A molecular marker for bovine hypothermia adaptation, a screening method and its application

Abstract

This invention belongs to the field of animal molecular breeding technology, and relates to a molecular marker, screening method, and application of bovine hypothermia adaptation. Specifically, this invention utilizes a high-density SNP chip to genotype bovine breeds from different regions, integrates FLK and hapFLK genomic selection signal analysis methods, compares genomic selection signals among cattle in different temperature zones or within different bovine breeds, identifies regions of strong selection and positively selected genes, verifies the function of the HSPA12B gene using a CRISPR / Cas9 gene knockout mouse model, and screens out functional genes for hypothermia adaptation and their molecular markers (g.51906414T>C, g.51910621A>G, g.51913699G>A). This invention will provide new targets for elucidating the molecular mechanisms of bovine hypothermia adaptation, provide a scientific basis and a simple and rapid detection method for screening and breeding distinctive bovine breeds with hypothermia resistance, and also provide new reference for the breeding of other livestock and poultry breeds with hypothermia resistance.

Description

Technical Field

[0001] This invention belongs to the field of animal molecular breeding technology, and relates to a molecular marker for bovine low-temperature adaptability, a screening method, and its application. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Cattle are one of the most important domestic animals in my country. Through thousands of years of natural and artificial selection, various local cattle breeds have been domesticated and adapted to the local environment. For example, the Yanbian and Mongolian cattle in the low-temperature regions of northern my country, and the Tibetan cattle in the high-altitude regions, are unique cold-resistant local cattle breeds and extremely valuable genetic resources. Studies have shown that cattle need to consume a large amount of energy to maintain their core body temperature in frigid climates (Qi et al., 2015). Cold stress leads to accelerated metabolism, increased urination and defecation, significantly reduced production performance, and impaired immune responses (Liu et al., 2023). The lower the temperature, the higher the risk of death for cattle (Morignat et al., 2015). Faced with increasingly extreme climate change and frequent extreme cold waves, researching the molecular mechanisms of cattle's cold adaptation can reduce the economic losses caused by extreme cold weather in cattle farming and make significant contributions to the genetic improvement of modern cattle breeds.

[0004] Tens of thousands of years of climate change have generated varying selection pressures during the adaptive evolution of animals. These pressures leave selection imprints in the animal genome, such as reduced genetic polymorphism and linkage disequilibrium, known as genomic selection signals. Some research teams have used genome-wide association studies (GWAS) based on bovine hypothermia adaptation to identify genes potentially related to hypothermia adaptation (Igoshin et al., 2019; Huang et al., 2023). However, strategies like GWAS for identifying hypothermia-related genes heavily rely on phenotypes, especially since phenotypic records for local cattle breeds are often incomplete or even missing, posing a significant challenge to target gene identification. In contrast, genomic selection signal analysis strategies do not require strict phenotypic data to identify genes associated with target traits. This strategy is more convenient and reliable for gene discovery from an evolutionary perspective. Common genomic selection signal analysis methods are mainly based on allele frequency spectra, linkage disequilibrium, population differentiation, and genomic heterozygosity.

[0005] Adaptation to low-temperature environments is a complex biological process. Mammals in cold regions typically possess long hair and thick adipose tissue, especially the thick adipose tissue, which provides ample energy for cold resistance. Adipose tissue can be divided into two main categories: white adipose tissue (WAT), which stores energy in the form of triglycerides, and brown adipose tissue (BAT), which maintains core body temperature through non-shivering thermogenesis (Cheng et al., 2021). Brown-like adipocytes are present in the subcutaneous adipose tissue of the tail root, perirenal region, and groin of newborn calves in Angus, Brahman, and Chinese Holstein cattle, and these adipocytes shrink in volume and deepen in browning under low-temperature conditions (Smith et al., 2004; Cao et al., 2017). In adult Jinjiang cattle, after cold exposure, the volume of subcutaneous adipocytes decreases, and the expression levels of browning-specific genes (UCP1, PRDM16, and PGC-1α) and lipolysis regulators (HSL) significantly increase (Li et al., 2023). The above evidence suggests that adipose browning thermogenesis is an indispensable physiological activity for cattle to cope with low-temperature environments. Summary of the Invention

[0006] To address the aforementioned problems, this invention provides a molecular marker and screening method for bovine hypothermia adaptation, and its application. Specifically, this invention uses an Illumina BovineHD 777K SNP gene chip to genotype local cattle DNA samples, integrates FLK and hapFLK genomic selection signal analysis methods, compares and analyzes genomic selection signals between and within cattle breeds in high- and low-temperature regions, identifies regions and genes subjected to strong positive selection, and verifies gene function using a gene knockout mouse model, thereby screening functional genes and related molecular markers for hypothermia adaptation. Based on the above research results, this invention is thus completed.

