A soybean salt tolerance-related gene GmVP6, its encoded protein, and applications thereof
By overexpressing the GmVP6 gene in soybeans, the problem of insufficient tolerance to saline-alkali stress by soybeans is solved, the growth potential and yield of soybeans are improved, and technical support is provided for the effective utilization of saline-alkali land resources.
Patent Information
- Application Number
- CN202510480750.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-17
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2045-04-17
AI Technical Summary
Soybeans have low tolerance to saline-alkali stress, which affects their growth and yield. The research on the salt tolerance regulation genes of soybeans in the prior art has not yet been fully in-depth, resulting in the failure to effectively utilize saline-alkali land resources.
By overexpressing the soybean salt tolerance related gene GmVP6, the salt tolerance of soybean is improved, and specifically, its tolerance to salt stress is enhanced by overexpressing the GmVP6 gene in soybeans.
It enhances the salt stress tolerance of soybeans, improves the growth potential and yield of soybeans, provides the possibility of cultivating new salt-tolerant and high-yield soybean varieties, and promotes the effective utilization of saline-alkali land.
Smart Images

Figure CN119979603B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a soybean salt tolerance-related gene GmVP6, its encoded protein, and applications thereof. Background Art
[0002] Soybean (Glycine max (L.) Merr.) originated in China, belongs to the legume family, Papilionoideae subfamily, and Glycine genus, and is one of the important grain and oil crops and feed crops in the world. As a multi-functional crop, soybeans can be used to make various bean products, such as tofu, soy yogurt, ice cream, etc., can also be processed into livestock feed, and is also an important source of plant protein. With the development of the national economy and the improvement of people's living standards, the demand for soybeans in China is increasing, but the soybean yield in China is relatively low, and the self-sufficiency rate is less than 20%, mainly relying on imported soybeans to meet the domestic soybean demand.
[0003] Globally, soil salinization is one of the key factors restricting crop production capacity, and has a great negative impact on both the yield and quality of soybeans. Cultivated soybeans are relatively insensitive to salt stress. When the salt stress value exceeds the tolerance of soybeans, it will significantly inhibit the growth of soybeans, thus having a certain impact on soybean yield. How to reasonably utilize saline-alkali cultivated land in China to improve soybean production capacity is an urgent problem for us to solve.
[0004] Excavating salt-tolerant and high-yield genes and cultivating salt-tolerant soybean varieties to make full use of saline-alkali land resources has become one of the effective ways. Selecting and popularizing salt-tolerant soybean varieties is an important strategy for making full use of saline-alkali cultivated land in China. Important crops such as corn, rice, and wheat have made important progress in studying salt-tolerance-related genes through overexpression. Glutathione S-transferases (GSTs) are a class of highly conserved functional enzymes that play an important role in the process of plant response to abiotic stress. Research shows that the GsGSTU13 gene is an important salt-tolerant gene in wild soybeans. Overexpressing the GsGSTU13 gene in rice enhanced the reactive oxygen species scavenging ability of the overexpressing lines and improved the salt tolerance of rice. The GmPP2C89 gene was induced by NaCl to up-regulate its expression. Under salt induction, the GmPP2C89 overexpressing lines enhanced the salt tolerance of the overexpressing lines by activating the antioxidant pathway and the ABA pathway. Overexpressing the GmTGA26 gene up-regulated the expression levels of the NHX family gene GmNHX5 and the key gene GmSOS1 of the SOS signaling pathway, thereby enhancing the salt tolerance of plants by regulating the intracellular Na + homeostasis. Although some progress has been made in the study of soybean salt tolerance in recent years, due to the aggravation of cultivated land salinization caused by irrigation methods and climate change, it is urgent to identify and characterize more soybean salt-tolerant genes.
