Application of the Isoniazid Resistance-Associated Gene Rv2670c and Its Mutation Sites in Mycobacterium tuberculosis

Abstract

The present invention relates to the field of biotechnology and discloses a gene related to isoniazid resistance of Mycobacterium tuberculosis. Rv2670c The present invention discovered a new gene in the genome of Mycobacterium tuberculosis that is related to the change in isoniazid sensitivity. Rv2670c , and verified a new base mutation site in the Mycobacterium tuberculosis genome that can affect the sensitivity of Mycobacterium tuberculosis to isoniazid (gene Rv2670c The present invention provides a new method and technology for determining isoniazid resistance in Mycobacterium tuberculosis, which can be used to prepare tuberculosis diagnostic reagents and design anti-tuberculosis drugs. The newly discovered mutation site can be combined with existing products to improve the accuracy and comprehensiveness of isoniazid resistance detection in Mycobacterium tuberculosis.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a gene related to isoniazid resistance in Mycobacterium tuberculosis. Rv2670c and application of its mutation sites. Background Art

[0002] Tuberculosis is a serious infectious disease caused by Mycobacterium tuberculosis. It is highly contagious and lethal.

[0003] The emergence of drug-resistant tuberculosis (TB) has further exacerbated the challenges of TB prevention and control. Multidrug-resistant TB (MDR-TB) and extensively drug-resistant TB (XDR-TB) have low treatment success rates, low cure rates, and high mortality rates, posing a serious threat to human health.

[0004] Testing Mycobacterium tuberculosis for isoniazid susceptibility is crucial for the effective treatment of tuberculosis. Isoniazid is a first-line anti-tuberculosis drug and plays an important role in the diagnosis and treatment of drug-resistant tuberculosis. Accurate and rapid detection of drug-resistant strains can help clinicians adjust treatment plans promptly, avoid the use of ineffective drugs, thereby improving treatment success rates and reducing the spread of drug-resistant strains. The WHO recommends that all tuberculosis patients be tested for rifampicin and isoniazid resistance to ensure that they receive the most appropriate treatment.

[0005] Currently, the common mutation sites used for molecular detection of isoniazid resistance in Mycobacterium tuberculosis are mainly concentrated in katG (Rv1908c) 、 inhA(Rv1484), fabG1(Rv1483) and ahpC(Rv2428) Among them, katG The 315th site of the gene is a hotspot for mutations that has been studied extensively. For example, the AGC→ACC mutation (serine to threonine) is the most common isoniazid resistance-related mutation, accounting for more than 50% of isoniazid-resistant strains, and mainly corresponds to high-concentration isoniazid resistance (MIC ≥ 2 μg / ml) (Reference: Study on the correlation between rifampicin and isoniazid resistance-related gene mutations and resistance levels in Mycobacterium tuberculosis, Chinese Journal of Antituberculosis, 2021, 43(3): 248-254 doi: 10.3969 / j.issn.1000-6621.2021.03.010). In addition, inhA Mutations in the promoter region of genes play an important role in the detection of isoniazid resistance, especially inhA Mutation at position -15, such as -15C→T. inhAOther mutation sites of the gene, such as Gly5Ser, Glu7Ala, Gly8Ala, Arg16Gly, etc., are also associated with isoniazid resistance (Reference: Research Progress on Isoniazid-Resistant Genes and Mutations in Mycobacterium tuberculosis, Chinese and Foreign Health Digest, 2013 (10) doi: 10.3969 / j.issn.1672-5085.2013.10.463). fabG1 Mutations in gene promoter regions, especially fabG1 The C-15T mutation is more common. ahpC Although gene mutations are rare, mutations in its promoter region (such as -46G→A) are also considered to be associated with isoniazid resistance. In recent years, some new mutation sites (such as ndh, oxyR-ahpC, kasA Mutations in the PI3K gene have also been found to be associated with isoniazid resistance. Detection of these mutations provides an important basis for the molecular diagnosis of isoniazid resistance in Mycobacterium tuberculosis.

