Identification of molecular marker related to quality of pig semen and application of molecular marker

Abstract

The invention provides identification of a molecular marker related to boar semen quality and application of the molecular marker, and relates to the technical field of biology. According to the application, a substance for detecting the SNP molecular marker rs3471304372 is applied to preparation of a product for predicting the quality of the boar semen. The SNP molecular marker rs3471304372 is related to the sperm motility and the sperm density of the pig, the TT genotype is a dominant genotype, the sperm motility and the sperm density of the pig can be effectively improved by selecting the TT genotype pig to breed, and the genetic marker is used for evaluating the sperm quality of the large white pig and breeding the breeding boar and has important reference significance for genetic breeding of the pig.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to molecular marker identification related to pig semen quality and application thereof. Background Art

[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0003] Boar fertility is crucial to the pig industry. The quality of boar semen is closely related to the conception rate and litter size of sows. Semen quality plays an important role in the genetic improvement of pigs. Compared with traditional breeding methods, molecular marker-assisted selection technology has become an effective way to improve boar fertility with its high efficiency and high accuracy.

[0004] Molecular marker-assisted selection technology indirectly selects target traits by detecting molecular markers that are closely linked to target traits, thereby improving breeding efficiency. The core of this technology is to utilize the linkage relationship between molecular markers and target trait genes. By selecting markers that are closely linked to target traits, individuals carrying excellent alleles can be quickly screened out at an early stage without having to wait for the phenotypic expression of the traits. Therefore, by screening molecular markers that are closely linked to boar semen quality traits, molecular marker-assisted selection technology can be used to more accurately select boars carrying excellent semen trait markers, thereby improving semen quality at the genetic level, which is of great significance for improving reproductive efficiency and accelerating the process of genetic improvement.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] The purpose of the present invention is to overcome the defects of the prior art and provide a SNP molecular marker related to pig semen quality and its application.

[0007] In order to solve the above technical problems, the present invention particularly adopts the following technical solutions:

[0008] In a first aspect, provided is the use of a substance for detecting the SNP molecular marker rs3471304372 in the preparation of a product for predicting pig semen quality, wherein the semen quality includes sperm motility and sperm density.

[0009] In a second aspect, a kit for predicting pig semen quality is provided, the kit comprising a substance for detecting the SNP molecular marker rs3471304372.

[0010] In a third aspect, provided is the use of the substance for detecting the SNP molecular marker rs3471304372 described in the first aspect, or the kit described in the second aspect in breeding pig screening or pig breeding.

[0011] In a fourth aspect, a method for predicting pig semen quality is provided, comprising predicting a sample whose genotype of the SNP molecular marker rs3471304372 is TT as having high sperm motility and high sperm density.

[0012] In a fifth aspect, a method for screening boars is provided, the screening method comprising obtaining the genotype of the SNP molecular marker rs3471304372, and screening boars with a genotype of TT, wherein the boars with a genotype of TT of the SNP molecular marker rs3471304372 have high sperm motility and high sperm density.

[0013] In a sixth aspect, a pig breeding method is provided, the breeding method comprising making the genotype of the SNP molecular marker rs3471304372 of the boar TT.

[0014] In a seventh aspect, provided is the use of a substance for gene editing the SNP molecular marker rs3471304372 in the preparation of a product for improving the quality of pig semen, wherein the semen quality includes sperm motility and sperm density.

[0015] In an eighth aspect, a kit for improving the quality of boar semen is provided, wherein the quality of boar semen includes sperm motility and sperm density. The kit includes a reagent for gene editing of the SNP molecular marker rs3471304372, wherein the gene editing reagent causes the subject to have a genotype of TT at the SNP molecular marker rs3471304372.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention discloses a method for identifying or assisting in identifying the quality traits of boar semen. The present invention detects the genotype of the rs3471304372T>C site in the pig CD163 gene, and finds that the genotype of the site is CC, TT or CT, and the site is significantly associated with pig sperm motility and sperm density, the TT genotype is the dominant genotype, and the sperm motility and sperm density of the TT genotype are higher than those of the CT or CC genotype. The SNP molecular marker rs3471304372 can assist in identifying the quality traits of pig semen, and the evaluation of the semen quality of Large White pigs and the selection of boars are carried out according to the genetic marker, which has important reference significance for pig genetic breeding. DETAILED DESCRIPTION

[0018] The technical scheme of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without making creative work are within the scope of protection of the present invention. Unless otherwise specified, the professional and scientific terms used in this article have the same meanings as those familiar to those skilled in the art. In addition, any method or material similar or equal to the recorded content can also be applied to the present invention.

