A molecular marker of the IQUB gene associated with the size of the testes and epididymis in Hu sheep and its application

Abstract

This invention discloses a method related to the size of the testes and epididymis of Hu sheep. DRIVE Gene molecular markers and their applications, wherein the molecular markers are composed of DRIVE The gene sequence was obtained by amplification using designed specific primers, and its nucleotide sequence is shown in SEQ ID NO.1. There is an A / C base mutation at position 147 bp in SEQ ID NO.1, which leads to Mlu I-RFLP restriction polymorphism. Analysis of Hu sheep... DRIVE The correlation between genotyping and testicular and epididymal size revealed that Hu sheep individuals had three genotypes: AA, AC, and CC. Individuals with the AC genotype showed significantly higher testicular and total epididymal weights than those with the AA and CC genotypes. Using the molecular markers of this invention for Hu sheep breeding offers high accuracy and allows for the selection of high-fertility Hu sheep rams in their early years, enabling early selection and accelerating the breeding process.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a phenomenon related to the size of the testes and epididymis of the Hu sheep. IQUB Gene molecular markers and their applications. Background Technology

[0002] The Hu sheep, a unique breed of lambskin sheep native to China, is prized for its delicious meat and high reproductive rate. Developing and protecting its superior traits is crucial for the sustainable development of my country's meat sheep industry. However, unplanned crossbreeding practices are gradually altering the genetic characteristics of Hu sheep, posing a threat to their long-term development. Against this backdrop, purposefully protecting and enhancing the reproductive capacity of Hu sheep, particularly male reproductive capacity, has become a key focus in Hu sheep research and practice.

[0003] Male fertility is a complex polygenic trait, influenced by multiple gene loci and environmental factors. In large-scale sheep farms, ram fertility directly affects the overall production level and economic benefits of the flock. Therefore, improving the utilization and coverage of superior breeding rams is of great significance for improving overall production levels. Semen quality is an important indicator of ram fertility, but its assessment is complex and easily affected by various factors such as age, nutritional level, and season. This makes objective and accurate evaluation of semen quality quite difficult. In contrast, testicular and epididymal size, as simple, easily measurable, and highly heritable indicators, show a significant positive correlation with reproductive performance parameters such as ejaculate volume, sperm density, and sperm motility, and a significant negative correlation with sperm abnormality rate. They are also closely related to growth performance and conception rate in fertilized females. Therefore, testicular and epididymal size can serve as an important selection indicator for genetically improving the fertility of male rams and their offspring. In breeding practice, traditional breeding methods are often time-consuming and inefficient. Molecular marker-assisted selection, as an advanced breeding method, can significantly improve the accuracy of trait selection, reduce breeding costs, and increase breeding efficiency. However, the number of candidate genes and molecular markers related to the size of the testes and epididymis in livestock remains very limited.

[0004] The IQ and ubiquitin-like domain-containing protein (IQUB) was first isolated from a rat cryptorchidism model. The protein it encodes mainly contains two domains: the IQ motif and the ubiquitin-like domain, both of which exhibit spermatogenic cell specificity in expression. Previous studies have found that IQUB can affect sperm flagellar formation by inhibiting the activity of RSPH3 and p-ERK1 / 2. Mice with IQUB gene knockout (Zhang ZH et al., 2023) and nonsense mutations in homozygous IQUB genes (Tu T et al., 2025) both cause abnormal sperm motility, leading to infertility in male mice and human men. Therefore, it can be considered that the IQUB gene is correlated with male fertility. However, no studies have been reported on the effects of IQUB on the fertility of sheep, including Hu sheep and other sheep. Summary of the Invention

[0005] The purpose of this invention is to provide a method related to the size of the testes and epididymis of Hu sheep. IQUB Genetic molecular markers provide an auxiliary selection marker for detecting the size of the testes and epididymis in Hu sheep, improving the accuracy of selection, enabling early breeding of Hu sheep breeds, and accelerating the breeding process.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] This invention provides a method related to the size of the testes and epididymis of Hu sheep. IQUB Genetic molecular markers, which are based on chromosome 4 of the Hu sheep reference genome ARS-UI_Ramb_v3.0 version. IQUB The gene sequence was obtained by amplification using designed specific primers, and its nucleotide sequence is shown in SEQ ID NO.1. At 147bp in sequence SEQ ID NO.1, r indicates an A / C base mutation, which leads to Mlu I-RFLP restriction polymorphism.

