Compound, endoplasmic reticulum stress inhibitor, drug, ophthalmic drug, eye drops, composition, and method for preparing compound

Abstract

The present invention provides a novel compound having self-assembly activity. A compound represented by chemical formula (I), a tautomer or a stereoisomer thereof, or a salt of the compound or the tautomer or the stereoisomer. In the chemical formula (I), R1 is a hydrogen atom or a substituent represented by-SO2-R11, R11 is a hydrogen atom or any substituent, R2 and R3 are each a hydrogen atom, a halogen atom, a nitro group, a linear or branched alkyl group, a linear or branched alkoxy group, or a cyano group, one or more hydrogen atoms in the alkyl group or alkoxy group may be further substituted by a substituent or not substituted, or one or more hydrogen atoms in the alkyl group or alkoxy group may be substituted by a substituent. R2 and R3 may be integrated to form a cyclic structure together with the benzene ring to which they are bonded, each X is a hydrogen atom or an arbitrary substituent, each X may be the same or different, and Z is a hydrogen atom or an arbitrary substituent.

Description

Technical Field

[0001] The present disclosure relates to a compound, an endoplasmic reticulum stress inhibitor, a medicine, an ophthalmic medicine, an eye drop, a composition, and a method for preparing the compound. Background Art

[0002] The phenomenon caused by abnormal protein accumulation (denatured protein) in the endoplasmic reticulum is called endoplasmic reticulum stress, and it is reported that it is involved in neurodegenerative diseases such as Alzheimer's disease, metabolic diseases, and geriatric diseases such as ophthalmological diseases. As agents that inhibit endoplasmic reticulum stress, chemical partners such as PBA (4-phenylbutyric acid) and TUDCA (tauroursodeoxycholic acid) are known (Non-Patent Document 1). In addition, regarding these two substances, their usefulness in cell and animal models is also suggested (Non-Patent Document 2).

[0003] Prior art literature

[0004] Patent Literature

[0005] Non-patent document 1: Oezcan, U. et al. Chemical Chaperones Reduce ER Stress and Restore Glucose Homeostasis in a Mouse Model of Type 2 Diabetes. Science 313, 1137-1140 (2006).

[0006] Non-patent document 2: Cortez, L. & Sim, V. The therapeutic potential of chemical chaperones in protein folding diseases. Prion 8, 197-202 (2014). Summary of the invention

[0007] 1. Technical issues to be resolved

[0008] However, existing chemical chaperones have not actually been used clinically. The problem with existing chemical chaperones is that their activity is limited to inhibiting the denaturation of normal proteins and cannot remove denatured proteins. If a new type of compound with self-assembly activity can be provided, a new technology can be provided that targets denatured proteins that are also prone to self-assembly.

[0009] In this regard, the purpose of the present disclosure is to provide a novel compound having self-assembly activity, an endoplasmic reticulum stress inhibitor, a drug, an ophthalmic drug, an eye drop, a composition, and a method for preparing the compound.

[0010] (II) Technical solution

[0011] In order to achieve the above-mentioned object, the compound disclosed in the present invention is a compound represented by the following chemical formula (I), a tautomer or stereoisomer thereof, or a salt thereof.

[0012] [Chemical Formula I]

[0013]

[0014] In the chemical formula (I),

[0015] R 1 A hydrogen atom or -SO2-R 11 The substituent represented by R 11 is a hydrogen atom or any substituent,

[0016] R 2 and R 3 are respectively a hydrogen atom, a halogen atom, a nitro group, a straight-chain or branched-chain alkyl group, a straight-chain or branched-chain alkoxy group, or a cyano group, wherein one or more hydrogen atoms of the alkyl group or alkoxy group may be further substituted with a substituent or not, or, R 2 and R 3 optionally integrated to form a ring structure together with the benzene ring to which they are bonded,

[0017] X is a hydrogen atom or any substituent, each X can be the same or different,

[0018] Z is a hydrogen atom or an arbitrary substituent.

[0019] The endoplasmic reticulum stress inhibitor disclosed in the present invention is characterized by containing the above-disclosed compound, its tautomer or stereoisomer, or a salt thereof.

[0020] The drug disclosed in the present invention is characterized by containing the above-disclosed compound, its tautomer or stereoisomer, or a salt thereof.

[0021] The ophthalmic drug disclosed in the present invention is characterized by containing the above-disclosed compound, its tautomer or stereoisomer, or a salt thereof.

[0022] The eye drops disclosed in the present invention are characterized by containing the above-disclosed compound, its tautomer or stereoisomer, or a salt thereof.

[0023] The preparation method of the compound disclosed in the present invention is a preparation method of the above-disclosed compound, its tautomer or stereoisomer, or a salt thereof, which comprises the following steps:

[0024] a hydrolysis step of hydrolyzing the compound represented by the following chemical formula (II), its tautomer or stereoisomer, or a salt thereof; and

[0025] A cyclization step of cyclizing the product of the hydrolysis step.

[0026] [Chemical Formula II]

[0027]

[0028] In the chemical formula (II),

[0029] R 1 , R 2 , R 3 , X and Z and R in the chemical formula (I) 1 , R 2 , R 3 , X and Z are the same,

[0030] Hal is a halogen atom.

[0031] (III) Beneficial effects

[0032] According to the present disclosure, a novel compound having self-assembly activity, an endoplasmic reticulum stress inhibitor, a drug, an ophthalmic drug, an eye drop, a composition, and a method for preparing the compound can be provided. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 A graph showing the biological activity of compound 1 for reducing cytotoxicity under ER stress, the graph showing the relief of cell death under ER stress achieved by PBA and compound 1, wherein HEK293 cells were pre-cultured with PBA (2.0 mM) or compound 1 (100 μM) for 12 hours, then treated with 10 μM thapsigargin (Tg) or 5.0 μg / mL tunicamycin (Tm) for 48 hours, and the cell viability of DMSO, PBA and compound 1 was compared; the vertical axis of the graph represents the cell viability.

[0034] Figure 2The figure shows the results obtained after measuring the changes in mRNA levels of ER stress-related genes caused by tunicamycin treatment by qPCR, wherein the mRNA expression level of genes related to ER stress induced by compound 1 or compound 6 was measured by quantitative PCR; HEK293 cells were treated with compound 1 (100 μM) for 10 hours and then cultured with 1.0 μg / mL tunicamycin (Tm) for 24 hours; the separated RNA samples were subjected to reverse transcription and quantitative RT-PCR; the bars in the bar graph respectively show, from the left: the measurement results in the presence of tunicamycin (without compounds 1 and 6), the measurement results in the absence of tunicamycin (without compounds 1 and 6, only DMSO), the measurement results in the coexistence of tunicamycin and compound 1, and the measurement results in the coexistence of tunicamycin and compound 6.