[0007] Specifically, the present invention is achieved through the following technical solution:

[0008] In a first aspect, the present invention provides a bovine hypothermia-related molecular marker, comprising the HSPA12B gene (NCBI: AC_000170.1) and single nucleotide polymorphism sites located on the HSPA12B gene (NCBI: AC_000170.1), namely g.51906414T>C, g.51910621A>G, and g.51913699G>A.

[0009] A second aspect of the present invention provides primers for detecting molecular markers related to bovine hypothermia adaptation, said primers comprising an upstream primer and a downstream primer.

[0010] A third aspect of the present invention provides a detection kit comprising at least the primers described above.

[0011] A fourth aspect of the present invention provides the application of the above-described primers or detection kits in screening bovine individuals with low-temperature adaptability.

[0012] A fifth aspect of the present invention provides a method for using bovine hypothermia-related molecular markers, the method comprising at least:

[0013] Genotyping of bovine DNA samples was performed using SNP chips.

[0014] Analysis of FLK and hapFLK genomic selection signals;

[0015] Identify genetic variations and differentially selected regions that are subject to positive selection;

[0016] Candidate genes and SNP markers were screened based on a candidate gene screening strategy.

[0017] In a sixth aspect of the invention, the application of the above-mentioned molecular markers, primers or detection kits in the selection, breeding and genetic improvement of cold-resistant cattle breeds is provided.

[0018] The above-mentioned one or more technical solutions have the following beneficial technical effects:

[0019] The aforementioned technical solution specifically targets the genetic characteristics of low-temperature adaptation in bovine breeds. From the perspectives of genomic evolution, selection, and adaptation, it selects local bovine breeds distributed in southern or northern regions, divides them into high- and low-temperature zones based on the local average annual temperature, and integrates multi-genome selection signal analysis methods to efficiently and accurately screen for the key gene HSPA12B and related molecular markers for low-temperature adaptation. The method is rationally designed, and the detection method based on key genes and molecular markers is characterized by its ease of operation and high accuracy.

[0020] The above method can effectively screen cattle individuals with low-temperature adaptability, which is of great significance for the selection, breeding, and genetic improvement of cold-resistant cattle breeds in low-temperature regions. This invention provides a high-quality technical solution for the cultivation of distinctive germplasm resources, which can greatly shorten the breeding time and also provides a practical technical solution for the cultivation of other new livestock and poultry breeds, thus having great practical application value. Attached Figure Description

[0021] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. Hereinafter, embodiments of the invention will be described in detail with reference to the accompanying drawings, wherein:

[0022] Figure 1 The HSPA12B gene region selection signal (FLK analysis results) for 25 local cattle breeds in Example 1.

[0023] Figure 2 The HSPA12B gene region selection signal (hapFLK analysis results) for 25 local cattle breeds in Example 1.

[0024] Figure 3 The results are obtained by PCR sequencing of the SNP (g. 51910621A>G) of the low-temperature adaptation candidate gene HSPA12B in Example 1.

[0025] Figure 4 The results are obtained by electrophoresis of PCR products from HSPA12B knockout mice, which were used to screen for low-temperature adaptation candidate genes in Example 1.

[0026] Figure 5 The results of Western blot analysis of HSPA12B protein expression levels in various tissues of wild-type mice in Example 1 are shown.

[0027] Figure 6 The results of Western blot analysis of HSPA12B protein levels in interscapular brown adipose tissue (iBAT) of wild-type mice treated at 10°C and 22°C in Example 1 are shown.

[0028] Figure 7 The results show the body temperature monitoring of wild-type mice and HSPA12B gene knockout mice treated at 10°C for 72 hours in Example 1.