[0006] The molecular mechanism of isoniazid resistance is complex and involves mutations in multiple genes. Although some gene mutation sites associated with isoniazid resistance have been identified (such as katG 315, inhA Promoter and ahpC promoter, etc.), but these common mutation sites do not cover all drug resistance situations. Other less common mutation sites, as well as other unidentified mutations or non-gene mutations that cause drug resistance, exist. This diversity makes it impossible for detection methods and tools based on the currently discovered isoniazid resistance-associated mutation sites to comprehensively detect drug resistance in clinical practice, thus affecting the sensitivity and accuracy of detection.

[0007] In addition, different resistance gene mutations may lead to different degrees of resistance. For example, katG The S315T mutation in the gene is often associated with high-level isoniazid resistance, while inhA The C-15T mutation in the gene promoter region may lead to low-level drug resistance. Different levels of drug resistance will inevitably affect the choice of later treatment options, making the treatment process more complicated.

[0008] Therefore, continuously discovering and verifying new isoniazid resistance-related genes and mutation sites and applying them in clinical testing has become an inevitable choice to improve the sensitivity of isoniazid resistance detection in tuberculosis patients, shorten the diagnosis and treatment time of patients, and quickly formulate accurate treatment plans.

[0009] Rv2670c is a gene in Mycobacterium tuberculosis that encodes a hypothetical protein. Rv2670cIn CRISPRi screening experiments, it showed sensitivity to certain drugs, which suggests that its expression may be related to the resistance of Mycobacterium tuberculosis to drugs. Rv2670c A study report on the effects of isoniazid sensitivity on Mycobacterium tuberculosis. In a study of clinical isolates of Mycobacterium tuberculosis, Rv2670c The gene sequence was relatively conservative and no obvious gene polymorphism was found, which indicated that the gene was highly stable among different strains. Summary of the Invention

[0010] The purpose of the present invention is to provide a gene related to isoniazid resistance of Mycobacterium tuberculosis Rv2670c and application of its mutation sites.

[0011] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides a gene Rv2670c The invention relates to an application of a marker of isoniazid resistance of Mycobacterium tuberculosis in the preparation of a product for detecting isoniazid resistance of Mycobacterium tuberculosis.

[0012] The gene Rv2670c The gene encoding the following protein (a) or (b):

[0013] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 4; or

[0014] (b) A protein derived from (a) with equivalent function, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO: 4.

[0015] Furthermore, the gene Rv2670c The 14th base of the gene is mutated from C to T (correspondingly, Rv2670c The fifth amino acid of the encoded protein is mutated from alanine (A) to valine (V), corresponding to isoniazid-resistant strains of Mycobacterium tuberculosis.

[0016] In a second aspect, the present invention provides a gene related to isoniazid resistance of Mycobacterium tuberculosis Rv2670c The mutation site is a gene in the genome of the standard strain of Mycobacterium tuberculosis H37Rv Rv2670c The 14th base C of the gene is mutated to T; or,

[0017] The mutation site is the mutation of base G to A at position 2986827 on the genome of the standard strain of Mycobacterium tuberculosis H37Rv;

[0018] The reference sequence number of the Mycobacterium tuberculosis standard strain H37Rv genome is RefSeq NC_000962.3.

[0019] In a third aspect, the present invention provides use of the mutation site as a marker of isoniazid resistance of Mycobacterium tuberculosis in the preparation of a product for detecting isoniazid resistance of Mycobacterium tuberculosis.

[0020] In a fourth aspect, the present invention provides primers for detecting the mutation site.

[0021] In a fifth aspect, the present invention provides a detection reagent or kit containing the primers.

[0022] In a sixth aspect, the present invention provides the use of the primers or a detection reagent or kit containing the primers in detecting the resistance of Mycobacterium tuberculosis to isoniazid (including non-disease diagnosis and treatment purposes).

[0023] In a seventh aspect, the present invention provides a method for rapid screening of isoniazid resistance in Mycobacterium tuberculosis (including non-disease diagnosis and treatment purposes), which amplifies the gene of the Mycobacterium tuberculosis genome. Rv2670c , and detect genes Rv2670c Whether the 14th base C mutation occurs to T is used to determine the resistance of Mycobacterium tuberculosis to isoniazid.