[0035] Figure 3 is a diagram showing the self-assembly of compound 1 in living HEK293 cells, wherein Figure 3 (A) is the fluorescence image of HEK293 cells treated with compound 1 (100 μM) and DCVJ (1.0 μM); Figure 3 (B) shows the quantification of compound 1 (100 μM) in cells stained with DCVJ (1.0 μM) by flow cytometry in the presence (+) or absence (-) of endocytosis inhibitors (100 μM chloroquine, 20 μM chlorpromazine and 100 μM genistein); the vertical axis of the graph represents the average value of fluorescein isothiocyanate (FITC) in arbitrary units (au).

[0036] Figure 4 This is a graph showing the changes in cell viability under ER stress brought about by compound 1 and its derivatives compounds 4 to 6, wherein the vertical axis of the graph represents the cell viability (unit: %), and the horizontal axis of the graph represents, from the left, the measurement results of compound 1, compound 4, compound 5, compound 6, PBA, and DMSO, respectively.

[0037] Figure 5 Fluorescence images of the self-assembly of compound 1 and its derivatives in living cells.

[0038] Figure 6 It is a graph showing the dose-response curve of tunicamycin detection using compound 1, compound 6 and PBA.

[0039] Figure 7Figure 2 is a diagram showing the co-assembly formation between self-assembling chemical substances (Compound 1 and Compound 6) and fluorescently labeled BSA (BSA-flu).

[0040] Figure 8 A graph showing the results of luciferase-based refolding assays in living HEK293 cells, wherein the vertical axis of the graph represents the relative activity of luciferase (unit: %), and the horizontal axis of the graph represents, from the left, the measurement results for DMSO alone, the measurement results for compound 1, the measurement results for compound 6, and the measurement results for PBA alone; the bars in the bar graph are differentiated by different colors according to the time of refolding in living cells, which, from the left, represent the refolding results in living cells at 0 hour (0h), the refolding results in living cells at 2 hours (2h), and the refolding results in living cells at 4 hours (4h).

[0041] Fig. 9 This is a graph showing the results of tunicamycin detection using an autophagy inhibitor and a proteasome inhibitor, wherein: Fig. 9 (A) is a graph showing the measured values ​​in the presence or absence of bafilomycin A1 (BafA1, autophagy inhibitor); Fig. 9 (B) is a graph showing the measured values ​​in the presence or absence of MG132 (proteasome inhibitor).

[0042] Fig.10 This is a graph showing the results of tunicamycin testing using autophagy-deficient cells, wherein the vertical axis of the graph represents the cell survival rate.

[0043] Fig.11 The photographs are showing the results of CBB staining of electrophoresis during native polyacrylamide gel electrophoresis (8% acrylamide gel), specifically, the figures are of native PAGE analysis of heat-induced denaturation of BSA in the presence of compound 1, compound 6 and PBA, wherein BSA (2.0 mg / mL) was incubated at 25°C or 75°C for 1 hour in the presence (marked as +) of 1 (100 μM), 6 (100 μM) or PBA (10 mM) or in the absence of these substances.

[0044] Fig.12The graph is a graph showing the data of tunicamycin (Tm) detection of compounds XD8 to XD13 and XD7 (compound 6), wherein the vertical axis of the graph represents the cell viability (unit: %); in the two graphs on the left, the horizontal axes respectively show, from the left: the measurement results of compound XD8, compound XD9, compound XD10, compound XD7 (compound 6), PBA, and DMSO; in the two graphs on the right, the horizontal axes respectively show, from the left: the measurement results of compound XD11, compound XD12, compound XD13, compound XD7 (compound 6), PBA, and DMSO.

[0045] Fig.13 The graphs show the data of tunicamycin detection of compounds XD14 to XD18 and X441A (Compound 1), wherein the vertical axis of the graph represents the relative cell viability (unit: %); in the two graphs on the left, the horizontal axes respectively show, from the left: the measurement results of compound XD15, compound XD16, compound XD17, X441A (Compound 1), PBA, and DMSO; in the two graphs on the right, the horizontal axes respectively show, from the left: the measurement results of compound XD7 (Compound 6), compound XD14, compound XD18, X441A (Compound 1), PBA, and DMSO.

[0046] Fig.14 The graph is a graph showing the data of tunicamycin detection of compounds XD19 to XD22 and XD7 (compound 6), wherein the vertical axis of the graph represents the relative cell viability (unit: %); in the two graphs on the left, the horizontal axes respectively represent, from the left, the measurement results of compound XD19, compound XD20, compound XD7 (compound 6), PBA, and DMSO; in the two graphs on the right, the horizontal axes respectively represent, from the left, the measurement results of compound XD21, compound XD22, compound XD7 (compound 6), PBA, and DMSO.

[0047] Fig.15 The graph is a graph showing the data of tunicamycin detection of compounds XD23 to XD28 and XD7 (compound 6), wherein the vertical axis of the graph represents the relative cell viability (unit: %); in the two graphs on the left, the horizontal axes respectively represent, from the left, the measurement results of compound XD23, compound XD24, compound XD25, compound XD7 (compound 6), PBA, and DMSO; in the two graphs on the right, the horizontal axes respectively represent, from the left, the measurement results of compound XD26, compound XD27, compound XD28, compound XD7 (compound 6), PBA, and DMSO.

[0048] Fig.16Phase contrast microscopic photographs of immortalized human corneal endothelial cells (iFECD) from a patient with Fuchs' corneal endothelial dystrophy that were pretreated with compound 1 (X441A), an endoplasmic reticulum stress inhibitor, and stimulated with TGF-β2 for 30 hours of iFECD (the upper panel shows control and TGF-β2 from the left, and the lower panel shows TGF-β2+X441A (compound 1, 1 μM), TGF-β2+X441A (compound 1, 10 μM), and TGF-β2+X441A (compound 1, 100 μM) from the left); Compound 1, an endoplasmic reticulum stress inhibitor, inhibits cell damage caused by TGF-β signaling in the corneal endothelial damage model of Fuchs' corneal endothelial dystrophy.

