Application of CHPF2 in glioblastoma prognosis diagnosis reagent

Abstract

The invention discloses application of CHPF2 in a glioblastoma prognosis diagnosis reagent, and relates to the technical field of CHPF2 application. The method specifically comprises the following steps: 1, obtaining and treating a glioblastoma sample; step 2, HE and immunohistochemical staining; 3, analyzing expression, prognosis and immune cell infiltration conditions of CHPF2 and mRNA thereof in glioblastoma by a bioinformatics method; and 4, observing the influence of CHPF2 on the proliferation and growth of U251 and A172 cells through an in-vitro experiment. Experimental results prove that CHPF2 is mainly expressed in tumor tissues, the expression of CHPF2 is increased along with the increase of glioma grading, and the expression in primary glioblastoma is the highest; cHPF2mRNA and protein levels thereof of the U251 cell and the A172 cell are higher than those of normal cells; cHPF2 is mainly expressed in a cell nucleus and cytoplasm.

Description

Technical Field

[0001] The present invention relates to the technical field of CHPF2 application, and in particular to the application of CHPF2 as a prognostic diagnostic reagent for glioblastoma. Background Art

[0002] Glioma is a type of malignant tumor originating from glial cells. It is considered to be one of the brain tumors with the worst prognosis clinically due to its high invasiveness and resistance to existing treatments. According to statistics, the incidence of gliomas is on the rise, especially glioblastoma (GBM), whose survival period is usually between 14 and 17 months, and the treatment effect is not ideal. This is mainly due to the complexity of its biological characteristics and microenvironment, which makes traditional treatments such as surgery, radiotherapy and chemotherapy (such as temozolomide and bevacizumab) limited in effect. Although these therapeutic drugs can slow tumor growth, they are often accompanied by side effects such as nausea, fatigue and immunosuppression, which further affect the patient's quality of life.

[0003] Chondroitin sulfate (CS), as a class of glycosaminoglycans (GAGs), is composed of repeating disaccharides of n-acetylgalactosamine and d-glucuronic acid (DS is l-iduronic acid) with various sulfation patterns. Due to its specific structural features, especially sulfation and molecular size, CS plays an important role in antioxidant, neuroprotective, anti-tumor, anti-proliferative and anti-adhesion processes. Chondroitin sulfate proteoglycan (CSPG) is a complex formed by chondroitin sulfate (CS) covalently linked to the proteoglycan (PG) core protein. Proteoglycans (PG) containing CS1 / 2DS chains are located in the extracellular matrix, and the upregulation or downregulation of CSPG expression is associated with normal and pathological conditions. And CSPG is able to regulate key cellular processes, including proliferation, cell death, migration, adhesion and invasion, as well as extracellular machinery assembly through its highly negatively charged CS1 / 2DS side chain. The structural changes of CS chains in CSPG lead to various activities of growth factors and their receptors, enabling them to specifically promote various biological effects. The type of CS (i.e., sulfation pattern) appears to be a key factor in cancer progression.

[0004] CHPF2 is one of the six glycosyltransferases in the biosynthesis of CS, and there are few related research reports. The expression and possible role of CHPF2 in glioblastoma were analyzed through a series of bioinformatics methods, and preliminary verification was performed through in vitro experiments to study the expression changes of CHPF2 in glioblastoma and its influence on its proliferation and growth. Summary of the invention

[0005] The purpose of the present invention is to solve the shortcomings in the prior art and to propose the application of CHPF2 as a prognostic diagnostic agent for glioblastoma.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] The application of CHPF2 as a prognostic diagnostic reagent for glioblastoma specifically comprises the following steps:

[0008] Step 1: Obtaining and processing glioblastoma samples; processing the obtained glioblastoma samples to prepare glioblastoma paraffin sections for later use;

[0009] Step 2: HE and immunohistochemical staining; dewax and dehydrate some glioblastoma paraffin sections to obtain glioblastoma section samples, stain some glioblastoma section samples with HE staining kit to observe the optical morphology of section cells; perform immunohistochemical staining on another part of glioblastoma section samples to observe positive results;

[0010] Step 3: Bioinformatics methods were used to analyze the expression, prognosis, and immune cell infiltration of CHPF2 and its mRNA in glioblastoma; specifically, CHPF2 gene expression analysis, CHPF2 expression analysis in glioblastoma patient tissues, CHPF2 mRNA expression in glioblastoma patient tissues and patient prognosis survival analysis, and CHPF2 mRNA expression in glioblastoma patient tissues and immune cell infiltration analysis;

[0011] Step 4: In vitro experiments were performed to observe the effect of CHPF2 on the proliferation and growth of U251 and A172 cells; specifically, cell culture, passaging, siRNA sequence design, transfection and grouping, reverse transcription real-time fluorescence quantitative PCR, immunoblotting, immunofluorescence, Transwell and scratch tests.

