D18-GAL10p-CYP87D18-down were co-transformed into strain M38 to obtain strain M44, and the strain was preserved for later use (20% glycerol);

[0284] Verification experiment: Detection of Mogrol

[0285] Take out the glycerol bacteria from the -80 refrigerator, streak on the YPD plate, and culture at 30°C for 2-3 days; pick a single colony from the plate and place it in 10mL YPD medium, 30°C, 250rpm, and culture overnight; transfer the seed liquid to a 250mL shake flask containing 25mL YPD liquid medium at a 5% inoculation amount, and ferment and culture at 30°C, 250rpm, with 3 parallels per group; ferment for 120h, take 5mL of fermentation liquid, add glass beads to shake and break the cells for 30min, extract with an equal volume of ethyl acetate, centrifuge at 12,000rpm for 5min to collect the organic phase, repeat the extraction 3 times, and finally place the organic phase in a 70°C vacuum drying oven, evaporate the solvent, and re-dissolve with 200μL methanol (containing 1% formic acid) and perform HPLC detection. The results are detailed in Example 9.

[0286] Example 6 Construction of strains for de novo synthesis of mogroside I-A1 and mogroside II E

[0287] The enzymes required for synthesizing mogroside I-A1 and mogroside II E were transferred into the previously constructed strains M27, M30, M31, M34, M35, M38, M40, M42, and M44 in the form of plasmids to obtain strains MGV06-MGV14 for synthesizing mogroside I-A1 and mogroside II E from scratch.

[0288] The enzymes introduced are:

[0289] UGT720-269-1

[0290] Taking the MGV06 strain as an example, the specific construction process is as follows:

[0291] 1. Construction of UGT720-269-1 recombinant plasmid

[0292] Using pIYC04-HIS as a vector, construct the recombinant expression plasmid pIYC04-HIS-P PGK1 -UGT720-269-1. The primers involved are listed in Table 9, and the primers are used to amplify the UGT720-269-1 fragment carrying the homology arm and the linearized pIYC04-HIS vector fragment. According to the instructions of the kit, the DNA fragment and the linearized vector fragment were subjected to homologous recombination reaction. After reacting at 50°C for 1 hour, the E. coli DH5α competent cells were transformed, and the Amp-resistant plates were coated and cultured at 37°C overnight. Colony PCR was used to screen positive clones, and positive clones were picked in 5mL LB medium containing Amp, sequenced and verified, and the recombinant expression plasmid pIYC04-HIS-P with correct sequencing was extracted. PGK1 -UGT720-269-1 spare.

[0293] 2. Strain Construction

[0294] The recombinant expression plasmid pIYC04-HIS-P PGK1 -UGT720-269-1 was transformed into M27 competent cells, coated on SC-HIS plates, and cultured at 30°C for 2-3 days. Positive clones were screened by colony PCR, and positive clones were picked and inoculated into 10 mL of SC-HIS liquid culture medium, cultured at 30°C and 230 rpm for 24 h, and strain MGV06 was preserved.

[0295] Using the same method, the expression plasmid pIYC04-HIS-P was transferred into competent cells M30, M31, M34, M35, M38, M40, M42, and M44, respectively. PGK1 -UGT720-269-1, and constructed strains MGV07-MGV14 that synthesized mogroside I-A1 and mogroside IIE from scratch.

[0296] Experimental verification: Detection of mogroside I-A1 and mogroside II E

[0297] The glycerol bacteria were taken out from the -80°C refrigerator, streaked on a SC-HIS plate, and cultured at 30°C for 2-3 days; a single colony was picked from the plate and placed in 10 mL of SC-HIS medium, and cultured overnight at 30°C, 250 rpm; the seed liquid was transferred to a 250 mL shake flask containing 25 mL of SC-HIS liquid medium at a 5% inoculation rate, and fermented at 30°C, 250 rpm, with 3 parallels per group; fermented for 120 h, 1 mL of fermentation liquid was added with 1 mL of methanol, and the supernatant was collected by centrifugation at 12,000 rpm for 5 min, and filtered and then tested by HPLC. The specific results are shown in Example 9.

[0298] Example 8 Construction of strains for de novo synthesis of mogroside III X, mogroside IV A, simenoside I and mogroside V

[0299] The enzymes necessary for synthesizing mogroside III X, mogroside IV A, simonoside I and mogroside V were transferred into the previously constructed strains M27, M30, M31, M34, M35, M38, M40, M42 and M44 in the form of plasmids to obtain strains MGV20-MGV28 for synthesizing mogroside III X, mogroside IV A, simonoside I and mogroside V from scratch.