[0049] Fig.17 Shown are phase contrast microscopic photographs of immortalized human corneal endothelial cells from a patient with Fuchs' corneal endothelial dystrophy, which were pretreated with compound 6 (XD7), an endoplasmic reticulum stress inhibitor, and stimulated with TGF-β2 for 30 hours (the upper panel shows, from the left, control, TGF-β2, and TGF-β2+XD7 (compound 6, 10 nM); the lower panel shows, from the left, TGF-β2+XD7 (compound 6, 100 nM), TGF-β2+XD7 (compound 6, 1 μM), and TGF-β2+SB431542 (10 μM)); compound 6, an endoplasmic reticulum stress inhibitor, inhibits cell damage caused by TGF-β signaling in the corneal endothelial damage model of Fuchs' corneal endothelial dystrophy.

[0050] Fig.18 From the top, the results of protein immunoblotting of fibronectin, total caspase 3, cleaved caspase 3, PARP and GAPDH are shown respectively, among which, from the left lane, the results of iFECD, iFECD+TGF-β2, iFECD+TGF-β2+X441A (Compound 1, 1 μM), iFECD+TGF-β2+X441A (Compound 1, 10 μM), and iFECD+TGF-β2+X441A (Compound 1, 100 μM) are shown.

[0051] Fig.19From the top, the results of protein immunoblotting of fibronectin, total caspase 3, cleaved caspase 3, PARP and GAPDH are shown respectively, among which, from the left lane, the results of iFECD, iFECD+TGF-β2, iFECD+TGF-β2+XD7 (Compound 6, 10nM), iFECD+TGF-β2+XD7 (Compound 6, 100nM), iFECD+TGF-β2+XD7 (Compound 6, 1μM), and iFECD+TGF-β2+SB431542 (10μM) are shown.

[0052] Fig. 20 The figure shows the results of the primary screening based on turbidity for 29 compounds, wherein in the upper graph, the vertical axis represents the change in turbidity and the horizontal axis represents the index; PBA and TUDCA were used at high concentrations as positive controls; the table below summarizes the changes in turbidity and the compounds of each index.

[0053] Fig.21 A graph showing the results of tunicamycin detection using HEK293 cells for the second screening, wherein the results of three experiments using the top 16 compounds (50 μM) are shown; the vertical axis of the graph represents cell survival rate (unit: %); the error bar is sd (n=3).

[0054] Fig. 22 For compound 1 1 H- 1 H NOESYNMR spectrum, with arrows indicating important NOE crossover signals. 1 H is correct.

[0055] Fig.23 The graphs represent the dynamic light scattering of the molecules of compound 1 in PBS (pH 7.4) and DMEM (10% FBS), wherein, in the graph on the left, the Z-average (nm) of the vertical axis represents the average size of the particles; in the graph on the right, the Derived count rate (kcps) of the vertical axis represents the derived count rate; the horizontal axes represent the molar concentrations (μM) of PBS (pH 7.4) and DMEM (10% FBS), respectively; the error bars are sd (n=3).

[0056] Fig.24Graph showing quantification of self-organization of compound 1 in cell culture medium, wherein (A) compound 1 (10-100 μM) was dissolved in 100 μL of DMEM (10% FBS, 1% DMSO) containing 1.0 μM DCVJ as an environmentally sensitive pigment; fluorescence (e.g., 365 nm, em: 530 nm) was measured using a microplate reader to quantify the relative amount of self-organized 1; the dotted line represents the theoretical fluorescence signal expected when compound 1 is fully organized at each concentration; (B) is a normalized dose composition curve of compound 1 in DMEM; the ratio of assembly / total molecules 1 at each concentration was estimated by normalizing the observed fluorescence signal using the theoretical signal of (A); for the saturation level of the dose-assembly curve, it was assumed that 100% was assembled; by fitting using a sigmoid curve, the apparent maximum assembly concentration (AC50) of compound 1 was 29.7 μM; error bars are represented by sd; (n=4).

[0057] Fig.25 Graph showing the reversibility of self-assembly of compound 1, wherein compound 1 (100 μM) was cultured in DMEM (10% FBS, 0.5% DMSO) at 25°C for 1 hour to form self-assembly; solutions of preformed assemblies of compound 1 were diluted at various ratios using DMEM (10% FBS, 0.5% DMSO); in order to quantify the amount of self-assembly of compound 1 based on fluorescence, all samples contained 1.0 μM DCVJ, an environmentally sensitive pigment; when self-assembly is irreversible (the upper graph in the box), the fluorescence signal is linear with respect to the amount of compound; as a control, reversible self-assembly (the lower graph in the box) is at low temperature due to the decomposition of preformed particles. The concentration shows fluorescence below the linear level; in the two graphs in the frame, the vertical axis represents fluorescence and the horizontal axis represents concentration; the graph on the left side outside the frame shows the results 18 hours after dilution, the vertical axis represents relative fluorescence (unit: %), and the horizontal axis represents concentration (unit: μM); the graph on the right side outside the frame shows the results of real-time tracking of samples diluted to 25 μM, the vertical axis represents relative fluorescence (unit: %), and the horizontal axis represents elapsed time (unit: h); for the self-assembly of compound 1, if diluted to 25 μM (as a monomer of 1), a significant decrease in fluorescence is shown, indicating that the assembly process is reversible; at 25 μM (as a monomer of 1), a decrease in fluorescence over time was also observed; error bars are represented by sd; (n=3).

[0058] Fig.26A graph showing the results of tunicamycin assay using Compound 1, Compound 2, Compound 3, PBA, and DMSO, wherein HEK293 cells were treated with Compound 1, Compound 2, or Compound 3 for 16 hours and then treated with tunicamycin (0 μg / mL or 5 μg / mL) for 48 hours; Fig.26 A in the figure is a graph showing the results after treatment with tunicamycin 5 μg / mL, which shows the changes in cell survival rate caused by compound 1 and its derivatives compounds 2 to 6 under ER stress; Fig.26 B in FIG. 1 is a graph showing the results after treatment with 0 μg / mL tunicamycin (ie, no tunicamycin); Fig.26 A and Fig.26 In B, the vertical axis represents relative cell viability (unit: %), and the horizontal axis represents concentration (unit: μM); the cell viability was measured using a WST-8 cell counting kit (Dojindo); the error bar is sd (n=3).

[0059] Fig. 27 A graph showing the results of cell viability assay using Compound 1, Compound 4, Compound 5, Compound 6, PBA, and DMSO, wherein HEK293 cells were treated with Compound 1, Compound 4, Compound 5, or Compound 6 (25 μM or 100 μM, respectively) for 64 hours; the vertical axis represents relative cell viability (unit: %), and the horizontal axis represents concentration (unit: μM); the cell viability was determined using a WST-8 cell counting kit; the error bar is sd (n=3).