[0005] V-ATPase is a special enzyme located on the vacuolar membrane of plants, which can hydrolyze pyrophosphate to release energy and plays an important role in maintaining the osmotic pressure stability of cells, the electrochemical potential inside and outside the membrane, and the secondary active transport of small molecule substances inside cells. The VP gene family was first identified in Arabidopsis thaliana and has various functions such as affecting plant morphogenesis, increasing plant biomass and yield, enhancing plant tolerance to drought and salt, improving tolerance to heavy metal elements, participating in plant sugar metabolism, and improving element utilization efficiency. Overexpression of AVP1 in Arabidopsis thaliana, tomato, and rice enhanced the salt tolerance of plants. Upregulation of type I H + -PPase in Arabidopsis thaliana resulted in a higher proton electrochemical gradient, which helped to enhance the influx of ions and sugars into the vacuole and reduce the water potential, leading to increased salt tolerance compared with the wild type. AVP1 was overexpressed in cotton, and its ROS activity under salt stress was measured. Analysis found that cotton lines overexpressing AVP1 showed higher salt tolerance. Transgenic wheat expressing ZxNHX / VP1-1 grew under salt stress. Studies on phenotypes, antioxidant and osmotic adjustment abilities, as well as ion homeostasis and agronomic traits found that ZxNHX / VP1-1 significantly improved the salt tolerance of wheat. ZmVPP5 was expressed in multiple locations including the plasma membrane, vacuolar membrane, and nucleus of maize. Overexpression of ZmVPP5 in yeast cells showed hypersensitivity to salt stress, and transgenic maize lines overexpressing ZmVPP5 also showed salt tolerance phenotypes. Based on these previous studies, the VP gene family plays a crucial role in enhancing plant salt tolerance. However, the functions of the VP gene family in soybean are not yet clear. Summary of the Invention
[0006] The purpose of the present invention is to provide a soybean salt tolerance-related gene GmVP6, its encoded protein, and their applications, and overexpress the soybean salt tolerance-related gene GmVP6 to improve the salt tolerance of soybeans.
[0007] The technical solution adopted by the present invention to solve its technical problems is:
[0008] An application of a soybean salt tolerance-related gene GmVP6 in improving the salt tolerance of soybeans, and the nucleotide sequence of the soybean salt tolerance-related gene GmVP6 is shown in SEQ ID No.1.
[0009] Soybean is an important oil crop and food crop in China, with a history of more than five thousand years. However, its yield is affected by various factors, including the restriction of saline-alkali land. Therefore, cultivating new soybean varieties with salt tolerance is of great significance for effectively utilizing the large area of saline-alkali land in China and increasing soybean yield. However, the regulation of salt tolerance in soybean by the GmVP gene family has not been reported. In this invention, we analyzed the potential function of the GmVP6 gene, which is highly expressed in the roots. Under salt stress, heterologous expression of GmVP6 in Arabidopsis thaliana led to an increase in the number of lateral roots, fresh weight of the above-ground part, and fresh weight of the underground part. At the same time, the MDA content in the GmVP6 overexpression lines was lower than that in the wild type under salt stress, while the activities of POD and SOD were higher than those in the wild type. That is, overexpression of the GmVP6 gene enhanced the ability of the overexpression lines to scavenge reactive oxygen species and improved the salt tolerance of the crops, which provided a new idea for improving soybean salt tolerance through genetic engineering.
[0010] Up-regulate the expression level of the soybean salt tolerance-related gene GmVP6, thereby improving the salt tolerance of soybeans.
[0011] Use of a soybean salt tolerance-related gene GmVP6 as a target for improving soybean salt tolerance transformation, and the nucleotide sequence of the soybean salt tolerance-related gene GmVP6 is shown in SEQ ID No.1.
[0012] A method for improving soybean salt tolerance, which improves the salt tolerance of soybeans by overexpressing and transforming the soybean salt tolerance-related gene GmVP6 in soybeans.
[0013] The nucleotide sequence of the soybean salt tolerance-related gene GmVP6 is shown in SEQ ID No.1.
[0014] A soybean salt tolerance-related gene GmVP6, whose nucleotide sequence is shown in SEQ ID No.1.
[0015] A protein encoded by a soybean salt tolerance-related gene GmVP6, which is obtained by transcription and translation of the soybean salt tolerance-related gene GmVP6 with the nucleotide sequence shown in SEQ ID No.1, and its amino acid sequence is shown in SEQ ID No.2. The GmVP6 gene is mainly expressed in the roots.