[0300] The enzymes introduced are:

[0301] UGT720-269-1

[0302] UGT94-289-3

[0303] Taking the MGV20 strain as an example, the specific construction process is as follows:

[0304] 1. Construction of UGT94-289-3 recombinant plasmid

[0305] The same method as step 1) of "1. Construction of UGT720-269-1 recombinant plasmid in Example 7" was used, and the primers involved are listed in Table 9. The difference is:

[0306] pIYC04-HIS-P PGK1 -UGT720-269-1 was used as plasmid, and the UGT94-289-3 fragment carrying the homology arm and the linearized vector fragment were amplified using primers to obtain pIYC04-HIS-P PGK1 -UGT720-269-1-P TEF1 -UGT94-289-3 recombinant expression plasmid is kept for future use.

[0307] 2. Strain Construction

[0308] The recombinant expression plasmid pIYC04-HIS-P PGK1 -UGT720-269-1-P TEF1 -UGT94-289-3 was transformed into M27 competent cells, coated on SC-HIS plates, and cultured at 30°C for 2-3 days. Positive clones were screened by colony PCR, and positive clones were picked and inoculated into 10 mL of SC-HIS liquid culture medium, cultured at 30°C and 230 rpm for 24 h, and strain MGV15 was preserved.

[0309] Using the same method, the expression plasmid pIYC04-HIS-P was transferred into competent cells M30, M31, M34, M35, M38, M40, M42, and M44, respectively. PGK1 -UGT720-269-1-P TEF1 -UGT94-289-3, and constructed strains MGV21-MGV28 that synthesized mogroside III X, mogroside IV A, simenoside I and mogroside V from scratch.

[0310] Experimental verification: Detection of mogroside III X, mogroside IV A, simonoside I and mogroside V

[0311] The glycerol bacteria were taken out from the -80°C refrigerator, streaked on a SC-HIS plate, and cultured at 30°C for 2-3 days; a single colony was picked from the plate and placed in 10 mL of SC-HIS medium, and cultured overnight at 30°C, 250 rpm; the seed liquid was transferred to a 250 mL shake flask containing 25 mL of SC-HIS liquid medium at a 5% inoculation rate, and fermented at 30°C, 250 rpm, with 3 parallels per group; fermented for 120 h, 1 mL of fermentation liquid was added with 1 mL of methanol, and the supernatant was collected by centrifugation at 12,000 rpm for 5 min, and filtered and then tested by HPLC. The specific results are shown in Example 9.

[0312] Example 9 Output of target product

[0313] 1. Mogrol production

[0314] Table 10

[0315]

[0316] 2. Production of mogroside I-A1 and mogroside II E

[0317] Table 11

[0318]

[0319] Table 12

[0320]

[0321] 3. Production of mogroside III X, mogroside IV A, simenoside I and mogroside V

[0322] Table 13

[0323]

[0324] Table 14

[0325]

[0326] Table 15

[0327]

[0328] Table 16

[0329]

[0330] By screening and replacing the CPR gene, artificially synthesized CPR1, CPR2, and CPR3 were used to increase the copy number of the P450 enzyme CYP87D18 to 2-4 copies, and the relatively weak constitutive promoter was replaced to reduce the expression intensity of CPR, thereby improving the catalytic efficiency of cytochrome P450 (CYP450), and ultimately promoting the increase in product yield.

[0331] Example 10 Knockout of G1P metabolic enzyme gene GAL7

[0332] (1) The GTR-CRISPR-Cas9 gene editing system was used to integrate the target gene into the Saccharomyces cerevisiae genome, and a plasmid carrying a gene expressing the Cas9 protein and a sgRNA sequence targeting the corresponding site was constructed for targeted gene integration.

[0333] First, the gRNA sequence of the GAL7 integration site was predicted using the website CRISPOR (http: / / crispor.tefor.net / ), and the gRNA sequence with high efficiency and no off-target was selected; primers containing the gRNA sequence were designed (see Table 17), and PCR amplification was performed using the plasmid pScURA as a template to obtain a gene fragment containing the corresponding gRNA and the screening marker Ura, and then the DNA fragment was connected to the pCas9 plasmid using the Golden Gate Assembly kit to obtain the knockout plasmid pCas9-GAL7. Donor construction primers were designed (see Table 17), and the Donor DNA gene fragment contained 50bp gene sequences of the upstream and downstream homologous arms, and Donor DNA was obtained by OE-PCR: up-OverLap(GAL7)-down;

[0334] (2) The Donor DNA: up-OverLap(GAL7)-down and pCas9-GAL7 plasmids were co-transformed into MGV27 competent cells by electroporation, and the target gene GAL7 was knocked out by utilizing the homologous recombination ability of Saccharomyces cerevisiae. The cells were coated on SC-URA plates and cultured at 30°C for 2-3 days.