[0060] Fig.28 Graph showing dynamic light scattering of compound 4, compound 5 and compound 6 in DMEM (10% FBS), wherein Z-average represents the average size of particles; error bars are sd (n=3).

[0061] Fig.29 The graph is a diagram showing the normalized dose-assembly curves of compound 4, compound 5 and compound 6 in cell culture medium, wherein various concentrations of the compounds were dissolved in 100 μL of DMEM (10% FBS, 1% DMSO) containing 1.0 μM DCVJ; fluorescence was measured using an ELISA reader (e.g., 365 nm, em: 530 nm) to quantify the relative amount of self-assembled molecules; the ratio of assembled / total molecules at each concentration was calculated according to Fig.23method; for the saturation level of the dose-assembly curve, it was assumed that 100% was assembled; in the fitting using the S-shaped curve, the apparent maximum assembly concentration (AC50) of 25.1 μM, 16.9 μM or 9.30 μM was obtained for the molecules of compound 4, compound 5 and compound 6, respectively; the error bars are represented by sd (n=4).

[0062] Fig.30 To show Figure 7 Separated fluorescence images and bright field images of the photograph, wherein the co-assembly formation between the self-assembling chemical substances (compounds 1 and 6) and the fluorescently labeled BSA (BSA-flu) is shown. The 2 columns on the left represent the results of compound 1, and the 2 columns on the right represent the results of compound 6; the undenatured is the undenatured BSA-flu, and the denatured is the denatured BSA-flu.

[0063] Fig.31 A graph showing the results of cell viability detection using bafilomycin A1, wherein HEK293 cells were treated with bafilomycin A1 in DMEM (10% FBS) for 48 hours; the vertical axis represents the relative cell viability (unit: %), and the horizontal axis represents the concentration of bafilomycin A1 (unit: μM); the cell viability was determined using a WST-8 cell counting kit; the error bar is sd (n=3).

[0064] Fig.32 A graph showing the results of cell viability detection using MG132, wherein HEK293 cells were treated with MG132 in DMEM (10% FBS) for 48 hours; the vertical axis represents the relative cell viability (unit: %), and the horizontal axis represents the concentration of MG132 (unit: μM); the cell viability was determined using a WST-8 cell counting kit; the error bar is sd (n=3).

[0065] Fig.33 The graphs show dynamic light scattering of the molecules of compounds XD8 to XD28 in PBS (pH 7.4) and DMEM (10% FBS), which show the self-assembly activity of compounds XD8 to XD28, wherein the Z-average shows the average size of the particles; the error bar is sd (n=3).

[0066] Fig.34 The graphs show dynamic light scattering of the molecules of compounds XD8 to XD28 in PBS (pH 7.4) and DMEM (10% FBS), which show the self-assembly activity of compounds XD8 to XD28, wherein Derived count rate (kcps) represents the derived count rate; the error bar is sd (n=3).

[0067] Fig.35 This is a graph showing the results of measuring the change in axial length in order to examine the effect of X441A eye drops on inhibiting the progression of myopia, wherein -30 diopter (refractive index unit, D) lenses (-30D) were worn on the right eye of 3-week-old C57BL6J male mice, and only the frame (NL) was worn on the left eye as a control eye; the period of wearing the lenses was set to 3 weeks, during which X441A was dripped into the eyes once a day (X441A eye drops group), and PBS was dripped into the eyes of the control group (PBS eye drops group); the amount of change in axial length of the X441A eye drops group and the PBS eye drops group before and after the 3-week period of wearing the lenses and eye drops was compared; the vertical axis of the graph represents the change in axial length (unit: mm), and p represents the realization value of the probability.

[0068] Fig.36 This is a graph showing the results of measuring the change in refractive index in order to examine the effect of X441A eye drops on inhibiting the progression of myopia, wherein a -30 diopter (refractive index unit: D) ​​lens (-30D) was worn on the right eye of 3-week-old C57BL6J male mice, and only the frame (NL) was worn on the left eye as a control eye; the period of wearing the lens was set to 3 weeks, during which X441A was dripped into the eye once a day (X441A eye drops group), and PBS was dripped into the eye of the control group (PBS eye drops group); the change in refractive index of the X441A eye drops group and the PBS eye drops group before and after the 3-week period of wearing the lens and eye drops was compared; the vertical axis of the graph represents the change in refractive index (unit: D), and p represents the realization value of the probability.

[0069] Fig.37 A graph showing the results of Western blotting analysis of the expression levels of p62, Atg5, and Atg12 in the X441A eye drop group and the PBS administration group after 3 weeks of myopia induction and eye drops. In the figure, a -30 diopter (refractive index unit: D) ​​lens (-30D) was worn on the right eye of 3-week-old C57BL6J male mice, and only the frame (NL) was worn on the left eye as a control eye. The left 4 columns "Veh" show the results of the group to which PBS was dripped into the eye during the 3-week period, and the right 4 columns "X441A" show the results of the group to which X441A was dripped into the eye during the 3-week period. DETAILED DESCRIPTION

[0070] Hereinafter, the present disclosure will be described in further detail with reference to examples, but the following description is merely an example, and the present disclosure is not limited to the following description.

[0071] In the present disclosure, when there are isomers such as tautomers or stereoisomers (for example, geometric isomers, coordination isomers and optical isomers) in a compound (for example, a compound represented by the general formula (I), a compound represented by the general formula (II), etc.), any isomer can be used in the present disclosure unless otherwise specified. In addition, when a compound can form a salt, the salt can also be used in the present disclosure unless otherwise specified. The salt can be an acid addition salt or a base addition salt. Furthermore, the acid forming the acid addition salt can be an inorganic acid or an organic acid, and the base forming the base addition salt can be an inorganic base or an organic base. The inorganic acid is not particularly limited, and examples thereof include sulfuric acid, phosphoric acid, hydrofluoric acid, hydrochloric acid, hydrobromic acid, hydroiodic acid, hypofluoric acid, hypochlorous acid, hypobromous acid, hypoiodous acid, fluorite acid, chlorous acid, bromic acid, iodous acid, fluoric acid, chloric acid, bromic acid, iodic acid, perfluoric acid, perchloric acid, perbromic acid, and periodic acid. The organic acid is also not particularly limited, and examples thereof include p-toluenesulfonic acid, methanesulfonic acid, oxalic acid, p-bromobenzenesulfonic acid, carbonic acid, succinic acid, citric acid, benzoic acid, and acetic acid. The inorganic base is not particularly limited, and examples thereof include ammonium hydroxide, alkali metal hydroxides, alkaline earth metal hydroxides, carbonates, and bicarbonates. More specifically, examples thereof include sodium hydroxide, potassium hydroxide, potassium carbonate, sodium carbonate, sodium bicarbonate, potassium bicarbonate, calcium hydroxide, and calcium carbonate. The organic base is not particularly limited, and examples thereof include ethanolamine, triethylamine, and tris(hydroxymethyl)aminomethane. The preparation method of these salts is also not particularly limited, and for example, they can be prepared by appropriately adding the above-mentioned acid or base to the compound using a known method.