[0012] Preferably: the specific method of CHPF2 gene expression analysis is as follows: retrieve mRNA sequencing data of 33 cancers and corresponding normal tissues from the TCGA cohort from the Tumor Immune Estimation Resource Database, analyze the expression of CHPF2 mRNA in various cancer tissues and corresponding normal tissues, organize the relevant data into an expression matrix, and use the ggplot2R package to visualize the CHPF2 mRNA expression.

[0013] Further: The specific method for analyzing the expression of CHPF2 in glioblastoma patient tissues is as follows: After retrieval through UALCAN, the data is downloaded and organized into a gene expression matrix, and the R language wilcox statistical method is used to analyze the protein expression of CHPF2 in glioblastoma patient tissues.

[0014] As a preferred embodiment of the present invention: the specific method for analyzing the expression of CHPF2 mRNA in glioblastoma patient tissue and patient prognosis and survival is as follows: the data on CHPF2 mRNA expression and overall survival of glioblastoma patients are obtained through the TCGA and CGGA databases, the correlation between CHPF2 mRNA expression and patient prognosis is analyzed using the survivalR package of R language, and the effect of the difference in CHPF2 mRNA expression on patient prognosis and survival rate is analyzed using the log rank test.

[0015] On the basis of the above scheme: the specific method of CHPF2 mRNA expression in glioblastoma patient tissues and immune cell infiltration analysis is as follows: the data on CHPF2 mRNA expression in glioblastoma patient tissues obtained from the TCGA database, and the relationship between CHPF2 mRNA expression levels and immune activators and immunosuppressants in glioblastoma were evaluated through the TISIDB database.

[0016] On the basis of the above scheme: the cells in cell culture and passaging are human brain glioma cell lines A172 and U251, and human astrocytes SVG-P12; the siRNA sequences designed for CHFP2 in the siRNA sequence design, transfection and grouping are UAGUCAGCGUUGUAGAAGC(dT)(dT), GCUUCUACAACGCUGACUA(dT)(dT).

[0017] Furthermore: the reverse transcription real-time fluorescence quantitative PCR uses the TRIzol reagent kit procedure to extract total RNA from three types of cells: U251, A172 and SVG-P12, and performs reverse transcription quantitative PCR and SYBR Green real-time PCR on them.

[0018] On the basis of the above scheme: the cells were transfected in a 6-well plate in the Transwell, and the cells were digested after culturing for 24 hours. 8000 cells were inoculated into a 24-well plate with a transwell chamber, and cultured for 24 hours. The cells were then washed with PBS, fixed with paraformaldehyde, washed with PBS again, stained with crystal violet stain, and finally the transwell chamber was washed with PBS. The results were photographed with an inverted fluorescence microscope and the number of cells was counted under a 10x microscope for statistical analysis.

[0019] The beneficial effects of the present invention are:

[0020] The application of CHPF2 as a prognostic diagnostic reagent for glioblastoma has been demonstrated through experimental results that CHPF2 is mainly expressed in tumor tissues, CHPF2 expression increases with the increase of glioma grade, and is highest in primary glioblastoma; CHPF2 mRNA and protein levels in U251 cells and A172 cells are higher than those in normal cells; CHPF2 is mainly expressed in the cell nucleus and cytoplasm, and its expression in glioma cells is significantly increased. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 A flow chart of the present invention as a whole;

[0022] Figure 2 This is a comparison diagram of the glioblastoma paraffin section before and after HE staining of the present invention;

[0023] Figure 3 This is a comparison diagram of the glioblastoma section sample before and after immunohistochemical staining of the present invention;

[0024] Figure 4 Schematic diagram of the statistical results of ImageJ of the present invention;

[0025] Figure 5 This is a statistical result diagram of CHPF2 gene expression analysis of the present invention;