[0019] Cluster of differentiation 163 (CD163) is a type I membrane protein, mainly expressed in monocytes and macrophages, and belongs to the B-type member of the cysteine-rich scavenger receptor superfamily. The porcine CD163 gene is located on chromosome 5. The genome includes 17 exons and 16 introns. The coding region is 3333bp in length, encoding a total of 1110 amino acids. The CD163 gene plays an important role in inflammatory response, immune regulation, and the occurrence and development of diseases. Testicular macrophages (tMΦ) have immunosuppressive functions and can protect spermatogenesis from autoimmune attacks. Studies have shown that CD163-positive M2 macrophages are significantly negatively correlated with spermatogenesis, which may affect the quality of semen, suggesting that CD163 may be a key factor affecting the reproduction of male animals. The present invention found that the SNP site rs3471304372 in the CD163 gene is associated with sperm motility and sperm density. The SNP molecular marker rs3471304372 is located at position 63326545 on chromosome 5 of the genome sequence information version number Sscrofa11.1 (accession number NM_213976.1). There is a T>C mutation. The site is position 41 of SEQ ID NO.6. The base Y of the site is C or T, and the genotype of the site is CC, TT or CT.

[0020] SEQ ID NO.6:

[0021] AATATATTTTAATAAGCTCTACCAAGTCATCCAGAAGCTA Y TAAAGAATTACTGGTCACTGACATAGTGTACCTGTTTTCA.

[0022] Through experiments, it was found that the genotype of the rs3471304372T>C site in the pig genome is related to pig sperm motility and sperm density. By detecting the genotype of the rs3471304372T>C site in the pig genome, it can assist in identifying pig semen quality traits: the sperm motility and sperm density of the TT genotype pigs are higher than those of the CT or CC genotype pigs. In this article, high sperm motility refers to sperm motility higher than the average sperm motility of the breed, and high sperm density refers to sperm density higher than the average sperm density of the breed.

[0023] Based on the above findings, the following technical solutions are provided.

[0024] In a first aspect, a method is provided for using a substance for detecting a SNP molecular marker rs3471304372 in preparing a product for predicting pig semen quality, wherein the semen quality includes sperm motility and sperm density.

[0025] In an optional embodiment, the substance for detecting SNP molecular markers includes one or more of a reagent for nucleic acid amplification, a reagent for detecting nucleic acid amplification products, a reagent for mass spectrometry detection, a reagent for constructing a sequencing library, and a reagent for sequencing. More specifically, the substance for detecting SNP sites includes, but is not limited to, primers, probes, enzymes for nucleic acid amplification reactions, fluorescent markers, buffer reagents, dNTPs, salts, etc. Depending on the specific detection means, those skilled in the art can select the above-mentioned substance for detecting SNP molecular markers according to the methods recorded in general and more specific teaching materials, references, process manuals, product descriptions, and standard documents, etc., and the present invention does not limit this.

[0026] In an optional embodiment, the reagent for nucleic acid amplification includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer includes the sequence shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer includes the sequence shown in SEQ ID NO.2.

[0027] SEQ ID NO.1: AGCTCTACCAAGTCATCCAG;

[0028] SEQ ID NO. 2: GGCCTTGAAAACAGGTACAC.

[0029] In an optional embodiment, the forward primer and the reverse primer also independently contain one or more of a universal primer sequence, a tag sequence, a restriction site sequence and a protective base for sequencing.

[0030] In an optional embodiment, the material for detecting SNP molecular markers includes a MassARRAY detection reagent, which is a nucleic acid mass spectrometry analysis method based on matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) technology. MassARRAY detection first obtains an amplification product containing a SNP site by nucleic acid amplification, and then uses a single base extension primer designed next to the SNP site to perform a single base extension reaction. The extension primer terminates after extending one base at the SNP site, so that the allele extension product of each SNP has only a difference in the terminal base. Then mass spectrometry is performed to obtain a spectrum, and a peak diagram is generated at the corresponding molecular weight position according to the difference in the molecular weight of the extension product. The MassARRAY detection reagent includes a forward primer, a reverse primer and an extension primer.