[0072] In addition, in the present disclosure, unless otherwise specified, a chain substituent (for example, an alkyl group, an unsaturated aliphatic hydrocarbon group, or other hydrocarbon group) may be linear or branched, and the number of carbon atoms thereof is not particularly limited, and may be, for example, 1 to 40, 1 to 32, 1 to 24, 1 to 18, 1 to 12, 1 to 6, or 1 to 2 (or more than 2 in the case of an unsaturated hydrocarbon group). In addition, in the present disclosure, the number of ring members (the number of atoms constituting the ring) of a cyclic group (for example, an aryl group, a heteroaryl group, etc.) is not particularly limited, and may be, for example, 5 to 32, 5 to 24, 6 to 18, 6 to 12, or 6 to 10. In addition, when isomers exist in a substituent, etc., any isomer may be used unless otherwise specified, and for example, in the case of a simple "naphthyl group", it may be 1-naphthyl or 2-naphthyl.

[0073] In the compounds disclosed herein, X in the chemical formula (I) can be, for example, a hydrogen atom, a non-aromatic hydrocarbon group (which can be a straight chain or a branched chain, which can be saturated or unsaturated, and which can contain a cyclic structure or not), an aromatic group (for example, an aromatic group (aryl group) containing no heteroatoms, or a heteroaromatic group (heteroaryl group) containing heteroatoms, which can be a monocyclic ring or a condensed ring), a halogen atom, an amino group, a nitro group, a sulfonyl group or a cyano group, and at least one hydrogen atom in each substituent can be further substituted by any other substituent or can be unsubstituted.

[0074] In the compounds disclosed herein, Z in the chemical formula (I) may be, for example, a hydrogen atom, a non-aromatic hydrocarbon group (which may be a straight chain or a branched chain, which may be saturated or unsaturated, and which may or may not contain a cyclic structure), an aromatic group (for example, an aromatic group (aryl) containing no heteroatoms, or a heteroaromatic group (heteroaryl) containing heteroatoms, and which may be a monocyclic ring or a condensed ring), a halogen atom, an amino group, a nitro group, a sulfonyl group or a cyano group, and at least one hydrogen atom in each substituent may be further substituted by any other substituent or may not be substituted.

[0075] The inventors of the present application have developed a self-assembling compound that can directly target denatured proteins, and found that at least a portion of the compound can reduce the toxicity and endoplasmic reticulum stress on cells caused by denatured proteins.

[0076] The compounds disclosed herein may not have endoplasmic reticulum stress inhibitory activity, but preferably have endoplasmic reticulum stress inhibitory activity. By making the compounds disclosed herein have endoplasmic reticulum stress inhibitory activity, they can be used as, for example, endoplasmic reticulum stress inhibitors or active ingredients of endoplasmic reticulum stress inhibitors. According to the present disclosure, for example, an endoplasmic reticulum stress inhibitor having higher activity than existing drugs can also be provided.

[0077] The compounds disclosed herein can be, for example, self-assembling compounds that co-assemble with denatured proteins to inhibit endoplasmic reticulum stress. Denatured proteins are important drug targets related to geriatric diseases such as neurodegenerative diseases, metabolic diseases, and ophthalmic diseases, but existing drugs cannot target them. In the present disclosure, a series of bioactive small molecule groups that use denatured proteins as direct targets have been successfully developed by utilizing self-assembling compounds that are not usually considered as candidate compounds for drug development. Denatured proteins that have been co-assembled with the compounds disclosed herein, for example, have the possibility of being decomposed or removed by the autophagic pathway of cells. The compounds disclosed herein can be effectively used as research tools for studying endoplasmic reticulum stress and lead compounds for drug development of diseases caused by protein toxicity. In addition, for example, as shown in the examples described below, according to experiments using cells from patients with Fuchs corneal endothelial dystrophy, cell death caused by endoplasmic reticulum stress can be inhibited by the compounds disclosed herein.

[0078] Among the compounds disclosed herein, compounds having particularly strong effects of inhibiting endoplasmic reticulum stress include, for example, compound 1 and compound 6 described below, but are not limited to these two compounds. As the uses of the compounds disclosed herein, for example, drugs for treating or preventing symptoms, damage or diseases of the eye, or uses as active ingredients of the drugs can be listed. However, the uses of the compounds disclosed herein are not limited thereto and can be used for any purpose.

[0079] Light from the cornea, the transparent tissue at the front of the eyeball, reaches the retina and excites the retinal nerve cells. The generated electrical signals are transmitted to the visual cortex of the brain via the optic nerve, thereby recognizing visual information. In order to obtain good vision, the cornea needs to be transparent. The transparency of the cornea is maintained by maintaining the water content at a certain level by utilizing the pump function and barrier function of the corneal endothelial cells.

[0080] Human corneal endothelial cells exist at a density of about 3,000 per 1 square millimeter at birth, and their ability to regenerate once damaged is extremely limited. Fuchs' corneal endothelial dystrophy is a disease in which the endothelial cells on the inner side of the cornea become abnormal, causing corneal edema, and the cause is unknown. In Fuchs' corneal endothelial dystrophy, extracellular matrix such as collagen is deposited on a part behind Desmedt's membrane located at the back of the cornea, resulting in thickening of the guttate cornea and Desmedt's membrane. Thickening of the guttate cornea and Desmedt's membrane causes photophobia and blurred vision in patients with Fuchs' corneal endothelial dystrophy, significantly impairing the patient's QOL (quality of life). There is no effective treatment for Fuchs' corneal endothelial dystrophy other than corneal transplantation. However, the supply of corneas in Japan is insufficient, and there are approximately 2,600 patients waiting for corneal transplantation, while the number of corneal transplants performed in Japan is approximately 1,700 per year.