[0026] Figure 6 This is a statistical result diagram of CHPF2 mRNA levels in GBM samples of the present invention;

[0027] Figure 7 It is a schematic diagram of the changes in the protein level of CHPF2 in the GBM samples of the present invention;

[0028] Figure 8 The present invention is the statistical analysis of the changes in CHPF2 expression with glioma grade Figure 1 ;

[0029] Fig. 9 The present invention is the statistical analysis of the changes in CHPF2 expression with glioma grade Figure 2 ;

[0030] Fig.10 This is a statistical graph of CHPF2 expression in IDH wild-type patients of the present invention;

[0031] Fig.11 This is a statistical comparison of the expression of CHPF2 in autosomes 1 and 19 in cells lacking or not lacking the present invention;

[0032] Fig.12 This is a statistical graph of the CHPF2 expression quantity versus the survival time of glioblastoma patients in the present invention;

[0033] Fig.13 The statistical diagram of the results of univariate and multivariate Cox regression analysis of the present invention;

[0034] Fig.14 This is a statistical graph of the results of RT-qPCR verification of CHPF2 mRNA and protein expression in the present invention;

[0035] Fig.15 This is a statistical graph of the results of Western Blot verification of CHPF2 mRNA and protein expression in the present invention;

[0036] Fig.16 The results and statistical graphs of the siRNA interference of the present invention with CHPF2 mRNA and protein expression in A172 cells and U251 cells;

[0037] Fig.17 This is a picture showing the photographic and statistical results of A172 cells after Transwell experiment of the present invention;

[0038] Fig.18 This is a picture showing the photographic and statistical results of the U251 cells after the Transwell experiment of the present invention;

[0039] Fig.19 This is the photo and result statistics of the A172 cell scratch test of the present invention;

[0040] Fig. 20 This is a photo of the U251 cell scratch test and a statistical chart of the results. DETAILED DESCRIPTION

[0041] The technical solution of the present invention is further described in detail below in conjunction with specific implementation methods.

[0042] Embodiments of the present invention are described in detail below, examples of which are shown in the accompanying drawings, wherein the same or similar reference numerals throughout represent the same or similar elements or elements having the same or similar functions. The embodiments described below with reference to the accompanying drawings are exemplary and are only used to explain the present invention, and cannot be understood as limiting the present invention.

[0043] Application of CHPF2 in glioblastoma prognostic diagnostic reagents, such as Figures 1 to 20 As shown, the specific steps include:

[0044] Step 1: Obtaining and processing glioblastoma samples; processing the obtained glioblastoma samples to prepare glioblastoma paraffin sections for later use.

[0045] Glioblastoma samples were human tissues, and 6 samples were obtained from the First Affiliated Hospital of Chongqing Medical University. The samples were fixed with 20% formaldehyde solution overnight, dehydrated with 70%-80%-90%-100% alcohol gradient, transparentized with xylene, embedded in paraffin, sliced, and mounted into paraffin sections for later use.

[0046] Step 2: HE and immunohistochemical staining; some glioblastoma paraffin sections were dewaxed and dehydrated to obtain glioblastoma section samples, some glioblastoma section samples were stained with HE staining kit to observe the optical morphology of section cells; another part of glioblastoma section samples were subjected to immunohistochemical staining to observe positive results.

[0047] Glioblastoma paraffin sections were dewaxed at 60 degrees, hydrated with xylene, and dehydrated with 100%-90%-80%-70% gradient alcohol. One part was stained with HE staining kit, and the cell morphology of the sections was observed under an optical microscope; the other part was immunohistochemically stained with IHC immunohistochemical staining kit, and positive results were observed under an optical microscope.

[0048] The primary antibody was polyclonal rabbit anti-human (ratio 1:100) (Wuhan Tri-Eagle Biotechnology Co., Ltd., China), and the secondary antibody was goat anti-rabbit (ratio 1:5000) (White Shark Biotechnology Co., Ltd., China).

[0049] ImageJ was used to count the positive area.

[0050] Reference Figures 2 to 4 , the results are as follows:

[0051] HE results showed that the general morphology of cells was consistent with the morphological characteristics of normal brain tissue and glioblastoma tissue cells.

[0052] Immunohistochemistry results showed that the cytoplasm and nuclei of glioblastoma cells were positively expressed and appeared yellow-brown, while no positive expression was observed in the normal brain tissue around the cancer.