[0029] Figure 8 The results show the body temperature monitoring of wild-type mice and HSPA12B gene knockout mice treated at 10℃ for 28 days in Example 1.

[0030] Figure 9 The results show the body weights of wild-type mice and HSPA12B gene knockout mice after treatment at 10℃ and 22℃ in Example 1.

[0031] Figure 10 The results show the weight and body weight ratio of brown adipose tissue (iBAT), subcutaneous adipose tissue (sWAT), and epididymal adipose tissue (eWAT) in wild-type mice and HSPA12B gene knockout mice treated at 10℃ and 22℃ in Example 1.

[0032] Figure 11 The H&E staining results are shown for brown adipose tissue (iBAT), subcutaneous adipose tissue (sWAT), and epididymal adipose tissue (eWAT) of wild-type mice and HSPA12B gene knockout mice treated at 10℃ and 22℃ in Example 1. Detailed Implementation

[0033] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer.

[0034] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0035] As mentioned earlier, there is limited research on the molecular mechanisms of hypothermia adaptation in cattle. The hypothermia adaptation process involves multi-level regulation of the body, and the specific mechanisms are quite complex. Currently, there are no screening methods for hypothermia-adapted cattle breeds.

[0036] In view of this, in a typical embodiment of the present invention, a molecular marker related to bovine hypothermia adaptation is provided, including the HSPA12B gene (NCBI: AC_000170.1) and single nucleotide polymorphism sites located on the HSPA12B gene (NCBI: AC_000170.1), namely g.51906414T>C, g.51910621A>G, and g.51913699G>A. Among them, g.51910621A>G has the strongest correlation with bovine hypothermia adaptation, and is therefore the most suitable as a molecular marker for bovine hypothermia adaptation.

[0037] In another specific embodiment of the present invention, a primer for detecting molecular markers related to bovine hypothermia adaptation is provided, the primer comprising an upstream primer and a downstream primer.

[0038] In another specific embodiment of the present invention, a detection kit is provided, the detection kit comprising at least the above-mentioned primers, and further comprising sampling tools, genomic DNA extraction reagents and / or PCR reaction reagents, etc., without specific limitations.

[0039] In another specific embodiment of the present invention, the application of the above-mentioned primers or detection kits in screening bovine individuals with low-temperature adaptability is provided.

[0040] Specifically, the application methods include:

[0041] DNA was extracted from the blood of different cattle individuals;

[0042] Using primers or kits to detect the molecular markers, the genotypes of the markers can be identified, and bovine individuals with low-temperature adaptability can be screened.

[0043] In another specific embodiment of the present invention, a method for providing bovine hypothermia-related molecular markers is provided, the method comprising at least:

[0044] Genotyping of bovine DNA samples was performed using SNP chips.

[0045] Analysis of FLK and hapFLK genomic selection signals;

[0046] Identify genetic variations and differentially selected regions that are subject to positive selection;

[0047] Candidate genes and SNP markers were screened based on a candidate gene screening strategy.

[0048] In another specific embodiment of the present invention, the genotype of bovine individuals with the g.51910621 locus is performed by direct sequencing of PCR products, and bovine individuals with this low-temperature adaptation molecular marker are screened.

[0049] In another specific embodiment of the present invention, the application of the above-mentioned molecular markers, primers or detection kits in the selection, breeding and genetic improvement of cold-resistant cattle breeds is provided.

[0050] Furthermore, the application is to screen cattle individuals or breeds that are adaptable to temperature (low or high temperature).

[0051] The present invention will be further described in detail below with reference to specific embodiments. It should be noted that the specific embodiments are explanations of the present invention and not limitations thereof.

[0052] Example 1

[0053] 1. Local cattle sample collection

[0054] A total of 337 cattle from 25 local breeds were selected, and genomic DNA was extracted from their blood. The cattle samples were then divided into a high-temperature acclimatization group (annual average temperature > 18℃) and a low-temperature acclimatization group (annual average temperature < 10.5℃) based on the average annual temperature. Specific breed information is as follows:

[0055]

[0056] 2. Genotyping DNA samples using SNP chips.