[0031] In an optional embodiment, the nucleotide sequence of the forward primer used for MassARRAY detection includes the sequence shown in SEQ ID NO.1, and the length is at least 30 bp; the nucleotide sequence of the reverse primer used for MassARRAY detection includes the sequence shown in SEQ ID NO.2, and the length is at least 30 bp. The length of the forward primer and the reverse primer of at least 30 bp helps to distinguish the primer from the target product in mass spectrometry analysis, and avoids interference with the detection result due to incomplete digestion of the primer.

[0032] In an optional embodiment, the nucleotide sequence of the forward primer for MassARRAY detection includes the tag sequence and the sequence shown in SEQ ID NO.1 from the 5' end to the 3' end; the nucleotide sequence of the reverse primer includes the tag sequence and the sequence shown in SEQ ID NO.2 from the 5' end to the 3' end.

[0033] In an optional embodiment, the nucleotide sequence of the forward primer for MassARRAY detection is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.4.

[0034] In an optional embodiment, the nucleotide sequence of the extension primer for MassARRAY detection is shown as SEQ ID NO.5.

[0035] In a second aspect, a kit for predicting pig semen quality is provided, the kit comprising a substance for detecting the SNP molecular marker rs3471304372 of the first aspect. The semen quality comprises sperm motility and sperm density.

[0036] In an optional embodiment, the kit includes one or more of a reagent for nucleic acid amplification, a reagent for detecting a nucleic acid amplification product, a reagent for mass spectrometry detection, a reagent for constructing a sequencing library, and a reagent for sequencing. More specifically, the kit includes, but is not limited to, primers, probes, enzymes for nucleic acid amplification reactions, fluorescent markers, buffer reagents, dNTPs, salts, etc. Depending on the specific detection means, those skilled in the art can select the reagent composition in the kit according to general and more specific methods recorded in teaching materials, references, process manuals, product descriptions, and standard documents, etc., and the present invention does not limit this.

[0037] In an optional embodiment, the kit includes a reagent for nucleic acid amplification, and the reagent for nucleic acid amplification includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer includes the sequence shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer includes the sequence shown in SEQ ID NO.2.

[0038] In an optional embodiment, the forward primer and the reverse primer also independently contain one or more of a universal primer sequence, a tag sequence, a restriction site sequence and a protective base for sequencing.

[0039] In an optional embodiment, the kit includes a MassARRAY detection reagent. The MassARRAY detection reagent includes a forward primer, a reverse primer and an extension primer.

[0040] In an optional embodiment, the nucleotide sequence of the forward primer used for MassARRAY detection includes the sequence shown in SEQ ID NO.1, and the length is at least 30 bp; the nucleotide sequence of the reverse primer used for MassARRAY detection includes the sequence shown in SEQ ID NO.2, and the length is at least 30 bp. The length of the forward primer and the reverse primer of at least 30 bp helps to distinguish the primer from the target product in mass spectrometry analysis, and avoids interference with the detection result due to incomplete digestion of the primer.

[0041] In an optional embodiment, the nucleotide sequence of the forward primer for MassARRAY detection includes the tag sequence and the sequence shown in SEQ ID NO.1 from the 5' end to the 3' end; the nucleotide sequence of the reverse primer includes the tag sequence and the sequence shown in SEQ ID NO.2 from the 5' end to the 3' end.

[0042] In an optional embodiment, the nucleotide sequence of the forward primer for MassARRAY detection is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.4.

[0043] In an optional embodiment, the nucleotide sequence of the extension primer for MassARRAY detection is shown as SEQ ID NO.5.

[0044] In a third aspect, provided is the use of the substance for detecting the SNP molecular marker rs3471304372 described in the first aspect, or the kit described in the second aspect in breeding pig screening or pig breeding.

[0045] In a fourth aspect, a method for predicting pig semen quality is provided, comprising predicting a sample whose genotype of the SNP molecular marker rs3471304372 is TT as a boar with high sperm motility and high sperm density.

[0046] In an optional embodiment, the prediction method can also be combined with other targets, such as other polymorphic molecular markers (such as SSR molecular markers, STR molecular markers or InDel molecular markers), or other prediction methods known in the art to assist in predicting pig sperm motility.

[0047] In a fifth aspect, a method for screening boars is provided, the screening method comprising obtaining the genotype of the SNP molecular marker rs3471304372, and screening boars with a genotype of TT, wherein the boars with a genotype of TT of the SNP molecular marker rs3471304372 have high sperm motility and high sperm density.