[0053] Step 3: Bioinformatics methods were used to analyze the expression, prognosis, and immune cell infiltration of CHPF2 and its mRNA in glioblastoma; specifically, CHPF2 gene expression analysis, CHPF2 expression analysis in glioblastoma patient tissues, CHPF2 mRNA expression in glioblastoma patient tissues and patient prognosis survival analysis, and CHPF2 mRNA expression in glioblastoma patient tissues and immune cell infiltration analysis.

[0054] (1) CHPF2 gene expression analysis

[0055] From the Tumor Immunity Estimation Resource (TIMER2.0,

[0056] The mRNA sequencing data of 33 cancers and corresponding normal tissues from the TCGA cohort were retrieved from the database http: / / timer.cistrome.org / to analyze the expression of CHPF2 mRNA in various cancer tissues and corresponding normal tissues, especially in glioblastoma.

[0057] The total RNA sequencing data of glioblastoma were obtained from The Cancer Genome Atlas (TCGA, http: / / cancergenome.nih.gov / ) and the Chinese Glioma Genome Atlas (CGGA, http: / / www.cgga.org.cn / ); the total RNA sequencing data of non-cancerous tissues were obtained from the Genotype-Tissue Expression Database (GTEx Database, https: / / gtexportal.org / ).

[0058] All data were downloaded and organized into an expression matrix, and the ggplot2R package was used to visualize the CHPF2 mRNA expression.

[0059] (2) Expression analysis of CHPF2 in glioblastoma patient tissues

[0060] After searching through the University of Alabama at Birmingham Cancer Data Analysis Portal (UALCAN, http: / / ualcan.path.uab.edu / index.html), the data were downloaded and organized into a gene expression matrix, and the protein expression of CHPF2 in glioblastoma patient tissues was analyzed using the R language wilcox statistical method.

[0061] (3) Analysis of CHPF2 mRNA expression in glioblastoma patient tissues and patient prognosis and survival

[0062] The data on CHPF2 mRNA expression and overall survival of glioblastoma patients were obtained through TCGA and CGGA databases; glioblastoma patients were divided into high and low groups according to the median expression value of CHPF2 mRNA, and the correlation between CHPF2 mRNA expression and patient prognosis was analyzed using the survivalR package of R language, and the impact of the difference in CHPF2 mRNA expression on patient prognosis and survival rate was analyzed using the log rank test.

[0063] (4) Expression of CHPF2 mRNA in glioblastoma patient tissues and analysis of immune cell infiltration

[0064] Based on the data on CHPF2 mRNA expression in glioblastoma patient tissues obtained from the TCGA database, the CIBERSORT algorithm was first used to calculate the relative proportion of tumor-infiltrating immune cells (TIIC). Then, according to the median expression value of CHPF2 mRNA, the cells were divided into a CHPF2 high expression group and a CHPF2 low expression group. The relative abundance of TIIC in the two groups was then analyzed.

[0065] The relationship between CHPF2 mRNA expression levels and immune activators and immunosuppressants in glioblastoma was evaluated using the TISIDB database (http: / / cis.hku.hk / ).

[0066] Reference Figures 5 to 7 , the experimental results are as follows:

[0067] Using the gene expression data from the TIMER2.0 database, the results showed that CHPF2 mRNA was expressed in many tumor tissues.

[0068] The glioblastoma samples in the TCGA and CGGA databases were visualized using R language, and the results showed that CHPF2 mRNA levels were also significantly upregulated in GBM samples in both databases.

[0069] Analysis of CHPF2 protein expression levels through the Clinical Proteomics Analysis Consortium (CPTAC) database showed that compared with the corresponding normal tissues, the CHPF2 protein expression in these tumor tissues {such as clear cell RCC (ccRCC), endometrial adenocarcinoma (UCEC), lung cancer (LUNG), pancreatic adenocarcinoma (PAAD), head and neck squamous cell carcinoma (HNSC)} and glioblastoma multiforme (GBM) were significantly upregulated, while the CHPF2 protein expression in colon cancer (CC) was significantly downregulated.

[0070] UCLCAN was used to visualize the CHPF2 protein levels in glioblastoma in the CPTAC database, and the results also showed that the protein level of CHPF2 was upregulated in GBM samples.