[0008] The primer pairs for amplifying the above molecular markers are as follows:

[0009] Forward primer F: CACTTTAGGATTCATTGATTTTCCT;

[0010] Reverse primer R: CTGAGTGACCAGAGCGTTTC.

[0011] The size of the testes and the size of the epididymis of the Hu sheep were the total weight of the testes and the total weight of the epididymis, respectively.

[0012] Using the above-mentioned correlations with the size of the testes and epididymis of the Hu sheep IQUBGenetic molecular markers can be used for marker-assisted selection in Hu sheep, especially for marker-assisted selection of Hu sheep rams with well-developed testes.

[0013] This invention involves extracting genomic DNA from testicular tissue of rams from Hu sheep, designing specific primer pairs for PCR amplification of the Hu sheep genome, and using the MluI-RFLP method to analyze the Hu sheep genome. IQUB Genotyping was performed on SNP loci in Hu sheep to analyze their genetic makeup. IQUB The correlation between genotype and the size of the testes and epididymis was investigated. Results showed that Hu sheep individuals were classified into AA, AC, and CC genotypes. Individuals with the AC genotype had significantly higher total testicular and epididymal weights than those with the AA and CC genotypes. Therefore, in the early selection of Hu sheep rams, individuals with the AC genotype can be chosen to achieve early breeding of Hu sheep rams with better testicular development.

[0014] By using the molecular markers provided by this invention for marker-assisted selection, it is only necessary to detect the characteristic amplification bands of the molecular markers to predict the testicular development of young Hu sheep rams after they reach adulthood. This method is simple, feasible, and highly efficient. It can select Hu sheep individuals with better testicular development when they are young, with clear selection targets and is not affected by the growth environment, thus realizing early breeding of Hu sheep breeds and accelerating the breeding process. Attached Figure Description

[0015] Figure 1 The present invention relates to the Hu sheep IQUB Partial gene sequencing results and SNP sites;

[0016] Figure 2 This invention relates to the Hu sheep. IQUB Electrophoresis results of gene PCR amplification products. The agarose concentration is 1.5%. The labeling in the figure is as follows: Lane M is the BioGold 2000 DNA Marker (containing 6 bands: 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, and 2000 bp).

[0017] Figure 3 This invention relates to the Hu sheep. IQUB Results of MluⅠ gene RFLP detection. Agarose concentration was 2%, and the labels in the figure are the same as those in the reference diagram. Figure 2 The data shows that the AA genotype fragment size is 443 bp, the CC genotype fragment sizes are 146 bp and 297 bp, respectively, and the AC genotype fragment sizes are 146 bp, 297 bp, and 443 bp, respectively. Detailed Implementation

[0018] The following embodiments are further illustrations of the present invention, but are not intended to limit the invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence should fall within the protection scope of the present invention.

[0019] The 6-month-old male Hu sheep samples used in this invention were collected from Minqin County Defu Agricultural Biotechnology Co., Ltd.

[0020] 1. Collection of testicular tissue from Hu sheep

[0021] The left testicular tissue of the above-mentioned male Hu sheep was collected, preserved in liquid nitrogen, and used for RNA and DNA extraction.

[0022] 2. Extraction of testicular RNA

[0023] (1) Grind the testicular tissue block into powder in liquid nitrogen;

[0024] (2) Take 100 mg of testicular tissue powder and transfer it to a 1.5 mL centrifuge tube. Add 1 mL of Trizol and lyse thoroughly for 5 min.

[0025] (3) Add 200 μL of chloroform, cap the centrifuge tube, shake to mix for 15 s, and let stand at room temperature for 10 min;

[0026] (4) Centrifuge at 12000r / min for 10min at 4℃, transfer the supernatant to another new centrifuge tube, add 0.5mL isoamyl alcohol, mix well and let stand at room temperature for 5-10min;

[0027] (5) Centrifuge the new centrifuge tube at 12000r / min for 10 minutes at 4℃, discard the supernatant, add 1mL of 75% ethanol to suspend the precipitate, and continue to centrifuge at 12000r / min at 4℃ for 5 minutes. Then discard the ethanol and place it in the air for 5-10 minutes to obtain RNA precipitate.

[0028] (6) Dissolve the RNA precipitate in 50 μL of RNase-free water (DEPC), determine the concentration using a spectrophotometer, and store at -80℃.