[0048] In a sixth aspect, a pig breeding method is provided, the breeding method comprising making the genotype of the SNP molecular marker rs3471304372 of the boar TT. The specific means for making the boar obtain a specific genotype can be achieved by a person skilled in the art using conventional methods known in the art, and the present invention is not limited thereto.

[0049] In an alternative embodiment, offspring with a target genotype are obtained by obtaining parents with known genotypes.

[0050] In an optional embodiment, offspring with a target genotype are obtained by gene editing methods.

[0051] In a seventh aspect, provided is the use of a substance for gene editing the SNP molecular marker rs3471304372 in the preparation of a product for improving the quality of pig semen, wherein the semen quality includes sperm motility and sperm density.

[0052] In an optional embodiment, the substances used for gene editing SNP molecular marker rs3471304372 include but are not limited to reagents used in the CRISPR-Cas gene editing system, specifically including but not limited to guide RNA or polynucleotides encoding guide RNA; donor DNA or polynucleotides encoding donor DNA; Cas enzymes or polynucleotides editing Cas nucleases, the Cas nucleases include but are not limited to Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9 or SpCas9; or proteins, polypeptides or complexes mutated from the above-mentioned Cas nucleases and / or fused with other functional domains.

[0053] In an eighth aspect, a kit for improving the quality of boar semen is provided, wherein the quality of boar semen includes sperm motility and sperm density. The kit includes a reagent for gene editing of the SNP molecular marker rs3471304372, wherein the gene editing reagent causes the subject to have a genotype of TT at the SNP molecular marker rs3471304372.

[0054] In an optional embodiment, the kit for improving boar sperm motility includes reagents for the CRISPR-Cas gene editing system, and the reagents for the CRISPR-Cas gene editing system include but are not limited to guide RNA or a polynucleotide encoding the guide RNA; donor DNA or a polynucleotide encoding the donor DNA; Cas enzyme or a polynucleotide that edits the Cas nuclease.

[0055] In an optional embodiment, the pig described in any of the above aspects includes a Large White pig.

[0056] The present invention is further described below by means of specific examples. However, it should be understood that these examples are only used for more detailed description and should not be understood as limiting the present invention in any form.

[0057] Example Discovery of SNP sites associated with pig semen quality and development of primers and methods for genotyping

[0058] 1. Screening of SNP sites of porcine CD163 gene

[0059] 1. Extraction of Semen Genomic DNA

[0060] The genomic DNA of 253 Large White pig semen was extracted as follows:

[0061] (1) Preparation of sperm extract: 0.5 mL Tris-HCl (1 M, pH = 8), 1 mL EDTA-Na (0.5 M, pH = 8), 1 mL NaCl (5 M), 2 mL SDS (10%), 400 μL DTT (1 M), and 5.5 mL ddHO. 2 O, mix well, autoclave, and store at room temperature.

[0062] (2) Take the semen out of the -20°C refrigerator and let it stand to liquefy. After thorough mixing, take 1 mL of semen and place it in a centrifuge tube. Centrifuge at 12,000 rpm for 2 min. Take 100 μL of the sample and precipitate it in a 1.5 mL centrifuge tube.

[0063] (3) Add 400 μL ddHO 2 O, 100 μL sperm extraction solution and 30 μL proteinase K, mix thoroughly.

[0064] (4) Digest in a constant temperature water bath at 60°C for 12 h until the sample becomes transparent.

[0065] (5) Add the same volume of Tris-saturated phenol, slowly invert to mix, centrifuge at 4°C, 10,000 rpm for 7 min, aspirate the supernatant (about 400 μL) into a new centrifuge tube, and repeat the process.

[0066] (6) Tris-saturated phenol, chloroform, and isoamyl alcohol were prepared into equal volumes in a ratio of 25:24:1 and added to the reaction mixture, and the above extraction steps were repeated.

[0067] (7) Prepare equal volumes of chloroform and isoamyl alcohol in a ratio of 24:1 and add them to the reaction. Repeat the above extraction steps and transfer the supernatant (about 150 μL) to a 2 mL centrifuge tube.