[0071] Reference Figures 8 to 13 , the experimental results are as follows:

[0072] Through CGGA database analysis, we found that CHPF2 expression increased with the increase of glioma grade, and was highest in primary glioblastoma. In IDH wild-type patients, CHPF2 expression was significantly higher than that in IDH mutant patients, and in patients with intact autosomes 1 and 19, expression was also higher than that in the deletion group.

[0073] The results of survival analysis of the TCGA database and the CGGA database showed that the survival time of glioblastoma patients with high CHPF2 expression group was significantly lower than that of patients with low CHPF2 expression group.

[0074] Univariate and multivariate Cox regression analysis revealed the relationship between the clinical characteristics of glioblastoma and the survival outcomes of patients. The results showed that patients with high expression of CHPF2 and intact arms of chromosomes 1 and 19 had a poor prognosis (p < 0.001).

[0075] Step 4: In vitro experiments were performed to observe the effect of CHPF2 on the proliferation and growth of U251 and A172 cells; specifically, cell culture, passaging, siRNA sequence design, transfection and grouping, reverse transcription real-time fluorescence quantitative PCR, immunoblotting, immunofluorescence, Transwell and scratch tests.

[0076] (1) Cell culture and subculture

[0077] Human glioma cell lines A172 and U251 and human astrocyte SVG-P12 were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). DMEM medium was added with 5% fetal bovine serum (FBS) and cultured at 37°C and 5% CO2. When the cell confluence reached about 90% under a microscope, the cells were passaged at a ratio of 1:2.

[0078] (2) siRNA sequence design, transfection and grouping

[0079] The siRNA sequences designed for CHFP2 were UAGUCAGCGUUGUAGAAGC(dT)(dT), GCUUCUACAACGCUGACUA(dT)(dT), which were designed and synthesized by technicians of Qingke Biotechnology Co., Ltd. (Beijing, China); the FT201 transfection kit (TransIntro EL Transfection Reagent, Beijing, China) was used.

[0080] During the interference test, the cells were divided into three groups, namely: control group, negative control group and interference group; the cells were digested and inoculated into 6-well plates, and when the cells grew to 70%, the reduced serum medium mixed with transfection reagent and small interfering agent was added, among which negative siRNA was added to the negative control group, and CHPF2-siRNA was added to the interference group; after culturing for 36 hours, the total RNA and protein of the cells were extracted, and the expression of CHPF2 and its mRNA was detected by RT-qPCR and WB methods to verify the interference efficiency.

[0081] (3) Reverse transcription real-time fluorescence quantitative PCR

[0082] Total RNA of U251, A172 and SVG-P12 cells was extracted according to the TRIzol reagent (Vazyme Biotech Co., Ltd, Nanjing, China) kit procedure, and reverse transcription quantitative PCR and SYBR Green real-time PCR were performed on them.

[0083] The design and synthesis of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) internal reference primer sequence and target gene primer sequence were completed by Qingke Biotechnology Co., Ltd. (Beijing, China).

[0084] The results were semi-quantitatively analyzed using the 2-ΔΔct method.

[0085] The primer sequences are as follows:

[0086] GAPDH-F("GGAGTCCACTGGCGTCTTCA"),

[0087] GAPDH-R("GTCATGAGTCCTTCCACGATACC").

[0088] CHPF2-F("AGCGGGCTTACAGTGAAATAGAA"),

[0089] CHPF2-R("AAAGCGAGAGTGTGGTGTGAAAG").

[0090] (4) Immunoblotting

[0091] The cells of each group were collected in T25 flasks, and radioimmunoprecipitation buffer (RIPA, PMSF ratio was 100:1) containing phenylmethylsulfonyl fluoride (PMSF) was added.

[0092] Use a disposable cell scraper to gently collect the cells and transfer the lysate to a 1.5 mL EP tube; then mix sodium dodecyl sulfate (SDS)-protein loading buffer with the lysate in a ratio of 1:4 and denature at 95°C for 5 minutes.

[0093] 10ul of protein loading solution was added to each well and SDS-PAGE electrophoresis was performed at 80V for 30mins and 120V for 60mins.

[0094] After cutting the gel near the corresponding molecular weight shown by the marker, put it in an ice box and transfer it to the PVDF membrane by electroporation at the parameters of 250 mA, 90 mins, and seal the PVDF membrane with a rapid sealing solution (Beyotime) at room temperature for 20 minutes.