[0029] 3. Reverse transcription reaction

[0030] Following the instructions of the EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix kit, the extracted RNA was diluted to the same concentration (1 μg / μL), and 1 μL of the RNA dilution buffer was transferred to a new PCR tube. 1 μL of Anchored Oligo(dT) Primer, 10 μL of 2×ES ReactionMix, 1 μL of EasyScript RT / RI Enzyme Mix, 1 μL of gDNA Remover, and 6 μL of RNase-free Water were added to the PCR tube, for a total volume of 20 μL. The mixture was gently mixed. Reverse transcription was performed using a PCR instrument under the following conditions: incubation at 42°C for 15 min, followed by heating at 85°C for 5 s to inactivate the EasyScript RT / RI Enzyme Mix and gDNA Remover. The cDNA generated from the reverse transcription was diluted to 20 ng / μL and stored at -80°C.

[0031] 4. Polymerase chain reaction (PCR)

[0032] According to the lake sheep provided by NCBI IQUB The mRNA sequence of the gene (XM_042248759.1) was obtained. Four pairs of primers (P1-P4, as shown in Table 1) were designed using the Primer-BLAST tool to amplify the mRNA sequence. Specifically, cDNA from 50 male Hu sheep individuals was pooled (each pool consisting of 10 Hu sheep individuals), and the target fragment was amplified by PCR using the pooled cDNA as a template. The total PCR amplification reaction volume was 20 μL: 4 μL of cDNA template (20 ng / μL), 10 μL of 2×Easy Taq PCR SuperMIX (TransGen), 0.5 μL each of the above forward and reverse primers (10 μM), and ddH2O was added to bring the volume to 20 μL. PCR amplification reaction conditions: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60.2℃ annealing for 30 s, 72℃ extension for 40 s, 34 cycles; final extension at 72℃ for 5 min; stored at 4℃ to obtain PCR products, and the PCR products were detected by electrophoresis using 1% agarose gel.

[0033] 5. IQUB Single nucleotide polymorphism screening

[0034] The PCR products obtained above were sequenced. Sequencing comparison revealed an A / C base mutation in the PCR product amplified by primer P1. This mutation produces a single nucleotide polymorphism (SNP) at the restriction endonuclease MluI cleavage site (A↓[C / A]GCGT). Partial sequencing peak results are shown below. Figure 1 As shown.

[0035] 6. Genomic DNA extraction

[0036] (1) Grind the testicular tissue block into powder in liquid nitrogen;

[0037] (2) Take 20 mg of testicular tissue powder and transfer it to a 1.5 mL centrifuge tube. Add 200 μL of tissue lysis buffer GA and shake until completely suspended.

[0038] (3) Add 20µL of proteinase K solution, mix the tissue solution, incubate at 56°C for 30 min, until the cell pellet is completely digested, briefly centrifuge to remove water droplets from the inner wall of the tube cap, and then proceed to the next step.

[0039] (4) Add 200 μL of buffer GB, mix thoroughly by inverting, place at 70°C for 10 min, and briefly centrifuge to remove water droplets from the inner wall of the tube cap;

[0040] (5) Add 200 μL of anhydrous ethanol and shake well for 15 seconds. At this time, flocculent precipitate may appear. Briefly centrifuge to remove water droplets from the inner wall of the tube cap.

[0041] (6) Add the solution and flocculent precipitate obtained in the previous step into an adsorption column (place the adsorption column in the collection tube), centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column back into the collection tube.

[0042] (7) Add 500 μL of buffer GD to the adsorption column, centrifuge at 12,000 rpm for 30 sec, discard the waste liquid, and put the adsorption column into the collection tube.

[0043] (8) Add 600 μL of washing solution PW to the adsorption column, centrifuge at 12,000 rpm for 30 sec, discard the waste liquid, and put the adsorption column into the collection tube.

[0044] (9) Repeat step 7.

[0045] (10) Place the adsorption column back into the collection tube, centrifuge at 12,000 rpm for 2 min, and discard the waste liquid. Place the adsorption column at room temperature for several minutes to thoroughly dry any remaining rinsing liquid in the adsorption material.

[0046] (11) Transfer the adsorption column into a clean centrifuge tube, add 100 μL of elution buffer TE to the middle of the adsorption membrane, place at room temperature for 2-5 min, centrifuge at 12,000 rpm for 2 min, and collect the solution into the centrifuge tube to obtain the DNA solution.