[0024] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0025] (1) The present invention discovered a new gene in the genome of Mycobacterium tuberculosis that is associated with changes in isoniazid sensitivity— Rv2670c ;

[0026] (II) The present invention verifies a new base mutation site in the genome of Mycobacterium tuberculosis that can affect the sensitivity of Mycobacterium tuberculosis to isoniazid (gene Rv2670c The 14th base C of the gene was mutated to T);

[0027] (3) The present invention provides a new detection method and technology for determining the resistance of Mycobacterium tuberculosis to isoniazid by detecting the above-mentioned new base mutation site carried by Mycobacterium tuberculosis;

[0028] (IV) The present invention provides an application of the above-mentioned new isoniazid resistance-related gene and a new base mutation site located on the gene that can affect the sensitivity of the strain to isoniazid in the preparation of tuberculosis diagnostic reagents and the design of anti-tuberculosis drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of the structure of the expression vector pMV261 in a preferred embodiment of the present invention.

[0030] Figure 2 In the preferred embodiment of the present invention, mc carrying pMV261_Rv2670c_M plasmid 2155 bacterial suspension was diluted 10 4 After fold increase, the cell can still grow in an environment with an isoniazid concentration of 4ug / ml.

[0031] Figure 3A 、 Figure 3B and Figure 3C In the preferred embodiment of the present invention, the clinical strain genome Rv2670c Distribution of gene mutations.

[0032] Figure 4 This is the drug and concentration distribution (μg / ml) of the Mycobacterium tuberculosis MYCOTBI drug susceptibility plate in a preferred embodiment of the present invention. OFL: ofloxacin, MXF: moxifloxacin, RIF: rifampicin, AMI: amikacin, STR: streptomycin, RFB: rifabutin, PAS: para-aminosalicylic acid, ETH: ethionamide, CYC: cycloserine, INH: isoniazid, KAN: kanamycin, EMB: ethambutol, POS: growth control.

[0033] Figure 5 In the preferred embodiment of the present invention, 6 strains carry Rv2670c Susceptibility of clinical strains with a mutation at position 14 of the gene to isoniazid. The green box indicates the isoniazid detection area, the red circle indicates the isoniazid MIC, and the blue circle indicates that the strain's isoniazid MIC has exceeded the maximum detection range. (a) AH20030 susceptibility test results; (b) AH21040 susceptibility test results; (c) AH21069 susceptibility test results; (d) GS06037 susceptibility test results; (e) JL06048 susceptibility test results; and (f) XJ20554 susceptibility test results. DETAILED DESCRIPTION

[0034] The first object of the present invention is to provide a new gene in the genome of Mycobacterium tuberculosis that is related to the change in sensitivity to isoniazid and a mutation site on the gene.

[0035] The second object of the present invention is to provide an application of the mutation site as a detection target in the field of molecular drug resistance detection of Mycobacterium tuberculosis, especially for detecting high-concentration isoniazid resistance.

[0036] The third object of the present invention is to provide a rapid screening method for isoniazid resistance of Mycobacterium tuberculosis, which can be used as a means of diagnosing drug-resistant tuberculosis (isoniazid resistance).

[0037] The fourth object of the present invention is to provide a new target for anti-tuberculosis drugs that can be used to treat tuberculosis.

[0038] In order to screen new genes related to isoniazid resistance in the Mycobacterium tuberculosis genome, enrich the existing targets for isoniazid molecular resistance detection in Mycobacterium tuberculosis, improve the sensitivity and detection rate of detection, and achieve rapid and accurate treatment of tuberculosis patients.

[0039] The present invention adopts the following technical solutions:

[0040] First, the discovery of new genes and mutation sites related to isoniazid resistance in the Mycobacterium tuberculosis genome.

[0041] The data of Mycobacterium tuberculosis strains with published whole genome sequencing information and isoniazid phenotypic resistance test results were retrieved from public databases. After bioinformatics analysis, the results showed that the Mycobacterium tuberculosis genome Rv2670c Gene, sequence as SEQ ID NO:1 ( Rv2670c :1-1110bp) or its base complementary sequence SEQ ID NO:2 (H37Rv:2985731-2986840bp), and a base mutation on its gene ( Rv2670c The 14th base on the gene (base 2986827 on the H37Rv genome) is associated with isoniazid sensitivity.