[0016] The beneficial effects of this invention are: GmVP6 positively regulates the salt tolerance of plants, has breeding potential, and lays a foundation for cultivating salt-tolerant and high-yield soybeans and further studying the regulation of soybean salt tolerance by GmVP6 and its related mechanisms; it is possible to improve the salt tolerance of soybeans through genetic engineering transformation, cultivate new soybean varieties with salt tolerance, which is of great significance for effectively utilizing the large area of saline-alkali land in China and increasing soybean yield. Description of the Drawings
[0017] Figure 1 It is the analysis of the expression pattern of the GmVP gene family and the spatio-temporal expression pattern diagram; A: The expression pattern of the GmVP gene family in tissues; B: The expression pattern of the GmVP gene family in roots under salt stress; C: The expression level of the GmVP6 gene in different tissues.
[0018] Figure 2 It is the diagram of obtaining overexpressed transgenic lines and phenotype observation; A: PCR identification, B: RT-qPCR identification, C: Phenotype of Arabidopsis thaliana treated with salt in soil culture, D: Phenotype of Arabidopsis thaliana treated with salt in medium culture.
[0019] Figure 3 It is the diagram of the effects of different concentrations of salt treatment on the shoot fresh weight, root fresh weight, root length, and lateral roots of overexpressed transgenic lines.
[0020] Figure 4 It is the diagram of the effects of different concentrations of salt treatment on the germination rate and greening rate phenotypes of overexpressed transgenic lines.
[0021] Figure 5 It is the comparative statistical chart of the effects of different concentrations of salt treatment on the germination rate and greening rate of overexpressed transgenic lines.
[0022] Figure 6 It is the diagram of ROS activity determination of overexpressed transgenic lines; A: Concentration of malondialdehyde (MDA), B: Activity of superoxide dismutase (SOD), C: Activity of peroxidase (POD). Detailed implementation manners
[0023] The technical solutions of the present invention will be further specifically described below through specific embodiments.
[0024] In the present invention, unless otherwise specified, the raw materials and equipment used can be purchased from the market or are commonly used in the art. The methods in the following embodiments are conventional methods in the art unless otherwise specified.
[0025] Example 1: Cloning and expression pattern analysis of the soybean salt tolerance regulatory gene GmVP6
[0026] There are 8 members in the GmVP gene family in the soybean genome, namely GmVP1, GmVP2, GmVP3, GmVP4, GmVP5, GmVP6, GmVPL1, and GmVPL2. Bioinformatics analysis of the 8 members of the soybean GmVP gene family found that the soybean GmVP gene family is divided into two subfamilies. Then, the expression levels in different tissue parts of soybeans were analyzed, and it was found that the expression patterns of the soybean GmVP gene family in different tissues and organs were different. Among them, the GmVP6 gene was mainly expressed in the root system ( Figure 1In A), the expression patterns of the GmVP gene family under salt stress were also predicted. It was found that in the roots, under salt treatment conditions, GmVP6 was induced by salt and had a relatively high expression level. As the salt treatment time increased, the expression level gradually increased ( Figure 1 In B). Therefore, we selected GmVP6 as the candidate gene. To further verify the expression pattern of the GmVP6 gene, we performed RT-qPCR using RT-VP6-F and RT-VP6-R (Table 1) to analyze the expression of the GmVP6 gene in different tissues and verified that GmVP6 was mainly expressed in the roots ( Figure 1 In C). We constructed a GmVP6 vector driven by the pUBQ10 promoter for cloning.
[0027] Table 1 Primer sequences
[0028] Primer Name Primer Sequence (5’-3’) RT-VP6-F GCAATGCTTACAGCCCAGTT (SEQ ID No.3) RT-VP6-R TGCAGCAACAGCAATTCCAT (SEQ ID No.4) qRT-At-FP (Reference Gene) GTCGTACAACCGGTATTGTGCT (SEQ ID No.5) qRT-At-RP (Reference Gene) TGTCTCTTACAATTTCCCGCTCT (SEQ ID No.6)
[0029] Example 2. Obtaining overexpressing transgenic Arabidopsis thaliana and studying its salt tolerance
[0030] 1. Obtaining overexpressing transgenic Arabidopsis thaliana
[0031] To further study the role of GmVP6 in plant salt tolerance, we constructed an Arabidopsis thaliana transgenic line overexpressing GmVP6 driven by the pUBQ10 promoter. The wild-type and background Arabidopsis thaliana plants used in this study were of the Columbia-0 (Col-0) ecotype, and the method was to transform Arabidopsis thaliana by the floral dip method. The transformants were detected by RT-qPCR and PCR, and three homozygous transgenic lines were selected for further study ( Figure 2 In A, Figure 2 In B).