[0057] The Illumina BovineHD 777K high-density SNP chip was used for genotyping of DNA samples. Genotyping results were extracted from the genotyping file Finalreport.txt using the Python program PEDDA_ROW. The SNP data was filtered using Plink 1.9 software (http: / / zzz.bwh.harvard.edu / plink / plink2.shtml). First, SNPs on the X, Y, and mitochondrial chromosomes, as well as SNPs not uniquely mapped to UMD3.1, were removed. SNPs with a detection rate below 90% or a minimum allele frequency less than 0.05 were removed. After filtering, the remaining autosomal SNPs were analyzed further.

[0058] 3. Genomic FLK and hapFLK selection signal analysis of bovine breeds in high and low temperature regions

[0059] Using the FLK and hapFLK genomic selection signal analysis methods, the selection signal values ​​corresponding to SNPs in cattle from high-temperature (above 18℃) and low-temperature (below 10.3℃) regions were compared to obtain differential selection signals. Using Nelore as a distantly related population, genotypic data from 25 local cattle breeds were analyzed using FLK and hapFLK methods to collect SNP selection signals. Whole-genome and local genomic phylogenetic trees were constructed, and genes undergoing positive selection in low-temperature cattle breeds were identified as candidate genes. P-values ​​were calculated by fitting a standard normal distribution of the whole genome in R.

[0060] 4. Identification of genetic variations and differentially selected regions under positive selection, and screening of candidate genes and molecular markers.

[0061] Using FLK and hapFLK selection signal analysis methods, we screened the top 0.1% of highly selected SNPs in cattle herds from high- and low-temperature regions, identifying a total of 182 candidate genes. Among them, the HSPA12B gene is located on chromosome 13 (AC_000170.1:c51901882-51918896). Using FLK and hapFLK selection signal analysis methods, three SNPs were identified: g.51906414T>C, g.51910621A>G, and g.51913699G>A. Among these, g.51910621A>G showed the strongest selection signal.

[0062] 5. Verification of positive selection signals in the difference selection region

[0063] The selection behavior of 25 cattle breeds was analyzed using FLK and hapFLK selection signal analysis methods. The results showed that in the FLK analysis ( Figure 1The HSPA12B gene is strongly positively selected in cattle breeds in cold regions, such as Yanbian cattle, Anxi cattle, Tibetan cattle, and Apei Jiaza cattle; in hapKLK analysis ( Figure 2 This gene has been subjected to strong positive selection in Anxi and Shigatse cattle breeds in cold regions.

[0064] 6. SNP sequencing identification method for the low-temperature adaptation gene HSPA12B

[0065] (1) Select 20 local cattle breeds from high- and low-temperature areas, collect blood and extract blood DNA.

[0066] (2) Design a pair of PCR primers to amplify a DNA fragment containing the target SNP (g.51910621) site.

[0067] SEQ ID NO.2:F:5'-CCTTGGAAACTTGTGCTGGA-3'

[0068] SEQ ID NO.3:R:5'-GTATCCCTTCTTGTGTCCTC-3'

[0069] (3) The PCR amplification system consisted of 25 μL, including 1.0 μL (10 μmol / L) upstream primer, 1.0 μL (10 μmol / L) downstream primer, 1 μL (-50 μg / L) DNA template, 10.0 μL 2×Taq PCR Master Mix, and 9.5 μL ddH2O. The PCR amplification conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, and 72℃ extension for 30 s, for 35 cycles; and 72℃ extension for 10 min. The target fragment obtained was 554 bp in length, and the PCR product was detected by 1% agarose gel electrophoresis.

[0070] (4) The PCR products were directly sequenced, and the sequence results were compared with the bovine HSPA12B gene sequence provided by the NCBI GenBank database. Genotyping was performed on the SNP (g.51910621) sites of each sample, and individuals with A>G mutations were screened. The homozygous genotype GG is the dominant genotype for low-temperature adaptation, and this individual is a low-temperature adapted bovine individual. Figure 3 ).