[0042] Secondly, Rv2670c Biological verification of the influence of genes and mutation sites on isoniazid sensitivity.

[0043] Build and carry Rv2670c The recombinant plasmid pMV261_Rv2670c_W carrying the wild-type sequence of the gene (SEQ ID NO: 1) Rv2670c The recombinant plasmid pMV261_Rv2670c_M with the gene mutant sequence (base C at position 14 was mutated to T, SEQ ID NO: 3) was introduced into Mycobacterium smegmatis mc 2 155, detection of Mycobacterium smegmatis mc containing different plasmids 2 155Differences in sensitivity to isoniazid.

[0044] Third, screening for carriers in clinical strains Rv2670c strains with a mutation at position 14 of the gene.

[0045] Through bioinformatics analysis, the clinical strains of Mycobacterium tuberculosis that have been stored in our laboratory and have completed whole genome sequencing were screened for carriers. Rv2670c strains with mutations at position 14 of the gene, and amplifying the strains obtained by screening [[ID=5The complete gene sequence was compared and the mutation at the 14th base was analyzed through sequencing.

[0046] Fourth, evaluate the carrying ​ Susceptibility of clinical strains with mutations at base 14 of the gene to isoniazid.

[0047] Carriers screened ​ The clinical strain with mutation at base 14 of the gene was tested for its sensitivity to isoniazid using microplate susceptibility test to verify ​ Effect of mutation at base 14 of the gene on the sensitivity to isoniazid.

[0048] Molecular resistance testing for isoniazid usually relies on ​ 、 ​ 、 ​ and ​ Mutation analysis of genes and their promoter regions. Although, e.g. ​ The S315T mutation is one of the primary markers of drug resistance, but mutations in other genes should not be ignored, and specific mutations may be associated with resistance patterns in specific regions. Due to the diversity and complexity of drug-resistance mutations, testing a single gene or mutation site is insufficient to comprehensively assess drug resistance. Therefore, comprehensive multi-gene, multi-site analysis is needed to improve diagnostic accuracy and reliability. Although this approach can cover most clinically relevant cases of isoniazid resistance, it can still miss diagnoses, especially for those caused by atypical or rare mutations.

[0049] By continuously adding new resistance-related genes and mutation sites, the detection range of existing molecular diagnostic tools will be more comprehensive and reduce false negative results. ​ The gene and its 14th base mutation have not been used in any molecular detection products for isoniazid resistance that are currently on the market. ​ The detection of the gene and its 14th base mutation (base 2986827 of the H37Rv genome) combined with existing products will inevitably improve the accuracy and comprehensiveness of isoniazid resistance detection in Mycobacterium tuberculosis.

[0050] The base mutations listed in this paper all result in isoniazid resistance at concentrations no less than 2 μg / ml, which, according to the World Health Organization (WHO), constitutes high-concentration isoniazid resistance. Therefore, the base mutations listed in this paper are associated with high-concentration isoniazid resistance and can distinguish between low- and high-level isoniazid resistance, clearly guiding clinical drug dosage selection, enabling timely adjustments to first-line medication regimens for isoniazid-resistant patients, and reducing the risk of treatment failure and drug side effects.

[0051] Tuberculosis (TB) is a major chronic, infectious disease worldwide, and its epidemiological surveillance has always been a key focus of TB prevention and control. By analyzing newly discovered drug-resistance-associated mutation sites, we can construct a more refined network for the spread of drug-resistant strains, identify "super-spreaders" or drug-resistance hotspots, monitor the geographic distribution and prevalence of new mutations in real time, and provide early warning of potential drug-resistance outbreaks. The discovery and functional analysis of new drug-resistance-associated genes may also reveal new drug targets, providing potential design targets for the development of new anti-TB drugs.

[0052] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0053] The Mycobacterium smegmatis mc used in the following examples 2 155 was purchased from the American type culture collection (ATCC).