[0032] Steps for obtaining overexpressing transgenic Arabidopsis thaliana
[0033] Using the cDNA of Tianlong No. 1 soybean as a template, the gene GmVP6 (SEQ ID No.1) was amplified using the primers pUBQ-VP6-F and pUBQ-VP6-R. The reaction system for gene amplification is shown in Table 2, and the PCR amplification program is shown in Table 3. The 1300-pUBQ10-MCS-3'UTR-G10evo vector (for the plasmid map, see the appendix of the patent with application number 2024118108103 Figure 4 ) was digested with restriction enzymes, and the restriction enzyme sites were Spe Ⅰ and Sma Ⅲ. The correct fragment was ligated to the digested vector to obtain the recombinant vector pUBQ-VP6.
[0034] Sequence information of pUBQ-VP6-F and pUBQ-VP6-R:
[0035] pUBQ-VP6-F: 5’-AGTTTTTCTGATTAACAGACTAGTATGGTTGTGCTGAGCGAG-3’ (SEQ ID No.7);
[0036] pUBQ-VP6-R: 5’-GACCTGAGGTAATTATAACCCGGGTCAGAGTAATTTAAAGAT-3’ (SEQ ID No.8).
[0037] Table 2 Amplification Mix System
[0038] Reagent Dosage pUBQ-VP6-F (10 μM) 1 μL pUBQ-VP6-R (10 μM) 1 μL Prime STAR High Fidelity DNA Polymerase 1 μL dNTP Mixture 6 μL Template DNA 1 - 2 μL 5×Primer STAR Buffer 10 μL Sterilized Ultra-pure Water Make up to 50 μL
[0039] Table 3 PCR Amplification Program
[0040]
[0041] Transfer the constructed pUBQ-VP6 vector into GV3101 competent cells to obtain the target strain by transformation;
[0042] Inoculate the identified positive monoclonal agrobacterium with the correct band size into 1 ml of LB liquid medium containing 50 mg / L rifampicin (Rif) and 50 mg / L kanamycin sulfate (Kan) resistance. After culturing overnight in a shaker at 28°C and 220 rpm, transfer it into 200 ml of LB liquid medium containing 50 mg / L rifampicin (Rif) and 50 mg / L kanamycin sulfate (Kan) resistance, and culture it in a shaker at 28°C and 220 rpm until the OD 600 is between 1.2 - 1.8;
[0043] Select Arabidopsis thaliana that is 4 - 6 weeks old and growing well, and cut off the already opened flower clusters and pods to ensure the infection efficiency. Water it sufficiently the night before infection to ensure the normal growth state of Arabidopsis thaliana;
[0044] Centrifuge the cultured agrobacterium liquid at 4000 rpm and 4°C for 10 min, discard the supernatant, and resuspend it with the infection suspension (Table 5) to make the OD of the infection liquid 600 between 0.8 - 1.0;
[0045] Immerse the inflorescence of the Arabidopsis thaliana plant into the agrobacterium resuspension for 30 - 60 s. After soaking, put it back on the tray, cover it with a plastic cover to maintain humidity, and perform dark treatment for 24 h. Harvest the seeds after they mature;
[0046] The harvested T1 generation seeds were sown on 1 / 2 MS medium (Table 6) containing 20 mg / L ticarcillin (Tim) and 15 mg / L glyphosate resistance for the first step of screening. After one week, the seedlings that could grow normally were identified as positive seedlings, transplanted into soil for cultivation. When they grew up, DNA was extracted for PCR identification and seeds were harvested. Until the T3 generation, a homozygous transgenic line was obtained, DNA was extracted for PCR identification and RNA was extracted to measure its expression level.