[0081] Fuchs corneal endothelial dystrophy is a disease in which corneal stromal edema occurs due to excessive production of extracellular matrix and death of corneal endothelial cells. Currently, there is no clinically available treatment drug, and corneal transplantation is necessary.

[0082] The inventors of the present application have found that by inhibiting endoplasmic reticulum stress, cell death (apoptosis) of the eye, especially corneal endothelial cells, can be inhibited. In addition, the inventors of the present application have found that the compounds disclosed herein can be used for the treatment or prevention of ophthalmic diseases such as corneal endothelial damage caused by transforming growth factor-β (TGF-β) (especially corneal endothelial damage caused by Fuchs corneal endothelial dystrophy). In addition, the inventors of the present application have also found that by inhibiting endoplasmic reticulum stress, the overexpression of extracellular matrices such as fibronectin can be inhibited. Thus, the inventors of the present application have found that, for example, the compounds disclosed herein with endoplasmic reticulum stress inhibitory activity can also be applied to the improvement, treatment or prevention of corneal endothelial damage caused by overexpression of extracellular matrix (for example, drop-shaped cornea, hypertrophy of the posterior elastic layer, corneal opacity, leukoplakia and other turbid symptoms, etc.). Since cell death and extracellular matrix are independent phenomena, it is preferred to be able to inhibit both.

[0083] One or more features of the present disclosure may be provided in a manner that is further combined on the basis of the combinations indicated, for example. As long as the following detailed description is read and understood as needed, those skilled in the art will be able to recognize further embodiments and advantages of the present disclosure.

[0084] According to the present disclosure, a novel drug that can treat or prevent symptoms, damage, or diseases of the corneal endothelium caused by, for example, transforming growth factor-β (TGF-β) signals can be provided.

[0085] Myopia is a state of refractive error that needs to be corrected by glasses or contact lenses in order to focus on the retina because the focus is in front of the retina. For the human eyeball, as the eyeball grows larger after birth, the cornea becomes flatter and the lens thickness becomes thinner, which reduces the refractive power. On the other hand, the axial length is 20mm at the age of 1, 22mm at the age of 6, and grows to about 24mm in adults. Refraction tries to maintain emmetropia. The balance of the emmetropia is destroyed, and the axial length grows further, usually developing into axial myopia in school children around 9 to 15 years old. Myopia is basically caused by axial myopia. In addition, there is also refractive myopia that develops in the middle and elderly age stage due to metabolic abnormalities such as diabetes or changes in the lens caused by aging. It is known that if myopia develops excessively, it will put a burden on the retina or optic nerve, increase the risk of various ophthalmic diseases such as retinal detachment, glaucoma, macular degeneration, and the resulting visual impairment.

[0086] According to the present disclosure, a novel drug capable of treating or preventing symptoms, damage or diseases such as myopia can be provided.

[0087] In the present disclosure, technical terms, scientific and technical terms, etc., unless otherwise defined, have the same meaning as those generally understood by those skilled in the art to which the present disclosure belongs. If the meaning of a term is defined, the meaning of the term shall follow the definition.

[0088] (definition)

[0089] In the present disclosure, the word “about” before a numerical value is not particularly limited, and may mean, for example, ±10% of the subsequent numerical value.

[0090] In the present disclosure, "endoplasmic reticulum stress inhibitor" refers to any agent that co-assembles with denatured proteins to directly hinder activity (toxicity).

[0091] (definition)

[0092] In the present disclosure, "iFECD" (immobilized Fuchs' endothelial corneal dystrophy) is the abbreviation for immortalized cells of Fuchs' endothelial corneal dystrophy.

[0093] In the present disclosure, "HCEC" (human corneal endothelial cells) refers to human corneal endothelial cells. "iHCEC" is the abbreviation for immortalized human corneal endothelial cells.

[0094] In the present disclosure, "transforming growth factor-β (TGF-β; also referred to as TGF-β)" refers to: a homodimeric multifunctional cytokine with a molecular weight of 25 kD that is used in the same sense as the TGF-β used in the field, is responsible for the pathogenesis of various sclerotic diseases, rheumatoid arthritis, and proliferative vitreoretinopathy, is largely involved in hair loss, inhibits the behavior of immune-active cells, and on the other hand, inhibits the excessive production of proteases to prevent the decomposition of lung tissue and thus emphysema, and inhibits the growth of cancer cells, etc., and exhibits rich biological activities. For humans, there are three subtypes of TGF-β1 to β3. TGF-β is produced as an inactive latent type with a molecular weight of about 300 kD that cannot bind to receptors. It is activated on the surface of target cells or around them to become an active type that can bind to receptors, thereby exerting its effects.

[0095] The action of TGF-β in target cells is transmitted through the phosphorylation pathway of a series of proteins such as Smad, which is responsible for transmitting information. However, this theory does not limit the present disclosure in any way. According to this theory, first, if the active TGF-β binds to the type II TGF-β receptor present on the surface of the target cell, a receptor complex consisting of 2 molecules of type II receptor and 2 molecules of type I TGF-β receptor will be formed, and the type II receptor will phosphorylate the type I receptor. Then, if the phosphorylated type I receptor phosphorylates Smad2 or Smad3, the phosphorylated Smad2 and Smad3 form a complex with Smad4, thereby migrating to the cell nucleus and binding to the target sequence called CAGAbox present in the promoter region of the target gene, and inducing the transcriptional expression of the target gene together with the coactivator.

[0096] The transforming growth factor-β (TGF-β) signaling pathway, through the regulation of its target genes, can regulate a variety of cellular activities such as cell growth and differentiation, growth arrest, apoptosis, and epithelial-mesenchymal transition (EMT). Members of the TGF-β superfamily, including TGF-β itself (e.g., TGF-β1, TGF-β2, and TGF-β3), activins, and bone morphogenetic proteins (BMPs), are powerful regulators of cell growth, differentiation, migration, and apoptosis.

[0097] TGF-β is a protein of about 24Kd produced by a variety of cells including B lymphocytes, T lymphocytes and activated macrophages, as well as a variety of other cell types. The effects of TGF-β on the immune system include IL-2 receptor induction, inhibition of IL-1-induced thymocyte proliferation, and blocking of IFN-γ-induced macrophage activation. TGF-β is believed to be involved in various pathological conditions (Border et al. (1992) J. Clin. Invest. 90: 1), and its function as either a tumor suppressor or a cancer promoter has been fully verified.