[0047] 7. Detection of Restriction Fragment Polymorphism (RFLP)

[0048] according to IQUB The DNA sequence (Gene Bank ID: 101105744) was used to design a pair of specific primers P5 near the mutation site found above. Using the Hu sheep genomic DNA extracted in step 6 as a template, the target fragment was amplified by PCR. The primer P5 sequence is shown in Table 1. The PCR reaction amplification system was 20 μL, and the reaction conditions were: 10 μL of 2×Easy Taq PCR Super MIX (TransGen), 4 μL of DNA template, 0.5 μL each of the above forward and reverse primers, and 5 μL of ddH2O. The PCR amplification conditions were: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 61℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 34 cycles; 72℃ extension for 5 min. The PCR products were detected by 1.5% agarose gel electrophoresis.

[0049] Table 1 Lake Sheep IQUB Gene PCR primer sequences

[0050]

[0051] The DNA sequence obtained by amplification using the primer pair P5 is shown in SEQ ID NO.1 of the sequence listing. An A / C single nucleotide polymorphism (SNP) is present at position 147 bp in this sequence. The MluI-RFLP method was used to analyze the DNA from Hu sheep. IQUB Genotyping was performed at the SNP sites of the gene. The enzyme digestion reaction system was 15 μL, including 8 μL of PCR product, 0.5 μL of restriction endonuclease (MluⅠ), 1.5 μL of 10× buffer, and 5 μL of ddH2O. After mixing the samples, centrifuge and incubate at 37℃ for 1 h.

[0052] Take 5 μL of the enzyme digestion product and perform electrophoresis on a 2% agarose gel, followed by genotyping and identification. The results are as follows: Figure 2As shown. This amplified fragment is 443 bp in size. The polymorphic restriction site is located at 147 bp of this fragment. When the mutation site is a C base, it will produce a restriction endonuclease MluI cleavage site (A↓[C / A]GCGT). After MluI digestion of the PCR product, two bands of 146 bp and 297 bp in size will be produced, and its genotype is CC. When the site is an A base, no MluI restriction enzyme cleavage site will be produced, and the PCR product digested by MluI will still be a 443 bp band, and its genotype is AA. When the site is A / C heterozygous, since both A and C bases are present, the PCR product digested by MluI will produce three bands of 443 bp, 146 bp and 297 bp in size, and its genotype is AC.

[0053] 8. Lake sheep IQUB Genotype-testicular trait association analysis

[0054] The experiment examined polymorphism in 255 Hu sheep. Genotyping results showed that among the 255 individuals, 96 had the AA genotype, 148 had the AC genotype, and 11 had the CC genotype. (The last sentence appears to be incomplete and possibly refers to a calculation of Hu sheep genotypes.) IQUB The genotype frequency distribution of this single nucleotide polymorphism was analyzed, and association analysis between genotype and phenotype was performed using SPSS 25.0 software. If the data met the normality test, one-way ANOVA was used; otherwise, nonparametric tests were used. All values ​​are reported as mean ± standard error, and P < 0.05 was considered statistically significant. The results are shown in Table 2.

[0055] Table 2 IQUB Correlation between different gene genotypes and testicular traits

[0056]

[0057] The results in Table 2 show that the total testicular weight of Hu sheep individuals with the AC genotype is significantly higher than that of individuals with the AA and CC genotypes, and the total epididymal weight is also significantly higher. Therefore, individuals with the AC genotype can be selected for early breeding of Hu sheep rams to achieve early breeding of Hu sheep rams with better testicular development.

Claims

1. Detection of the relationship between testis and epididymis size in Hu sheep IQUB The application of SNP molecular marker reagents in marker-assisted selection of Hu sheep, characterized by: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. At 147 bp in the sequence SEQ ID NO.1, r indicates an A / C base mutation, which leads to MluⅠ-RFLP restriction polymorphism. The testicular size and epididymal size of the Hu sheep were respectively the total testicular weight and total epididymal weight. The total testicular weight of Hu sheep with AC genotype was significantly higher than that of individuals with AA and CC genotypes, and the total epididymal weight was significantly higher than that of individuals with AA and CC genotypes.

2. The detection method as described in claim 1, related to the size of the testes and epididymis of the Hu sheep. IQUB The application of SNP molecular marker reagents in marker-assisted selection of Hu sheep, characterized by: Hu sheep rams with well-developed testes and the AC genotype were selected for breeding.

3. The detection method as described in claim 1, related to the size of the testes and epididymis of the Hu sheep. IQUB The application of SNP molecular marker reagents in marker-assisted selection of Hu sheep, characterized by: The primer pairs for amplifying the SNP molecular marker are as follows: Forward primer F: CACTTTAGGATTCATTGATTTTCCT; Reverse primer R: CTGAGTGACCAGAGCGTTTC.

Images