[0095] The membrane was immersed in Tris-buffered saline Tween solution once, and then the PVDF membrane was incubated on ice overnight, and the primary antibody (CHPF2 dilution ratio, 1:2000; Abcam, UK; β-actin, 1:2000) was added at 4°C overnight.

[0096] The PVDF membrane was then incubated with secondary antibody (secondary antibody dilution ratio 1:10000; Proteintech, Rosemont, IL, USA) at 37°C for 2 h, the bands were detected with chemiluminescent colorimetric solution, and color imaging was performed using Image Lab software.

[0097] The ratio of the gray value of the target band to the gray value of the internal reference protein band was used as the source of statistical data; this experiment was repeated three times.

[0098] (5) Immunofluorescence

[0099] First, the cells were inoculated into a T25 culture flask. When the cells were fully grown, the digested cells were prepared. The sterile round glass slides were placed into a six-well plate. The digested cells were inoculated into the six-well plate. After the cells grew well, they were washed three times with PBS. The cells were treated with 4% paraformaldehyde for 20 minutes, washed three times with PBS, treated with TritonX-100 for 5 minutes, and washed three times with PBS after treatment.

[0100] The primary antibody (CHPF2 dilution ratio, 1:200; Abcam, UK) was added and incubated at 4°C overnight; then, the sections were washed three times with immunodetergent for 10 min each time, and then anti-rabbit fluorescent secondary antibody (dilution ratio 1:500) was added and incubated at room temperature for 1 h.

[0101] The slides were washed three times with PBS, and then stained with DAPI for 3 min and washed three times with PBS. The slides were sealed with neutral resin and photographed using an upright fluorescence microscope (Leica, Wetzlar, Germany).

[0102] The unit fluorescence intensity value (the ratio of the field of view area to the fluorescence positive area under a 10x microscope) was used as the source of statistical data; this experiment was repeated three times.

[0103] (6) Transwell

[0104] Cells were transfected using a 6-well plate and digested after 24 h of culture. 8,000 cells were seeded into a 24-well plate with a transwell chamber. Matrigel was applied three hours before seeding. After 24 h of culture, the 24-well plate was removed and washed three times with PBS.

[0105] The cells were fixed with 4% paraformaldehyde for 20 minutes, washed three times with PBS, and stained with crystal violet stain (Beyotime, Shanghai, China) for 3 to 5 minutes.

[0106] The transwell chamber was washed three times with PBS, and the results were photographed using an inverted fluorescence microscope (Leica, Wetzlar, Germany) and the number of cells was counted under a 10x microscope for statistical analysis.

[0107] (7) Scratch test.

[0108] Reference Figures 14 to 20 , the experimental results are as follows:

[0109] RT-qPCR and Western Blot verified the expression of CHPF2 mRNA and protein in U251, A172 and normal astrocytes SVGP12. The results showed that the CHPF2 mRNA and protein levels in U251 and A172 were higher than those in normal cells. Immunofluorescence results further showed that CHPF2 was mainly expressed in the nucleus and cytoplasm, and its expression in glioma cells was significantly increased.

[0110] The results of RT-qPCR and Western Blot experiments also showed that after siRNA interfered with the expression of CHPF2 mRNA and its protein in U251 and A172 cells, the levels of CHPF2 mRNA and its protein in both cells were reduced, which could meet the requirements of subsequent experiments.

[0111] The results of the scratch test showed that after CHPF2 expression was interfered, the scratch area of ​​U251 and A172 cells at 24h and 48h was larger than that of the negative control group, indicating that the migration speed of the two cell types was significantly reduced, indicating that the inhibition of CHPF2 reduced the migration ability of cells.

[0112] The results of Transwell experiments showed that the migration and invasion abilities of U251 and A172 cells were significantly weakened after the expression of CHPF2 was reduced.