[0098] TGF-β mediates its signal transduction through two serine / threonine kinase cell surface receptors, TGF-βRII and ALK5. TGF-β signal transduction begins with ligand-induced receptor dimerization, which makes it possible for TGF-βRII to phosphorylate the ALK5 receptor. Regarding this phosphorylation, the ALK5 kinase activity is activated, and the activated ALK5 then phosphorylates the downstream effector Smad protein (the vertebrate homolog of MAD, or "Mothers against DPP (Decapentaplegic)" protein), Smad2 or 3. The p-Smad2 / 3 complex with Smad4 enters the cell nucleus to activate the transcription of the target gene.

[0099] Smad3 is a member of the R-Smad (receptor-activated Smad) subgroup of Smads and is a direct mediator of TGF-β receptor-based transcriptional activation. TGF-β stimulation leads to phosphorylation and activation of Smad2 and Smad3, which form complexes with Smad4 (the "common Smad" or "co-Smad" of vertebrates) and accumulate in the nucleus, thereby regulating the transcription of target genes. R-Smads are localized in the cytoplasm and form complexes with co-Smads through ligand-induced phosphorylation based on the TGF-β receptor, and then migrate to the nucleus, where they regulate gene expression associated with chromatin and co-transcription factors. Smad6 and Smad7 are inhibitory Smads ("I-Smads"), that is, they are transcriptionally induced by TGF-β and function as inhibitors of TGF-β signaling (Feng et al. (2005) Annu. Rev. Cell. Dev. Biol. 21: 659). Smad6 / 7 exert their inhibitory effects by impeding receptor-mediated activation of R-Smads; these are associated with type I receptors that competitively impede mobilization and phosphorylation of R-Smads. Smad6 and Smad7 are known to recruit E3 ubiquitin ligases that bring about ubiquitination and degradation of Smad6 / 7 interacting proteins.

[0100] In addition, the TGF-β signaling pathway also has a pathway that is mediated by BMP-7, etc., which functions via ALK-1 / 2 / 3 / 6 and Smad1 / 5 / 8. For the TGF-β signaling pathway, please refer to: J. Massagu'e, Annu. Rev. Biochem. 1998. 67: 753-91; Vilar JMG, Jansen R, Sander C (2006) PLoS Comput Biol 2 (1): e3; Leask, A., Abraham, DJ FASEB J. 18, 816-827 (2004); Coert Margadant & Arnoud Sonnenberg EMBO reports (2010) 11, 97-105; Joel Rosenbloom et al., Ann Intern Med. 2010; 152: 159-166, etc.

[0101] The "symptoms, damage or diseases of the corneal endothelium caused by transforming growth factor-β (TGF-β)" in the present disclosure refers to any symptoms, damage or disease of the corneal endothelium induced by TGF-β in corneal endothelial cells. When corneal endothelial cells, for example, model cells of Fuchs' corneal endothelial dystrophy (e.g., iFECD) are exposed to TGF-β2, surprisingly, various damages are sometimes produced, for example as shown in the examples described below. This phenomenon has not been explained in the past. In addition, after further analyzing the symptoms, damage or diseases of the corneal endothelium caused by TGF-β signals, the inventors of the present application unexpectedly found that the damage can be inhibited by the compounds of the present disclosure (e.g., Compound 1 and Compound 6 shown in the examples described below) as endoplasmic reticulum stress inhibitors. Regarding symptoms, damage or diseases of the corneal endothelium caused by TGF-β signals, unlike the mTOR signaling pathway, symptoms, damage or diseases of the corneal endothelium caused by TGF-β signals include, for example, Fuchs corneal endothelial dystrophy, damage after corneal transplantation, corneal endotheliitis, trauma, damage after ophthalmic surgery, damage after ophthalmic laser surgery, aging, posterior polymorphous corneal dystrophy (PPD: posterior polymorphous dystrophy), congenital hereditary corneal endothelial dystrophy (CHED: congenital hereditary endothelial dystrophy), primary corneal endothelial damage and cytomegalovirus corneal endotheliitis, etc., symptoms, damage or diseases in which TGF-β expression is observed, but are not limited to these. It is believed that the damage discovered in the present disclosure or damage related thereto will be expressed or enhanced, especially in corneal endothelial cells or corneal endothelial tissues where the expression of TGF-β2 is more enhanced than usual. Therefore, any symptoms, damage or disease of the corneal endothelium observed in such corneal endothelial cells or corneal endothelial tissues are particularly eligible as the subject of the present disclosure.

[0102] "Extracellular matrix (ECM) overexpression in corneal endothelial cells" in the present disclosure refers to the expression of extracellular matrix at an abnormal level compared to the expression level of extracellular matrix in normal corneal endothelial cells. "Extracellular matrix expression at an abnormal level" means that extracellular matrix proteins such as fibronectin are produced in an amount greater than the amount produced in the extracellular matrix under normal morphology. In addition to the case of no stimulation, the production condition also includes the case where the expression amount is increased as required by responding to transforming growth factor (TGF) β. For example, for human corneal endothelial cells, it can be about 1.1 times or more, about 1.2 times or more, about 1.3 times or more, about 1.4 times or more, about 1.5 times or more, about 1.6 times or more, about 1.7 times or more, about 1.8 times or more, about 1.9 times or more, about 2.0 times or more of the amount of extracellular matrix under normal circumstances. It is preferred that the difference from normal is statistically significant, but it does not necessarily have to be statistically significant, and it can be a medically significant difference.

[0103] In the present disclosure, "corneal endothelial damage caused by excessive expression of extracellular matrix (ECM)" or its "symptoms" refer to damage or its symptoms mainly related to dirt, deposition, hypertrophy, etc. caused by extracellular matrix, which are related to symptoms such as warts (guttae) on the corneal endothelial surface or turbidity of Desmedius's membrane, hypertrophy of Desmedius's membrane, etc., which lead to decreased vision. For corneal endothelial damage such as Fuchs' corneal dystrophy, unlike the worsening of symptoms caused by cell death (especially apoptosis) of corneal endothelial cells, the excessive production of the extracellular matrix will still cause vision and visual deterioration even if it does not cause a decrease in the number of cells, and even if cell death can be suppressed, measures must be taken. For "corneal endothelial damage caused by excessive production of extracellular matrix (ECM)" or its "symptoms", the following turbidity, scars, corneal clouding, corneal leukoma, etc. can be listed, but are not limited to these.