[0047] Table 5 Preparation of infection suspension
[0048] Reagent Infection Suspension Preparation / 1 L Sucrose 50 g MS Medium Salt (MS salt) 2.2 g 2-(N-Morpholino)ethanesulfonic Acid Monohydrate (MES) 0.5 g 6-BA (1 mg / mL) 9.9 μL Organosilicon Surfactant (Silwet L-77) 200 μL KOH Adjust pH to 5.7
[0049] Table 6 Preparation of 1 / 2 MS medium
[0050]
[0051] Study on salt tolerance of soybean GmVP6 gene
[0052] The homozygous T3 generation Arabidopsis thaliana lines OE-0, OE-1, and OE-2 overexpressing GmVP6 (experimental group) and the wild-type line WT of Columbia ecotype Arabidopsis thaliana (control group) were identified, with the wild-type as the negative control. The results showed that the homozygous T3 generation Arabidopsis thaliana lines OE-0, OE-1, and OE-2 (experimental group) were all overexpressing lines ( Figure 2 A in Figure 2 B in ). The homozygous T3 generation Arabidopsis thaliana lines OE-0, OE-1, and OE-2 overexpressing GmVP6 (experimental group) and the wild-type line WT of Columbia ecotype Arabidopsis thaliana (control group) were cultured together on square plate medium without NaCl for 4 d, and then transferred to square plate medium containing different concentrations of NaCl (Table 7) for 7 d.
[0053] Table 7 Square plate medium
[0054]
[0055] Three selected transgenic lines OE-0, OE-1, and OE-2 were treated with salt and their phenotypes were observed. It was found that under salt treatment conditions, the transgenic lines grew better than WT ( Figure 2 C in Figure 2 D in ). Based on this phenotype, the above-ground fresh weight, underground fresh weight, root length, number of lateral roots and related indexes of Arabidopsis thaliana under this treatment were measured.
[0056] 2.1 Above-ground fresh weight, underground fresh weight, root length, lateral roots
[0057] Before sowing Arabidopsis thaliana seeds, 1 ml of ddH2O was added to a 1.5 ml centrifuge tube and vernalized at 4°C for two days. After sowing on 1 / 2 MS medium and growing for 4 days, they were transferred to 1 / 2 MS medium containing 0 / 50 / 75 / 100 mM / L NaCl and grown for 7 days, and then the primary root length, lateral root number, aboveground fresh weight, and underground fresh weight were measured. After measuring the root length and lateral root number of Arabidopsis thaliana after 7 days of salt treatment, no differences were found under normal conditions. However, under salt treatment conditions, there were no significant differences in root length between the transgenic lines OE-0, OE-1, and OE-2 and the WT, but the lateral root number was significantly more than that of the WT ( Figure 3 ). Subsequently, the aboveground fresh weight and underground fresh weight of Arabidopsis thaliana after treatment were measured. The results showed that under normal conditions, there was no difference in fresh weight between the transgenic lines and the WT. However, after salt treatment, the aboveground fresh weight and underground fresh weight of the transgenic lines were significantly higher than those of the WT ( Figure 3 ).
[0058] 2.2 Germination rate and greening rate
[0059] To study the salt tolerance of transgenic lines, before sowing Arabidopsis thaliana seeds, 1 ml of ddH2O was added to a 1.5 ml centrifuge tube and vernalized at 4°C for two days. Then, the seeds were sown on 1 / 2 MS medium containing 0 / 50 / 100 / 150 mM / L NaCl, and the germination rate and greening rate were recorded every 24 hours. The statistical results showed that there were no significant differences in the germination rate and greening rate between the WT and transgenic lines without NaCl. However, as the salt stress concentration increased, that is, after exogenous application of 100 mM / L and 150 mM / L NaCl, the germination rate and greening rate of the transgenic lines were significantly higher than those of the WT ( Figure 4 , Figure 5 ). These results indicate that the transgenic lines overexpressing GmVP6 are more tolerant to salt stress.
[0060] 2.3 Determination of salt treatment-related indicators
[0061] For the determination of physiological and biochemical indicators under salt treatment, before sowing Arabidopsis thaliana seeds, 1 ml of ddH2O was added to a 1.5 ml centrifuge tube and vernalized at 4°C for two days. After sowing on 1 / 2 MS medium and growing for 4 days, they were transferred to 1 / 2 MS medium containing 0 / 50 / 75 / 100 mM / L NaCl and grown for 7 days, and the relevant physiological indicators were measured.