[0071] 7. Validation of the low-temperature adaptation function of the HSPA12B gene

[0072] (1) Hspa12b gene knockout mice were constructed using CRISPR / Cas9 gene editing technology. Two pairs of guide RNAs (gRNAs) were designed and synthesized by a biotechnology company for large-fragment knockout of the Hspa12b gene:

[0073] SEQ ID NO.5: gRNA1: 5'-AGACAGGTGTCCCGCTAGGCTGG-3'

[0074] SEQ ID NO.6: gRNA2: 5'-TATGCGACTCATGCGTGAGATGG-3'

[0075] SEQ ID NO.7: gRNA3: 5'-TTTGCTAAGGGTCATAGGATGGG-3'

[0076] SEQ ID NO.8: gRNA4: 5'-AGTGGTGTCATAAGGGATAGAGG-3'

[0077] Cas9 mRNA and Hspa12b gRNA were synthesized and diluted to 100 ng / uL and 50 ng / uL respectively. They were mixed at a 1:1 volume ratio and injected into mouse single-cell stage fertilized eggs via microinjection. The embryos were then transferred into the oviducts of pseudopregnant mice. After birth, tail DNA was extracted from the mice for gene analysis to determine the effectiveness of the gene knockout. The F0 generation of knockout mice (heterozygotes) was crossed with wild-type mice of the same strain to obtain the F1 generation, and the F1 generation (heterozygotes) were crossed with the F2 generation (homozygous knockout mice). The two primer pairs used to detect the effectiveness of the mouse sequence knockout were:

[0078] SEQ ID NO.9: F1:5'-CACTTTGTACAGACCCACACATAA-3'

[0079] SEQ ID NO.10: R1:5'-TCATTCATAGCCTCACAGGACATC-3'

[0080] SEQ ID NO.11: F2:5'-GGAGGGGATGTTGAACTGTA-3'

[0081] SEQ ID NO.12: R2:5'-AGCAGGACTAACGGGAACTA-3'

[0082] The PCR amplification products were detected by 1% agarose gel electrophoresis. The F1 and R1 amplification products were 489 bp; the presence of only a 489 bp band indicated a homozygous knockout mouse. The F2 and R2 amplification products were 729 bp; the presence of only a 729 bp band indicated a wild-type mouse, while the presence of both bands indicated a heterozygous knockout mouse. Figure 4 ).

[0083] (2) Total protein was extracted from the heart, liver, spleen, lung, kidney, and epididymis white adipose tissue (eWAT), inguinal subcutaneous adipose tissue (sWAT), and interscapular brown adipose tissue (iBAT) of wild-type mice, and the distribution of HSPA12B in each tissue was analyzed. The results showed that this protein was highly expressed in iBAT. Figure 5 After 4 weeks of cold treatment at 10°C, the level of HSPA12B protein in brown adipose tissue significantly increased. Figure 6 This indicates that the HSPA12B level in mouse brown adipose tissue can be induced to increase by low temperature.

[0084] (3) 8 weeks of age Hspa12b - / - WT mice were housed at 22℃ and 10℃ respectively, and their core body temperature was monitored to collect data. Results showed that regardless of short-term ( Figure 7 or long-term ( Figure 8 Low-temperature treatment of Hspa12b - / - The mice were able to maintain a relatively high basal body temperature, indicating that the deletion of the Hspa12b gene promotes the maintenance of core body temperature in mice, making them more adaptable to low-temperature environments.

[0085] (4) 8 weeks of age Hspa12b - / - After being housed at 22°C and 10°C for 4 weeks, the mice were sacrificed. In the 22°C environment, mice with Hspa12b gene deletion experienced weight loss, while those treated with low temperature showed Hspa12b gene deletion. - / - The mice experienced a more significant decrease in body weight. Figure 9 Mouse iBAT, sWAT, and eWAT tissues were collected and weighed, and it was found that Hspa12b was significantly reduced after low-temperature treatment. - / - The ratio of adipose tissue to body weight in mice was significantly lower than that in wild-type mice. Figure 10 Histomorphological results of three types of adipose tissue showed that after low-temperature induction, Hspa12b... - / - In mice, the volume of adipocytes in multiple sites decreased, the number of intracellular lipid droplets increased, and the degree of browning was significantly increased. Figure 11 The above results indicate that Hspa12b plays an inhibitory role in the browning process of adipose tissue. It should be noted that the expression level of the Hspa12b gene is increased in wild-type mice under low temperature induction. Combined with the phenotype of mice with this gene deletion, it can be inferred that Hspa12b participates in regulating a thermoregulation mechanism in low temperature adaptation. That is, as the degree of adipose tissue browning induced by low temperature deepens, Hspa12b needs to be expressed at a higher level to inhibit browning, prevent excessive browning of adipose tissue, and thus maintain the body's thermoregulation.