[0054] Example 1 Discovery of new genes and mutation sites associated with isoniazid resistance in the Mycobacterium tuberculosis genome

[0055] The data of Mycobacterium tuberculosis strains with both whole genome sequencing information and isoniazid phenotypic resistance test results were retrieved from the public database of NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov). Based on bioinformatics analysis, after removing low sequencing quality mutation sites, removing mutation sites unique to different strains, removing rare mutation sites, removing mutation sites not related to drug resistance, removing uninterpretable drug sensitivity results, and eliminating redundant data such as genes and mutation sites related to isoniazid resistance in the currently known Mycobacterium tuberculosis genome, combined with the isoniazid resistance phenotypic test results of each selected strain, a total of 2588 strains of strain data were included. After comparison and analysis, it was found that 55 of the strains had the same mutation site in the corresponding H37Rv genome. ​ The 14th base C in the gene mutated to T (i.e., the 2986827th base in the H37Rv genome, and the G mutated to A), and the isoniazid phenotypic resistance test result was resistant (R); the whole genome sequencing data of the remaining 2533 strains showed that the 14th base in the Rv2670c gene was C (i.e., the corresponding bases at the 2986827th base in the H37Rv genome were all G), no mutation occurred, and the isoniazid phenotypic resistance test result was resistant or sensitive (R or S); that is, when ​When the 14th base C on the gene mutates to T (i.e., the corresponding 2986827th base G on the H37Rv genome mutates to A), Mycobacterium tuberculosis becomes resistant to isoniazid, as shown in Tables 1 and 2.

[0056] ​ Mycobacterium tuberculosis ( ​ ) A gene on the reference strain H37Rv genome (RefSeq NC_000962.3), located at chromosome position 2985731-2986840bp, with a nucleotide sequence length of 1110 bp. The encoding product of this gene contains 369 amino acids, and the sequence is shown in SEQ ID NO:4. ​ The specific function of this gene has not yet been fully elucidated. It is speculated that it encodes a transmembrane protein or enzyme that may be involved in cell wall synthesis, drug efflux or other important physiological processes.

[0057] Table 1 ​ Base sites of genes associated with isoniazid resistance

[0058]

[0059] Table 2 ​ Base sites of genes associated with isoniazid resistance

[0060]

[0061] Example 2 ​ Functional verification of genes and mutation sites affecting isoniazid sensitivity

[0062] Mycobacterium smegmatis ( ​ ) is a non-pathogenic mycobacterium that is widely used as a model strain for studying the gene function of Mycobacterium tuberculosis because of its high genetic similarity with Mycobacterium tuberculosis and high operational safety. 2 155 was used as a model strain to verify the biological functions of the newly discovered mutation sites.

[0063] 1. ​ Wild-type gene ​ Construction of gene mutation recombinant plasmid

[0064] Respectively ​ The wild-type sequence of the gene (SEQ ID NO: 1) and ​The mutant gene sequence (C to T at position 14, SEQ ID NO: 3) was synthesized in vitro and ligated into the pMV261 plasmid (a gift from the Howard Hughes Medical Institute at Albert Einstein College of Medicine). ​ Ⅰ and ​ Ⅰ between the restriction sites, construct ​ Gene wild-type recombinant plasmid pMV261_Rv2670c_W and ​ The gene mutant recombinant plasmid pMV261_Rv2670c_M was introduced into Escherichia coli and preserved. ​ shown.

[0065] 2. Recombinant Plasmid Recovery and Extraction

[0066] A small amount of E. coli cells containing the recombinant plasmid were picked and streaked onto a solid LB plate containing kanamycin (50 μg / ml), and cultured in a constant temperature incubator at 37°C for 12-16 hours.

[0067] A single colony was picked and inoculated into 5 ml of LB liquid medium containing kanamycin (50 μg / ml). The culture was incubated overnight in a shaker at 37°C and 180 rpm. The recombinant plasmid was extracted according to the instructions of the Tiangen Plasmid Extraction Kit (DP103-03).

[0068] 3. Mycobacterium smegmatis mc 2 155 Preparation of competent cells

[0069] Pick up the mc grown on the LB solid plate 2 155 single clones were inoculated into 5 ml of 7H9 liquid culture medium and cultured at 37°C, 180 rpm, with shaking until the OD600 value was about 0.6.