[0113] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. The use of CHPF2 as a prognostic diagnostic reagent for glioblastoma, characterized in that: The specific steps include: Step 1: Obtaining and processing glioblastoma samples; processing the obtained glioblastoma samples to prepare glioblastoma paraffin sections for later use; Step 2: HE and immunohistochemical staining; dewax and dehydrate some glioblastoma paraffin sections to obtain glioblastoma section samples, stain some glioblastoma section samples with HE staining kit to observe the optical morphology of section cells; perform immunohistochemical staining on another part of glioblastoma section samples to observe positive results; Step 3: Bioinformatics methods were used to analyze the expression, prognosis, and immune cell infiltration of CHPF2 and its mRNA in glioblastoma; specifically, CHPF2 gene expression analysis, CHPF2 expression analysis in glioblastoma patient tissues, CHPF2 mRNA expression in glioblastoma patient tissues and patient prognosis survival analysis, and CHPF2 mRNA expression in glioblastoma patient tissues and immune cell infiltration analysis; Step 4: In vitro experiments were performed to observe the effect of CHPF2 on the proliferation and growth of U251 and A172 cells; specifically, cell culture, passaging, siRNA sequence design, transfection and grouping, reverse transcription real-time fluorescence quantitative PCR, immunoblotting, immunofluorescence, Transwell and scratch tests.

2. The use of CHPF2 as a prognostic diagnostic reagent for glioblastoma according to claim 1, characterized in that: The specific method of the CHPF2 gene expression analysis is as follows: the mRNA sequencing data of 33 cancers and corresponding normal tissues from the TCGA cohort are retrieved from the Tumor Immune Estimation Resource Database, the expression of CHPF2 mRNA in various cancer tissues and corresponding normal tissues is analyzed, the relevant data are organized into an expression matrix, and the CHPF2 mRNA expression is visualized and analyzed using the ggplot2R package.

3. The use of CHPF2 as a prognostic diagnostic reagent for glioblastoma according to claim 1, characterized in that: The specific method for analyzing the expression of CHPF2 in glioblastoma patient tissues is as follows: after searching through UALCAN, the data is downloaded and organized into a gene expression matrix, and the R language wilcox statistical method is used to analyze the protein expression of CHPF2 in glioblastoma patient tissues.

4. The use of CHPF2 as a prognostic diagnostic reagent for glioblastoma according to claim 1, characterized in that: The specific method for analyzing the expression of CHPF2 mRNA in glioblastoma patient tissues and patient prognosis and survival is as follows: the data on CHPF2 mRNA expression and overall survival of glioblastoma patients are obtained through the TCGA and CGGA databases, the correlation between CHPF2 mRNA expression and patient prognosis is analyzed using the survivalR package of R language, and the effect of the difference in CHPF2 mRNA expression on patient prognosis and survival rate is analyzed using the log rank test.

5. The use of CHPF2 as a prognostic diagnostic reagent for glioblastoma according to claim 1, characterized in that: The specific method for analyzing the expression of CHPF2 mRNA in glioblastoma patient tissues and immune cell infiltration is as follows: the data on the expression of CHPF2 mRNA in glioblastoma patient tissues were obtained from the TCGA database, and the relationship between the CHPF2 mRNA expression level and the immune activators and immunosuppressants in glioblastoma was evaluated through the TISIDB database.

6. The use of CHPF2 as a prognostic diagnostic reagent for glioblastoma according to claim 1, characterized in that: The cells in the cell culture and passage are human brain glioma cell lines A172 and U251, and human astrocyte SVG-P12; the siRNA sequences designed for CHFP2 in the siRNA sequence design, transfection and grouping are UAGUCAGCGUUGUAGAAGC(dT)(dT), GCUUCUACAACGCUGACUA(dT)(dT).

7. The use of CHPF2 as a prognostic diagnostic reagent for glioblastoma according to claim 1, characterized in that: The reverse transcription real-time fluorescence quantitative PCR uses the TRIzol reagent kit procedure to extract total RNA from three types of cells: U251, A172 and SVG-P12, and performs reverse transcription quantitative PCR and SYBR Green real-time PCR on them.

8. The use of CHPF2 as a prognostic diagnostic reagent for glioblastoma according to claim 1, characterized in that: In the Transwell, a 6-well plate was used to transfect cells, and the cells were digested after culturing for 24 hours. 8,000 cells were inoculated into a 24-well plate with a transwell chamber, cultured for 24 hours, and then washed with PBS, fixed with paraformaldehyde, washed again with PBS, stained with crystal violet stain, and finally washed with PBS in the transwell chamber. The results were photographed using an inverted fluorescence microscope and the number of cells was counted under a 10x microscope for statistical analysis.

Images