[0335] Positive clones were screened by colony PCR and sequenced for verification. The single clones verified by PCR were re-streaked on SC plates containing 5-FOA (5-fluoroorotic acid) and cultured at 30°C to eliminate the Cas9 plasmid. The single clones grown on SC (containing 5-FOA) plates were streaked on YPD and SC-URA plates respectively and cultured at 30°C. The bacteria that grew on YPD plates but not on SC-URA plates were gene-edited bacteria. Single clones were selected and cultured in YPD liquid medium at 30°C for 24 hours, and the strains were preserved (20% glycerol) to obtain strain MUDP001.

[0336] Table 17 Primer sequence list

[0337]

[0338]

[0339] Example 11 Overexpression of UDPG synthesis pathway gene HXK1

[0340] The same method as in Example 10 "Knockout of G1P metabolic enzyme gene GAL7" was used, and the primers involved are listed in Table 17. The difference is:

[0341] Step 2) The knockout plasmid pCas9-dpp1 and donor DNA: up-GAL1p-HXK1-down were co-transformed into the MGV27 strain to obtain the chassis strain MUDP002, and the strain was preserved for later use (20% glycerol).

[0342] Step 2) The knockout plasmid pCas9-dpp1 and donor DNA: up-GAL1p-HXK1-down were co-transformed into the MUDP001 strain to obtain the chassis strain MUDP003, and the strain was preserved for later use (20% glycerol).

[0343] Example 12 Overexpression of PGM1

[0344] The same method as in Example 10 "Knockout of G1P metabolic enzyme gene GAL7" was used, and the primers involved are listed in Table 17. The difference is:

[0345] Step 2) The knockout plasmid pCas9-SAP155c and donor DNA: up-GAL1p-PGM1-down were co-transformed into the MGV27 strain to obtain the chassis strain MUDP004, and the strain was preserved for later use (20% glycerol).

[0346] Step 2) The knockout plasmid pCas9-SAP155c and donor DNA: up-GAL1p-PGM1-down were co-transformed into the MUDP003 strain to obtain the chassis strain MUDP005, and the strain was preserved for later use (20% glycerol).

[0347] Example 13 Overexpression of PGM2

[0348] The same method as in Example 10 "Knockout of G1P metabolic enzyme gene GAL7" was used, and the primers involved are listed in Table 17. The difference is:

[0349] Step 2) The knockout plasmid pCas9-1114a and donor DNA: up-GAL1p-PGM2-down were co-transformed into the MGV27 strain to obtain the chassis strain MUDP006, and the strain was preserved for later use (20% glycerol).

[0350] Step 2) The knockout plasmid pCas9-1114a and donor DNA: up-GAL1p-PGM2-down were co-transformed into the MUDP005 strain to obtain the chassis strain MUDP007, and the strain was preserved for later use (20% glycerol).

[0351] Example 14 Overexpression of UGP1

[0352] The same method as in Example 10 "Knockout of G1P metabolic enzyme gene GAL7" was used, and the primers involved are listed in Table 17. The difference is:

[0353] Step 2) The knockout plasmid pCas9-1014a and donor DNA: up-GAL1p-UGP1-down were co-transformed into the MGV27 strain to obtain the chassis strain MUDP008, and the strain was preserved for later use (20% glycerol).

[0354] Step 2) The knockout plasmid pCas9-1014a and donor DNA: up-GAL1p-UGP1-down were co-transformed into the MUDP007 strain to obtain the chassis strain MUDP009, and the strain was preserved for later use (20% glycerol).

[0355] Table 18 Basic information of strains

[0356]

[0357]

[0358] Example 15 Verification Experiment

[0359] The frozen strains MUDP001-MUDP009 were taken out from the -80°C refrigerator, streaked on YPD plates, and cultured at 30°C for 2-3 days; a single colony was picked from the plate and placed in 10mL YPD medium, and cultured overnight at 30°C, 250rpm; the seed liquid was transferred to a 250mL shake flask containing 25mL YPD liquid medium at a 5% inoculation rate, and fermented and cultured at 30°C, 250rpm, with 3 parallels per group; fermented for 120h, 5mL of fermentation liquid was taken, glass beads were added, and the cells were shaken for 30min, extracted with an equal volume of ethyl acetate, and the organic phase was collected by centrifugation at 12,000rpm for 5min, and the extraction was repeated 3 times. Finally, the organic phase was placed in a 70°C vacuum drying oven, the solvent was evaporated, and after re-dissolving with 200μL methanol (containing 1% formic acid), HPLC detection was performed. The specific results are shown in Tables 19 to 22.