[0070] The above bacterial solution was inoculated into 200 ml of 7H9 liquid culture medium (containing 1‰ Tween 80) at a ratio of 1:100, and cultured at 37°C with shaking until the OD600 value reached about 0.6.

[0071] Incubate the culture on ice for 1-2 h.

[0072] The cells were collected by centrifugation at 5000 rpm for 10 min at 4°C and the supernatant was discarded.

[0073] Resuspend the cells in 100 ml of pre-chilled 10% sterile glycerol.

[0074] The cells were collected by centrifugation at 5000 rpm for 10 min at 4°C and the supernatant was discarded.

[0075] Repeat the washing of the bacteria three times, and reduce the volume of 10% sterile glycerol used to 50 ml, 25 ml, and 12.5 ml respectively. Finally, use 5 ml of pre-cooled 10% sterile glycerol to resuspend the bacteria, gently pipette to mix, and dispense 200 ul into 1.5 ml Eppendorf tubes. Store at -80°C for later use.

[0076] 4. Construction of recombinant plasmids (two recombinant plasmids pMV261_Rv2670c_W, pMV261_Rv2670c_M and pMV261 empty plasmid) by electroporation to overexpress Mycobacterium smegmatis:

[0077] Mycobacterium smegmatis mc 2 After thawing the competent medium on ice, add 5ul of each of the three plasmid DNAs mentioned above, mix gently, and incubate on ice for 10min.

[0078] Transfer the above mixture to a pre-cooled 2mm electroporation cuvette, wipe off the moisture on the outside of the cuvette, set the electroporator parameters to voltage 2.5kV, resistance 1000Ω, and capacitance 25µF, and click electroporation.

[0079] After electroporation, the mixture was transferred to a 1.5 ml EP tube, 1 ml of 7H9 liquid culture medium was added, and the tube was placed in a shaker at 37 °C and 180 rpm for 4 h to recover.

[0080] Centrifuge at 5000 rpm for 10 min, discard part of the supernatant, and use 200 μl to resuspend the bacteria. Spread the suspension on an LB solid plate containing kanamycin (50 μg / ml), and culture in a 37°C constant temperature incubator for 3-5 days to observe whether there is any colony growth.

[0081] 5. Identification of Recombinant Plasmids Overexpressing Mycobacterium smegmatis

[0082] A single colony of the constructed recombinant plasmid overexpressing Mycobacterium smegmatis was picked and placed in 5 ml of fresh 7H9 liquid culture medium. The culture was incubated at 37°C, 180 rpm, and cultured for 2 days. PCR was then performed to identify the bacterial culture. The primers used for identification were pMV261F:GTCATGGGCCGAACATACT and pMV261R:GTAACATCAGAGATTTTGAGACAC (SEQ ID NOs: 5-6). The PCR product was sent to the company for sequencing, and the sequencing results were consistent with those of H37Rv ​ Gene sequences were compared to confirm the successful construction of recombinant plasmid overexpressing Mycobacterium smegmatis mc 2 155_pMV261 (carrying pMV261 empty plasmid), mc 2 155_pMV261_Rv2670c_W (carrying ​ Wild-type gene SEQ ID NO: 1), mc 2155_pMV261_Rv2670c_M (carrying ​ Mutant gene SEQ ID NO: 3).

[0083] 6. Plate susceptibility test to detect the sensitivity of recombinant plasmid-overexpressing Mycobacterium smegmatis to isoniazid

[0084] Prepare susceptibility plates containing different concentrations of isoniazid. Prepare 10 mg / ml isoniazid solution and 100 mg / ml kanamycin solution. Using sterile culture dishes, prepare 7H10 plates with the following isoniazid concentrations: isoniazid (0 μg / ml): kanamycin (50 μg / ml), isoniazid (1 μg / ml): kanamycin (50 μg / ml), isoniazid (2 μg / ml): kanamycin (50 μg / ml), and isoniazid (4 μg / ml): kanamycin (50 μg / ml).

[0085] Cultivation of recombinant plasmid-overexpressing Mycobacterium smegmatis. For each of the three recombinant plasmid-overexpressing Mycobacterium smegmatis strains, fresh monoclonal colonies were picked from 7H10 solid plates and placed in 5 ml of 7H9 liquid medium (kanamycin 50 μg / mL). Culture with shaking at 37°C and 180 rpm until the logarithmic growth phase. Adjust the OD600 of the culture to approximately 0.2.