[0068] (8) Add 1 / 10 volume of sodium acetate solution (3 M) and 2 volumes of anhydrous ethanol (precooled at -20°C) to the supernatant. Slowly invert the tube to precipitate white clumps of DNA. Gently shake to mix the DNA. Centrifuge at 4°C, 10,000 rpm for 2 min and discard the supernatant.

[0069] (9) Prepare 75% ethanol (precooled to -20°C) and add it to the DNA precipitate for 10 min. Centrifuge at 4°C, 10,000 rpm for 2 min, discard the supernatant, repeat the wash twice, and briefly centrifuge again to remove the residual liquid.

[0070] (10) Open the lid and let it dry naturally. When the white precipitate becomes transparent, add 50 μL ddHO. 2 O dissolved.

[0071] (11) DNA concentration and quality were detected using a micro-spectrophotometer and agarose gel electrophoresis.

[0072] 2. Design and synthesis of detection primers

[0073] Detection primers were designed based on the pig genome sequence information version number Sscrofa11.1, and primer sets were designed for the 63326545bp site (rs3471304372), 63303274bp site (rs690846722), 63322944bp site (rs3473446970), 63323697bp site (rs1112082621), 63305780bp site (rs3476466349), and 63314277bp site (rs3473298743) of the CD163 gene on chromosome 5 of Large White pig. The nucleotide sequences of the PCR amplification primers are shown in Table 1 (F represents the forward primer, R represents the reverse primer, and U represents the extension primer).

[0074] Table 1 Primer sequences

[0075]

[0076] The above primers were synthesized by Beijing Compson Biotechnology Co., Ltd.

[0077] 3. Genotyping using Sequenom MassARRAY SNP technology

[0078] (1) The genomic DNA of the semen of 253 Large White pigs to be tested was used as a template, and the forward primer and reverse primer corresponding to each of the above-mentioned sites were used to amplify the target fragment to obtain PCR amplification products. The PCR amplification system is shown in Table 2, and the amplification program is shown in Table 3.

[0079] Table 2 PCR amplification system

[0080] Components Volume (μL) Enzyme-free water 1.75 10×PCR Buffer 0.625 MgCl(25mM) 0.325 dNTP Mix (25mM) 0.1 Forward primer (0.5 μM) 0.5 Reverse primer (0.5 μM) 0.5 HotStar Taq(5U / μL) 0.2 DNA template (10ng / μL) 1 Total volume 5

[0081] Table 3 PCR amplification program

[0082]

[0083]

[0084] (2) The PCR products in the above (1) were treated and digested with alkaline phosphatase (SAP enzyme) (see Table 4 for the digestion system and Table 5 for the digestion reaction procedure) to obtain digestion products.

[0085] Table 4 Digestion system

[0086] Components Volume (μL) Enzyme-free water 1.53 10×SAP Buffer 0.17 SAP Enzyme (1.7U / μL) 0.3 PCR amplification products 5 Total volume 7

[0087] Table 5 Digestion reaction program

[0088] Temperature(℃) Time (m) Number of cycles 37 40 1 85 5 1

[0089] (3) Using the digestion product in (2) above as a template, a single base extension reaction is performed using the extension primers at each site (see Table 6 for the extension reaction system and Table 7 for the extension reaction program) to obtain an extension product.

[0090] Table 6 Extension reaction system

[0091] Components Volume (μL) Enzyme-free water 0.619 10X iPLEX Buffer plus 0.2 iPLEX terminator 0.2 iPLEX enzyme 0.041 Extend primer Mix 0.94 Digestion products 7 Total volume 9

[0092] Table 7 Extension reaction program

[0093]

[0094] (4) The extension product in the above (3) was diluted 3 times with enzyme-free water, 6 mg of resin was added for desalting, the mixture was rotated on a rotary mixer for 15 min, and centrifuged at 2000 rpm for 5 min. The desalted sample was spotted on the sample target using a mass spectrometer, and after natural crystallization, it was placed in a mass spectrometer for matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) reaction. The mass spectrum peak was detected using Typer 4.0 software, and the genotype of the target site of each sample was determined based on the mass spectrum peak diagram.

[0095] The genotyping results of target loci of different individuals in 253 Large White pigs are shown in Tables 8 to 13. The results show that there is no polymorphism in rs690846722 and rs3473446970 loci among the 253 Large White pigs (only one genotype was detected), and they could not be analyzed subsequently and were therefore excluded. The genotyping results of rs3471304372, rs1112082621, rs3476466349 and rs3473298743 loci were good, with a genotype detection rate of >90%. The unsuccessful genotyping of some samples is indicated by “ / ”.