[0062] MDA is a product of membrane lipid peroxidation in cell membranes. The accumulation of MDA can cause certain damage to plant membranes and cells, leading to a decrease in their tolerance to stress. Under normal conditions, the MDA concentration in transgenic lines is not different from that in WT. However, under salt stress conditions, the MDA activity in the GmVP6 transgenic Arabidopsis line is lower than that in WT, and the accumulation is less, that is, the degree of oxidative damage suffered by the GmVP6 transgenic Arabidopsis line under salt stress is low ( Figure 6 A in Figure 6 ). Under normal conditions, the activities of POD and SOD in transgenic lines are not different from those in WT. Under salt stress conditions, the activities of various oxides in both WT and transgenic lines increase, and the enzyme activities in the GmVP6 transgenic line in the root system are significantly higher than those in WT ( Figure 6 B in
[0063] C in
[0064] ). Statistical significance analysis was performed using SPSS, Origin, and Graphpad.
[0065] The embodiments described above are only a preferred solution of the present invention, and do not impose any form of limitation on the present invention. There are other variations and modifications without exceeding the technical solutions recorded in the claims.
[0066] SEQ ID No.1:
[0067]
[0068] SEQ ID No.2:
[0069] MVVLSEGLTQILIPVTAFIGIGFALLQWLLVSRVRVSSADHTEADNGYRKSLMGDSELENGVQSVEVTNKCTEIQHAISVGATSFLFTEYKYLTIFMGVFGAIIFVFLGSVKGFSTQSEPCTYNEGNICKPALANAIFSTVAFLLGALTSVLSGFLGMKIATYANARTTLEARKGIGKAFVIAFRSGAVMGFLLSANGLLVLYITINLFKLYYGDDWEGLYESITGYGLGGSSMALFGRVGGGIYTKAADVGADLVGKVEHNIPEDDPRNPAVIADNVGDNVGDIAGMGSDLFGSYAESSCAALFVASISSFGTNHDHTAMSYPLIISSMGIVVCLITTLFATDLFEIKNVSQIEPSLKRQLLISTILMTAGIAIVSFTALPSEFTLYNFGAKKVVKNWHLFFCVAIGLWAGLAIGYITEYYTSNAYSPVQDVADSCRTGASTNVIFGLALGYKSVIIPVFAIAIAIYVSFSLAAMYGIAVAALGMLSTMATSLAIDAYGPISDNAGGIAEMAGMRHEIRERTDALDAAGNTTAAIGKGFAIGSAALVSLALFGAYVSRAGIKTVNVMTPKVFIGLIVGAMLPYWFSAMTMKSVGSAALKMVEEVRRQFNTIPGLLEGRAKPDYANCVKISTDASLKEMIPPGALVLLTPLIAGTFFGVETLAGVLAGSLISGVQVAISASNTGGAWDNAKKYIEAGTTPHAVSLGPKGSDAHKAAVIGDTVGDPLKDTSGPSLNILIKLMAVESLVFAPFFAAHGGLIFKLL。
Claims
1. Application of a soybean salt tolerance-related gene GmVP6 in improving the salt tolerance of soybeans, characterized in that Soybean salt tolerance-related gene GmVP6 The nucleotide sequence is shown in SEQ ID No. 1; up-regulate the expression level of the soybean salt tolerance-related gene GmVP6 to improve the salt tolerance of soybeans.
2. Use of a salt tolerance-related gene in soybean GmVP6 as a target for improving salt tolerance in soybean, characterized in that Soybean salt tolerance-related gene GmVP6 The nucleotide sequence is shown in SEQ ID No.1; up-regulating the expression level of the soybean salt tolerance-related gene GmVP6 thereby improving the salt tolerance of soybeans.
3. A method for improving the salt tolerance of soybeans, characterized in that, By overexpressing the salt tolerance-related genes in soybeans GmVP6 to improve the salt tolerance of soybeans; the nucleotide sequence of the salt tolerance-related genes GmVP6 in soybeans is shown in SEQ ID No.1.
Citation Information
Patent Citations
Plant salt resistant associated protein and gene, application of plant salt resistant associated protein and gene as selection marker
CN102796713A