[0360] Table 19III-X Production

[0361]

[0362] Table 20 IV-A production

[0363]

[0364]

[0365] Table 21 SI production

[0366]

[0367] Table 22MV production

[0368]

[0369]

[0370] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

[0371]

[0372]

[0373]

[0374]

[0375]

[0376]

[0377]

[0378]

[0379]

[0380]

[0381]

[0382]

[0383]

[0384]

[0385]

[0386]

[0387]

[0388]

[0389]

[0390]

[0391]

[0392]

[0393]

[0394]

[0395]

[0396]

[0397]

[0398]

[0399]

[0400]

[0401]

Claims

1. Use of any one of the following or a combination thereof in the preparation of mogroside V; (I), knocking out the G1P metabolic enzyme gene GAL7; and / or (II), overexpression of UDPG synthesis pathway gene HXK1; and / or (III), overexpression of PGM1; and / or (IV), overexpression of PGM2; and / or (V), overexpression of UGP1; Preferably, said use comprises enhancing the UDPG pathway.

2. The use according to claim 1, characterized in that Any of the following items or their combination also include: (VI), screening and replacing CPR genes, selecting CPR1, CPR2, and CPR3; The CPR1 sequence is shown as SEQ ID No.92; The CPR2 sequence is shown as SEQ ID No.93; The CPR3 sequence is shown as SEQ ID No.94; and / or (VII), increasing the copy number of P450 enzyme CYP87D18 to 2 to 4 copies; and / or (VIII) Reducing the expression intensity of CPR by replacing a relatively weak constitutive promoter; The relatively weak constitutive promoter includes: PGI1p, HXT7p or PGK1p; and / or Any of the following items or their combination also include: (IX), integration into SgCDS, SgEPH3, CYP87D18, and / or SgCPR1; (X), integrated into UGT720-269-1; and / or (XI), integrated into UGT94-289-3; and / or Any of the following items or their combination also include: (XII), down-regulating the expression of endogenous gene ERG7; (XIII), knocking out the gene encoding the GAL4 inhibitory protein GAL80; (XIV), overexpression of squalene epoxidase SQE (GAL80) from Momordica grosvenori, cytochrome b5 (RsCyb5,511b) from Rubus sweetleaf, or yeast phospholipid biosynthesis regulatory gene INO2 (ER size regulator, replacement promoter); and / or Any of the following items or their combination also include: (XV), overexpression of tHMG1 and IDI1 (308a), key rate-limiting genes for terpenoid synthesis in the MVA pathway; and / or (XVI), a mutant gene upc2-1(416d) that overexpresses the global transcription factor UPC2; and / or (XVII), overexpression of genes for acetaldehyde dehydrogenase ALD6 (1622b), pyruvate decarboxylase PDC1 (1021b), acetyl-CoA synthetase ACS1 (911b); and / or (XVIII), knocking out the isocitrate dehydrogenase IDH1 gene; and / or (XIX), a gene that overexpresses the citrate lyase ACL of Rhodosporidium toruloides; and / or (XX), overexpression of the gene of alcohol dehydrogenase ADH2 (208a) from rice base rot pathogen.

3. A gene expression cassette, characterized in that Includes any one or combination of the following: (I), knocking out the G1P metabolic enzyme gene GAL7; and / or (II), overexpression of UDPG synthesis pathway gene HXK1; and / or (III), overexpression of PGM1; and / or (IV), overexpression of PGM2; and / or (V) Overexpression of UGP1.