[0096] Table 8 Statistical raw data of different genotypes of CD163 gene rs3471304372 locus in Large White pig

[0097]

[0098]

[0099] Table 9 Statistical raw data of different genotypes of Large White pig CD163 gene rs690846722 locus

[0100]

[0101]

[0102]

[0103] Table 10 Statistical original data of different genotypes of CD163 gene rs3473446970 locus in Large White Pig

[0104]

[0105]

[0106] Table 11 Statistical raw data of different genotypes of CD163 gene rs1112082621 locus in Large White pig

[0107]

[0108]

[0109]

[0110] Table 12 Statistical raw data of different genotypes of CD163 gene rs3476466349 locus in Large White pig

[0111]

[0112]

[0113] Table 13 Statistical raw data of different genotypes of CD163 gene rs3473298743 locus in Large White pig

[0114]

[0115]

[0116]

[0117] 2. Detection of pig sperm motility and sperm density

[0118] Computer-assisted sperm analysis was used to detect sperm motility and sperm density, as follows: after taking out the semen, place it in a constant temperature water bath at 37°C for liquefaction. After the semen was completely liquefied, mix it thoroughly. Take an appropriate amount of semen and place it on a sperm quality detection counting plate preheated at 37°C. After keeping warm for 2 minutes, sperm motility and sperm density were tested.

[0119] The results of sperm motility test of 253 Large White pigs are shown in Table 14, and the results of sperm density test are shown in Table 15.

[0120] Table 14 Large White Pig Sperm Motility Test Results

[0121]

[0122]

[0123]

[0124] Table 15 Detection results of sperm density in Large White pigs

[0125]

[0126]

[0127] III. Correlation analysis between SNP loci of porcine CD163 gene and porcine semen traits

[0128] Using Excel software, the distribution of genotypes of the above loci in the Large White pig population was statistically analyzed, and the genotype frequencies, allele frequencies, polymorphism information content (PIC), heterozygosity (HE), and effective number of alleles of each locus in the population were calculated. And chi-square test was used to detect whether the locus was in Hardy-Weinberg equilibrium state; HaploView software was used to detect the minor allele frequency (MAF) of each locus, and the results are shown in Tables 16 - 19.

[0129] For the rs3471304372 locus, the CT genotype had the largest proportion in the Large White pig population. For the rs1112082621 locus, the CC genotype had the largest proportion. For the rs3476466349 locus, the TT genotype had the largest proportion. For the rs3473298743 locus, the CT genotype had the largest proportion. All 4 loci showed moderate polymorphism (0.25 < PIC < 0.5) in the Large White pig population; Chi-square test showed that all 4 loci were in Hardy-Weinberg equilibrium state (P > 0.05) in the Large White pig population.

[0130] Table 16 Population genetics results of the rs3471304372 locus of CD163 gene in the Large White pig population

[0131]

[0132]

[0133] Table 17 Population genetics results of the rs1112082621 locus of CD163 gene in the Large White pig population

[0134]

[0135] Table 18 Population genetic results of rs3476466349 locus of CD163 gene in Large White pig population

[0136]

[0137] Table 19 Population genetic results of rs3473298743 locus of CD163 gene in Large White pig population

[0138]

[0139] Note: In Tables 16 to 19, PIC is the polymorphism information content, HE is the heterozygosity, NE is the effective number of alleles, MAF is the minimum allele frequency, P value is the chi-square value, and the number in brackets is the number of samples corresponding to the genotype.

[0140] The JMP Pro 18 software was used to analyze the association between the different genotypes of the above four loci and sperm motility and sperm density. The results are shown in Table 20. The rs3471304372 locus is significantly associated with sperm motility and sperm density of Large White boars. The TT genotype is the dominant genotype, and its sperm motility and sperm density are higher than those of the CT genotype and significantly higher than those of the CC genotype. In actual breeding, selecting pigs with the TT genotype for breeding will have better semen quality.

[0141] Table 20 Association analysis between different genotypes of CD163 gene SNP loci and sperm motility and sperm density in Large White pigs

[0142]

[0143] Note: Different letters in the upper right corner of the same column indicate significant differences (P<0.05)

[0144] The SNP site of the pig genome sequence information version number Sscrofa11.1, located at the 63326545th position on chromosome 5 (accession number NM_213976.1) is named rs3471304372T>C. The site is the 41st position of SEQ ID NO.6. The base Y of the site is C or T, and the genotype of the site is CC, TT or CT.