[0086] Dilution of recombinant plasmid-overexpressing Mycobacterium smegmatis samples. In a 1ml 96-well deep-well plate, the three recombinant plasmid-overexpressing Mycobacterium smegmatis bacterial suspensions were serially diluted using 7H9 medium (kanamycin 50ug / ml) at a dilution factor of 10. 1 , 10 2 , 10 3 , 10 4 .

[0087] Three recombinant plasmids overexpressed 10 1 , 10 2 , 10 3 , 10 4 Dilute the bacterial solution and apply 10ul of the solution on 7H10 culture dishes containing different concentrations of isoniazid. Seal the culture dishes and culture at 37℃ for 3-5 days before observing the results.

[0088] It was observed that mc carrying the pMV261_Rv2670c_M plasmid 2 155 bacterial suspension was diluted 10 4 After fold increase, the cells could still grow at an isoniazid concentration of 4ug / ml; however, the cells carrying the pMV261_Rv2670c_W plasmid and the pMV261 empty plasmid 2 155 bacterial solution diluted 10 2After 2 times, the growth of the bacteria was significantly inhibited in the environment of isoniazid concentration of 2ug / ml, and no growth was observed in the environment of isoniazid concentration of 4ug / ml; that is, when ​ When the 14th base C on the gene mutates to T (i.e. the 2986827th base G on the H37Rv genome mutates to A), the sensitivity of Mycobacterium tuberculosis to isoniazid decreases and it exhibits drug resistance, such as ​ shown.

[0089] Example 3 Carrying ​ Screening of clinical strains for mutations at base 14 of the gene

[0090] The original sequencing data of clinical strains of Mycobacterium tuberculosis that have completed whole genome sequencing were obtained from the data storage of our laboratory; the genome sequence of the reference strain H37Rv of Mycobacterium tuberculosis (RefSeq NC_000962.3) was downloaded from the NCBI database, and ​ Gene annotation information, clear ​ The location and sequence characteristics of the gene in the reference genome; the original sequencing data of the clinical strain of Mycobacterium tuberculosis after quality control were compared with the reference genome of Mycobacterium tuberculosis; the ​ The variation of gene region is found according to gene annotation information. ​ The mutation record at the 14th base of the gene was used to extract the information of the strain carrying the mutation at this site.

[0091] After whole genome comparison and analysis, 6 strains were screened out from the clinical strains whose whole genome sequencing had been completed by the Tuberculosis Control Room of the Institute of Infectious Disease Prevention and Control, Chinese Center for Disease Control and Prevention. ​ The clinical strains in which the C at position 14 of the gene mutated to T (i.e., the G at position 2986827 on the H37Rv genome mutated to A) are AH20030, AH21040, AH21069, GS06037, JL06048, and XJ20554.

[0092] 1. Scrape a loop of fresh culture of each of the six clinical strains and place it into a screw-cap centrifuge tube containing 200 μl of TE. Inactivate the culture at 80°C for 30 minutes and then lyse the cells at 100°C for 10 minutes. Centrifuge the tube at 12,000 rpm for 10 minutes and collect the supernatant as the template for amplification.

[0093] 2. Use the above template to amplify the corresponding clinical strains ​The primers used for amplification and sequencing of the full-length gene were Rv2670cF: TGGAGCTGTCCAAGCTGTACCT, Rv2670cR1: TCCAAGCTGCTGATGAAGTTCGC or Rv2670cR2: TGAATACCGCCATGTCACGGTCAA (SEQ ID NO: 7-9). When the amplification efficiency of primers Rv2670cF / Rv2670cR1 was poor, primers Rv2670cF / Rv2670cR2 were used for amplification. The PCR amplification products were sent to the company for sequencing, and the sequencing results were consistent with those of H37Rv ​ Gene sequences were compared to identify mutation sites.

[0094] 3. After amplification, sequencing and analysis, it was found that 6 strains, including AH20030, AH21040, AH21069, GS06037, JL06048 and XJ20554, all carried complete ​ gene, and the 14th base C mutated to T, while the reference genome H37Rv ​ There is no mutation at base 14 of the gene, e.g. ​ 、 ​ and ​ shown.