4. The gene expression cassette according to claim 3, characterized in that The gene expression cassette also includes: (VI), CPR1, CPR2, CPR3; The CPR1 sequence is shown as SEQ ID No.92; The CPR2 sequence is shown as SEQ ID No.93; The CPR3 sequence is shown as SEQ ID No.94; and / or (VII), P450 enzyme CYP87D18; and / or (VIII), relatively weak constitutive promoter; The relatively weak constitutive promoter includes: PGI1p, HXT7p or PGK1p; and / or The gene expression cassette also includes: (IX), SgCDS, SgEPH3, CYP87D18 and / or SgCPR1; and / or (X), UGT720-269-1; and / or (XI), UGT94-289-3; and / or The gene expression cassette also includes: (XII), down-regulated endogenous gene ERG7; and / or (XIII) does not include a gene encoding the GAL4 inhibitory protein GAL80; and / or (XIV), overexpressed squalene epoxidase SQE (GAL80) from Momordica grosvenori and cytochrome b5 (RsCyb5,511b) from Rubus sweetleaf, interacted with yeast phospholipid biosynthesis regulatory gene INO2 (ER size regulator, replacement promoter); and / or The gene expression cassette also includes: (XV), overexpression of tHMG1 and IDI1 (308a), key rate-limiting genes for terpenoid biosynthesis in the MVA pathway; and / or (XVI), overexpression of a mutant gene of the global transcription factor UPC2, upc2-1(416d); and / or (XVII), overexpressed genes of acetaldehyde dehydrogenase ALD6 (1622b), pyruvate decarboxylase PDC1 (1021b), acetyl-CoA synthetase ACS1 (911b); and / or (XVIII), genes excluding isocitrate dehydrogenase IDH1; and / or (XIX), the gene for citrate lyase ACL of overexpressed Rhodosporidium toruloides; and / or (XX), overexpressed gene of alcohol dehydrogenase ADH2 (208a) from rice base rot fungus.

5. A construct, characterized in that Comprising the gene expression cassette as claimed in claim 3 or 4.

6. A host, characterized in that Includes any of the following: (i) The gene expression cassette according to claim 3 or 4; (ii) the construct according to claim 5; Preferably, the host includes but is not limited to yeast.

7. A method for constructing a yeast engineering bacterium, characterized in that: The steps include: (I), knocking out the G1P metabolic enzyme gene GAL7; and / or (II), overexpression of UDPG synthesis pathway gene HXK1; and / or (III), overexpression of PGM1; and / or (IV), overexpression of PGM2; and / or (V) Overexpression of UGP1.

8. The method according to claim 7, characterized in that The method for constructing yeast engineering bacteria also includes the following steps: (VI) Screening and replacing CPR genes, using artificially synthesized CPR1, CPR2, and CPR3; The CPR1 sequence is shown as SEQ ID No.92; The CPR2 sequence is shown as SEQ ID No.93; The CPR3 sequence is shown as SEQ ID No.94; and / or (VII), increasing the copy number of P450 enzyme CYP87D18 to 2-4 copies; and / or (VIII) Reducing the expression intensity of CPR by replacing a relatively weak constitutive promoter; and / or The method for constructing yeast engineering bacteria also includes: (IX), integration into SgCDS, SgEPH3, CYP87D18 and / or SgCPR1; and / or (X), integrated into UGT720-269-1; and / or (XI), integrated into UGT94-289-3; and / or The method for constructing yeast engineering bacteria also includes: (XII), down-regulating the expression of endogenous gene ERG7; and / or (XIII), knocking out the gene encoding the GAL4 inhibitory protein GAL80; and / or (XIV) Overexpression of squalene epoxidase SQE (GAL80) from Momordica grosvenori, cytochrome b5 (RsCyb5,511b) from Rubus sweetleaf, and yeast phospholipid biosynthesis regulatory gene INO2 (ER size regulator, replacement promoter) to expand the space of the endoplasmic reticulum; and / or The method for constructing yeast engineering bacteria also includes: (XV), overexpression of tHMG1 and IDI1 (308a), the key rate-limiting genes for terpenoid synthesis in the MVA pathway; (XVI), mutant gene upc2-1(416d) that overexpresses the global transcription factor UPC2; (XVII), overexpression of acetaldehyde dehydrogenase ALD6 (1622b), pyruvate decarboxylase PDC1 (1021b), and acetyl-CoA synthetase ACS1 (911b); (XVIII), knockout of isocitrate dehydrogenase IDH1; (XIX), overexpression of citrate lyase ACL of Rhodosporidium toruloides; (XX), overexpression of alcohol dehydrogenase ADH2 (208a) from rice base rot pathogen.

9. Use of any one of the following or a combination thereof in the preparation of mogroside V; (i), the gene expression cassette according to claim 3 or 4; and / or (ii) the construct of claim 5; and / or (iii) the host according to claim 6; and / or (iv) The engineered yeast obtained by constructing according to claim 7 or 8.

10. A method for preparing mogroside V, characterized in that: (i) integrating the gene expression cassette as claimed in claim 3 or 4; and / or (ii), transforming the construct as claimed in claim 5; and / or (iii), fermentation culture of the host according to claim 6; and / or (iv) fermenting and culturing the engineered yeast obtained by the method of claim 7 or 8; The fermentation broth was collected and purified.

Images