[0145] In summary, the genotype of the rs3471304372T>C site in the pig genome is related to pig sperm motility and sperm density. By detecting the genotype of the rs3471304372T>C site in the pig genome, it can assist in identifying pig semen quality traits: the semen quality of pigs with TT genotype is higher than that of pigs with CT or CC genotype.

[0146] Unless otherwise specified, the materials, reagents, etc. used in the above examples can be obtained from commercial sources.

[0147] The main reagents used in the above examples are as follows:

[0148] PCR Enzyme (Roche, 05066506001);

[0149] PCR Accessory Set (Sequenom, 11327);

[0150] SpectroCHIP Resin Kit (Sequenom, 10117-2);

[0151] IPLEX Gold Reagent Kit (Sequenom, 10136);

[0152] Enzyme-free water (Tiangen, RT121-02);

[0153] The main instruments used in the above examples are as follows:

[0154] 384-well PCR machine (Applied Biosystems / BIO-GENER, Veriti384 / RePURE-A);

[0155] Vortex mixer (Qilin Bell, QL-901);

[0156] Centrifuge (eppendorf, 5810R);

[0157] Massarray mass spectrometer (Agena, 260000);

[0158] Massarray mass spectrometer (Agena, RS1000);

[0159] Rotary mixer (Jiangsu Haimen Qilin Bell Instrument Manufacturing Co., Ltd., WA-986);

[0160] All reagents and instruments were purchased from Beijing Compass Biotechnology Co., Ltd.

[0161] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of a substance for detecting the SNP molecular marker rs3471304372 in the preparation of a product for predicting pig semen quality, wherein the semen quality includes sperm motility and sperm density.

2. The use according to claim 1, characterized in that: The substance for detecting SNP molecular markers includes one or more of a reagent for nucleic acid amplification, a reagent for detecting nucleic acid amplification products, a reagent for mass spectrometry detection, a reagent for constructing a sequencing library, and a reagent for sequencing.

3. A kit for predicting pig semen quality, characterized in that: Includes substances for detecting SNP molecular marker rs3471304372; Optionally, the kit includes one or more of reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, reagents for mass spectrometry detection, reagents for constructing a sequencing library, and reagents for sequencing.

4. The kit according to claim 3, characterized in that The kit includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer includes the sequence shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer includes the sequence shown in SEQ ID NO.2; Optionally, the kit includes a MassARRAY detection reagent, and the MassARRAY detection reagent includes a forward primer, a reverse primer and an extension primer; Optionally, the nucleotide sequence of the forward primer includes the sequence shown in SEQ ID NO.1, and the length of the forward primer is at least 30 bp; the nucleotide sequence of the reverse primer includes the sequence shown in SEQ ID NO.2, and the length of the reverse primer is at least 30 bp; Optionally, the nucleotide sequence of the forward primer is shown as SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.4; Optionally, the nucleotide sequence of the extension primer is shown as SEQ ID NO.

5.

5. Use of the substance for detecting the SNP molecular marker rs3471304372 as claimed in any one of claims 1 to 2, or the kit as claimed in any one of claims 3 to 4 in breeding pig screening or pig breeding; Optionally, the pig comprises a Large White pig.

6. A method for predicting pig semen quality, characterized in that: This includes predicting samples with the genotype of SNP molecular marker rs3471304372 as TT as boars with high sperm motility and high sperm density.

7. A method for screening boars, characterized in that: The method includes obtaining the genotype of the SNP molecular marker rs3471304372 and screening the boars with the genotype of TT. The boars with the genotype of the SNP molecular marker rs3471304372 of TT have high sperm motility and high sperm density.

8. A pig breeding method, characterized in that: The genotype of the SNP molecular marker rs3471304372 of the boar is TT.

9. Use of a substance for gene editing SNP molecular marker rs3471304372 in the preparation of a product for improving pig semen quality, wherein the semen quality includes sperm motility and sperm density.

10. A kit for improving the quality of boar semen, characterized in that: It includes a reagent for gene editing of the SNP molecular marker rs3471304372, wherein the gene editing reagent causes the subject to have a genotype of TT at the SNP molecular marker rs3471304372.

Images