[0086] Nucleotide sequences and descriptions used in this invention

[0087] SEQ ID NO.1:

[0088] ATGTGGAGGGAGCAGAGAAAGGGGAAGGACAGTCCACATTCATGCAG GTCAAGTCCCCTGTATCTTTGGGGC A ATGACCCTTGGCTGTCTTTCCATATA GCCTCCCAGGCCCTGGTGAAGCCTGCTGATCCTCCATCC (Sequence containing the g.51910621A>G site in the HSPA12B gene on bovine chromosome 13, located at position 73 (5'-3') of this sequence, where the nucleotide at position 73 is either A or G)

[0089] SEQ ID NO.2:

[0090] F: 5'-CCTTGGAAACTTGTGCTGGA-3' (Primer F upstream of the nucleotide sequence containing the bovine HSPA12B gene molecular marker)

[0091] SEQ ID NO.3:

[0092] R: 5'-GTATCCCTTCTTGTGTCCTC-3' (Upstream primer R for amplifying the nucleotide sequence containing the bovine HSPA12B gene molecular marker)

[0093] SEQ ID NO.4:

[0094] GTATCCCTTCTTGTGTCCTCAGCCCTAGCAACAGGCCCAGCGTGGCCTCAGCTGTGTGTGCTGACAAGCTGGGATGCCATTCAGCTCCTAGAAAGCTCTAAAGTCCTAGGGCCTTTGTGGCCTCAGATGGATGTGGAGGGAGCAGAGAAAGGGGAAGGACAGTCCACATTCATGCAGGTCAAGTCCCCTGTATCTTTGGGGC AThe PCR product sequence obtained by amplification using primers SEQ ID NO.2 and SEQ ID NO.3 is 554 bp in size, with the g.51910621A>G site located at position 203.

[0095] SEQ ID NO.5:

[0096] gRNA1: 5'-AGACAGGTGTCCCGCTAGGCTGG-3' (The guide RNA (gRNA) sequence of HSPA12B gene knockout mice was constructed using CRISPR / Cas9 gene editing technology 1)

[0097] SEQ ID NO.6:

[0098] gRNA2: 5'-TATGCGACTCATGCGTGAGATGG-3' (The guide RNA (gRNA) sequence of HSPA12B gene knockout mice constructed using CRISPR / Cas9 gene editing technology 2)

[0099] SEQ ID NO.7:

[0100] gRNA3: 5'-TTTGCTAAGGGTCATAGGATGGG-3' (guide RNA (gRNA) sequence for HSPA12B gene knockout mice constructed using CRISPR / Cas9 gene editing technology 2)

[0101] SEQ ID NO.8:

[0102] gRNA4: 5'-AGTGGTGTCATAAGGGATAGAGG-3' (guide RNA (gRNA) sequence of HSPA12B gene knockout mice constructed using CRISPR / Cas9 gene editing technology 2)

[0103] SEQ ID NO.9:

[0104] F1: 5'-CACTTTGTACAGACCCACACATAA-3' (Primer sequence F1 for detecting the effectiveness of HSPA12B gene knockout in mice)

[0105] SEQ ID NO.10:

[0106] R1: 5'-TCATTCATAGCCTCACAGGACATC-3' (Primer sequence R1 for detecting the effectiveness of HSPA12B gene knockout in mice)

[0107] SEQ ID NO.11:

[0108] F2: 5'-GGAGGGGATGTTGAACTGTA-3' (Primer sequence F2 for detecting the effectiveness of HSPA12B gene knockout in mice)

[0109] SEQ ID NO.12:

[0110] R2: 5'-AGCAGGACTAACGGGAACTA-3' (Primer sequence R2 for detecting the effectiveness of HSPA12B gene knockout in mice)

[0111] SEQ ID NO.13:

[0112] CACTTTGTACAGACCCACACATAACATGCCTCGGCTATCACAGGACCACTGCCAAGGATCACTTGGTTGGGCTGAGAGAGCACAGCCTGCGGTGGCCCAGGATACAGCCAATCAGACCCACTGACAAGGGTCTTTGTGCCGGACCCCGCCACTTCTGTTGCCAGCCTTCCTAGCCCCATCCATTGATATCAGGGTCTCGGCACCATCCCATCACGCATGAGTCGCATAAGCCAAGCAGACAGCAGAGTGGGATAGAGAAGAGTTTGTGTCCACCCCTTTATACACCATGCGAACAATCACATCTGCATTTCCTGTTGGGCATTCCCAACAGGATTTCCATGGAGCTATGGGTAGGGAACAAGGACCCCTGTCTAGAAGTGGCAGCAAACAGCGGGGGCCAACCTGTGTCTCCTTCACCACCCACAGTGTGAACCTCGTGAAGTGGTCCTCACAGGGGATGCTCCG GATGTCCTGTGAGGCTATGAATGA (PCR product sequence amplified by primers SEQ ID NO.9 and SEQ ID NO.10, size 489bp)

[0113] SEQ ID NO.14:

[0114] GGAGGGGATGTTGAACTGTAGTCTTCCTGACCCTGTTCCTCTGGTACCCAGACACACTGCAGCTGTGCCCAGGCACTTTGTACAGACCCACACATAACATGCCTCGGCTATCACAGGACCACTGCCAAGGATCACTTGGTTGGGCTGAGAGAGCACAGCCTGCGGTGGCCCAGGATACAGCCAATCAGACCC ACTGACAAGGGTCTTTGTGCCGGACCCCGCCACTTCTGTTGCCAGCCTTCCTAGCCCCATCCATTGATATCAGGGTCTCGGCACCATCCCATCCTATGACCCTTAGCAAAACTTAACATGATGGTGGCTAGTGATTTGGTAGACAGGTGTCCCGCTAGGCTGGCCTTTCTGT CCCACAAGTGTTTGAGTCAAACCAGACCTGAGACCCTCCTGGAGACTGCTCTGCTTCCCAGCCCCGGCCTGGCCCTTCAGGGCGCTCTCAGAAACCCTCCTGCCCCCAGTGCTAATGTGAGTGTATGTGTGTGTGCTGAGACAGGAAATCAAAATTCCTGGTGCTGTGGATA TCCCGAGACACAGAGTTGGGCTGGGAGTAGGTGCTGCCTTCCCCTGGTCCTGTTTGTTCCTTTGGGGGGTGGGGAAGCTCCCTCAAGTCCTGATTAGGACCATGTGGCCCAACTTAATAGCAGAAAGGAACAGCCAGCCTCTGGGCCAAATGTCCCATGTCACAGCATCTG TAGTTCCCGTTAGTCCTGCT (The PCR product sequence obtained by amplification using primers SEQ ID NO.11 and SEQ ID NO.12 is 729 bp in size)

[0115] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art can modify the foregoing technical solutions or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of primers for detecting molecular markers related to bovine hypothermia adaptation in screening bovine individuals or breeds with hypothermia adaptability; among which, The primers include an upstream primer and a downstream primer, wherein the upstream primer is a single-stranded DNA molecule as shown in SEQ ID NO.2, and the downstream primer is a single-stranded DNA molecule as shown in SEQ ID NO.3; The bovine cryogenic adaptation-related molecular marker is g.51910621 A>G; The application method includes: extracting blood DNA from different individual cattle; Using primers that detect molecular markers related to bovine hypothermia adaptation, we identified the genotypes of these markers and screened for bovine individuals with hypothermia adaptation capabilities. Specifically, the PCR products were directly sequenced, and the sequence results were compared with the bovine HSPA12B gene sequence provided by the NCBI GenBank database. Genotyping was performed on the SNP g.51910621 site of each sample, and individuals with A>G mutations were screened. The homozygous genotype GG is the dominant genotype for low-temperature adaptation, and this individual is a low-temperature adapted cattle individual.

2. Application of primers for detecting molecular markers related to bovine hypothermia adaptation in the selection, breeding, and genetic improvement of bovine breeds; among which, The primers include an upstream primer and a downstream primer, wherein the upstream primer is a single-stranded DNA molecule as shown in SEQ ID NO.2, and the downstream primer is a single-stranded DNA molecule as shown in SEQ ID NO.3; The bovine cryogenic adaptation-related molecular marker is g.51910621 A>G; The application is to screen cattle individuals or breeds that are adapted to low temperatures.

Images