[0095] Example 4 Carrying ​ Susceptibility of clinical strains with mutations at position 14 of the gene to isoniazid

[0096] The Mycobacterium tuberculosis MYCOTBI drug sensitivity test panel produced by Thermo Fisher Scientific was used to test the six strains of AH20030, AH21040, AH21069, GS06037, JL06048, and XJ20554. ​ The sensitivity of clinical strains with gene mutations to isoniazid, the composition of the drug sensitivity panel is as follows ​ shown.

[0097] 1. Take 2 ml of sterile saline and place it into a sterile ultrasonic dispersion tube.

[0098] 2. Use a sterile inoculating loop to scrape a certain amount of the strain to be tested that has been cultured for no more than 14 days and add it to an ultrasonic dispersion tube containing physiological saline.

[0099] 3. Ultrasonic dispersion was performed for 30 seconds. After the bacterial suspension was naturally settled for 15 minutes, the concentration of the bacterial suspension was adjusted to 0.5 McFarland units.

[0100] 4. Transfer 100 μl of bacterial suspension to 10 ml of Mycobacterium tuberculosis MYCOTBI culture medium and vortex to mix for 30 seconds.

[0101] 5. Use a multichannel pipette to transfer 100 μl to each well of the Mycobacterium tuberculosis MYCOTBI Antibiotic Susceptibility Test Plate.

[0102] 6. Cover all wells with adhesive sealing film. Make sure all wells are completely covered to ensure adequate sealing.

[0103] 7. Incubate the plate at 35-37°C in an aerobic environment for 14 days and inspect its growth. When colonies grow in the control wells, the lowest antibiotic concentration represented by the drug-containing wells where colony growth is significantly inhibited is the minimum inhibitory concentration (MIC) of the antibiotic.

[0104] 8. According to the regulations of the World Health Organization (WHO), the Clinical and Laboratory Standards Institute (CLSI) of the United States and relevant literature reports, Mycobacterium tuberculosis can be judged as resistant (R) when the MIC of Mycobacterium tuberculosis to isoniazid is greater than 0.2ug / ml, and it can be judged as high-concentration resistant when the MIC of Mycobacterium tuberculosis to isoniazid is greater than or equal to 2ug / ml.

[0105] 9. The Mycobacterium tuberculosisMYCOTBI drug sensitivity test panel produced by Thermo Fisher Scientific was used to test the sensitivity of 6 clinical strains, including AH20030, AH21040, AH21069, GS06037, JL06048, and XJ20554, to isoniazid. ​ Clinical strains with mutations at position 14 of the gene all showed high-concentration resistance to isoniazid. The data are summarized in Table 3. The drug sensitivity results are shown in ​ As shown above, the results show that when the Mycobacterium tuberculosis genome ​ When the C at the 14th base of the gene mutates to T (that is, the G at the 2986827th base on the H37Rv genome corresponding to the Mycobacterium tuberculosis mutates to A), the strain shows high-concentration resistance to isoniazid.

[0106] Table 3 Carrying ​ Susceptibility of strains with mutations at position 14 of the gene to isoniazid

[0107]

[0108] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. Genes Rv2670c Use of a marker of isoniazid resistance of Mycobacterium tuberculosis in the preparation of a product for detecting isoniazid resistance of Mycobacterium tuberculosis; The gene Rv2670c The nucleotide sequence is shown in SEQ ID NO: 1; The gene Rv2670c The 14th base of the gene was mutated from C to T, corresponding to the isoniazid-resistant strain of Mycobacterium tuberculosis.

2. A rapid screening method for isoniazid resistance in Mycobacterium tuberculosis, characterized in that: Amplification of genes from the Mycobacterium tuberculosis genome Rv2670c , and detect genes Rv2670c Whether the 14th base C mutates to T is used to determine the resistance of Mycobacterium tuberculosis to isoniazid; The gene Rv2670c The nucleotide sequence is shown in SEQ ID NO: 1; The method is for non-disease diagnosis and treatment purposes.

Images