[0104] In a preferred embodiment, the symptom, injury or disease that is the object of the present disclosure is an injury associated with Fuchs' corneal endothelial dystrophy. With respect to Fuchs' corneal endothelial dystrophy, TGF-β induction in corneal endothelial cells has been shown to be associated therewith, and cell loss in FECD has been shown to be also associated therewith. Therefore, it is reasonable to expect that obstruction of the TGF-β signaling pathway can effectively treat FECD. However, the inventors of the present application unexpectedly discovered that the compounds of the present disclosure having endoplasmic reticulum stress inhibitory activity (e.g., Compound 1 and Compound 6 shown in the Examples described later) can inhibit damage caused by TGF-β signals.

[0105] The drug disclosed in the present invention can be used for the treatment or prevention of Fuchs' corneal endothelial dystrophy because it can treat cell damage induced by TGF-β2, which is an important cause of abnormality or damage in Fuchs' corneal endothelial dystrophy. In particular, in the present disclosure, as shown in the embodiments described below, for example, cell damage or programmed cell death induced by TGF-β2 can be inhibited for the Fuchs' corneal endothelial dystrophy model. Therefore, it is believed that the present disclosure can be used for the treatment of patients with severe diseases related to TGF-β2 in, for example, the Fuchs' corneal endothelial dystrophy model. In addition, unexpectedly, the drug disclosed in the present invention can inhibit, for example, the overexpression of the extracellular matrix (ECM), and can treat or prevent damage to the corneal endothelium such as ECM deposition on the posterior Descemet's membrane. Therefore, the present invention can treat or prevent damage to corneal endothelial cells, low corneal endothelial density, guttate cornea formation, thickening of Desmedt's membrane, thickening of corneal thickness, corneal epithelial damage, opacity, scarring, corneal stromal opacity, photophobia, blurred vision, visual impairment, eye pain, tears, congestion, pain, bullous keratopathy, eye discomfort, decreased contrast, halos, glare and edema of corneal stroma, such as Fuchs' corneal endothelial dystrophy.

[0106] The "symptoms, damages or diseases of myopia" in the present disclosure refer to symptoms, damages or diseases related to myopia, such as refractive error, axial length increase, choroidal thinning, and decreased choroidal blood flow.

[0107] In a preferred embodiment, the symptom, injury or disease that is the object of the present disclosure is an injury associated with myopia. For myopic scleral fibroblasts, it is shown that endoplasmic reticulum stress occurs, and this is involved in the development of myopia (reference 47). The inventors of the present application have found that the compounds of the present disclosure (e.g., compound 1 shown in the examples described later) with endoplasmic reticulum stress inhibitory activity reduce the expression of p62, which acts as a receptor for protein degradation. Further, the inventors of the present application have found that the compounds of the present disclosure (e.g., compound 1 shown in the examples described later) with endoplasmic reticulum stress inhibitory activity can inhibit the development of myopia and have the possibility of promoting the flow of autophagy in the sclera.

[0108] The ER stress response is mainly controlled by the activity of three pathways: the PERK pathway, the IRE1a pathway, and the ATF-6 pathway. The activation of these pathways is controlled by the ER molecular chaperone protein BiP, which binds to abnormally folded proteins to repair them. Due to the accumulation of abnormally folded proteins, BiP detaches from PERK or ATF-6 and activates them. For active PERK, Thr980 is phosphorylated, and then Ser51 of eIF2a is phosphorylated. As a result, the translation of almost all mRNAs is inhibited, and the expression of ATF-4, an important transcription factor in this pathway, is induced by changes in translation. In addition, by detaching BiP due to ER stress, ATF-6 migrates to the Golgi apparatus and is activated by proteases. IRE1a is directly activated by the accumulation of abnormally folded proteins based on BiP. Activated IREa induces alternative splicing of XBP1 mRNA. XBP1 (XBP-1s) that undergoes alternative splicing functions as a transcription factor and induces the expression of stress response genes. Through these pathways, transcription of stress response genes such as CHOP and GADD34 is induced. These genes function in a coordinated manner to control cellular responses such as cell death and autophagy.

[0109] If macroautophagy is induced, then the autophagosome of double membrane vesicles will be formed while a part of cytoplasm is surrounded, and it merges with lysosome to become autophagolysosome, and the cytoplasm surrounded thereby is decomposed. In the object of decomposition based on autophagy, not only cytoplasmic molecules such as protein or RNA are included, but also organelles such as nucleus, endoplasmic reticulum, mitochondria, peroxisome, fat droplets are included. Therefore, due to autophagy, lipids constituting organelles can flow into lysosome / vacuole in large quantities. In addition, autophagy is the general term for the decomposition pathway of the intracellular components in lysosome / vacuole.

[0110] (General Technology)

[0111] The molecular biological techniques, biochemical techniques, and microbiological techniques used in the present disclosure may be, for example, conventional techniques known in the relevant field. Examples of the method include those described in the following documents: Sambrook J. et al. (1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor and its third edition (3rd Ed.) (2001); Ausubel, FM (1987). Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Ausubel, FM (1989). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Innis, MA (1990). PCR Protocols: A Guide to Methods and Applications, Academic Press; Ausubel, FM (1992). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience. Pub.Associates; Ausubel, FM (1995). ShortProtocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub.Associates; Innis, MA et al. (1995). PCR Strategies, Academic Press; Ausubel, FM (1999).ShortProtocols in Molecular Biology:A Compendium ofMethods from Current Protocols in Molecular Biology,Wiley,and annual updates;Sninsky,JJet al.(1999).PCRApplications:Protocols for Functional Genomics,Academic Press;Gait,MJ(1985).Oligonucleotide Synthesis:A PracticalApproach, IRL Press; Gait, MJ (1990). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein, F. (1991). Oligonucleotides and Analogues: APractical Approach, IRL Press; Adams, R Letal. (1992). Acids,Chapman&Hall;Shabarova,Z.etal.(1994).Advanced Organic Chemistry of Nucleic Acids, Weinheim; Blackburn, GMetal. (1996). Nucleic Acids in Chemistry and Biology, Oxford University Press; Hermanson, GT (1996). Bioconjugate Techniques, Academic Press; Special volume of experimental medicine "Gene transfer & expression analysis experimental method" Yangtusha, 1997, etc. For corneal endothelial cells, the report of Nancy Joyce et al. {Joyce, 2004#161} {Joyce, 2003#7} is well known, but as mentioned above, the study of effective culture methods for producing fibroblast-like transformation through long-term culture and subculture is also underway. The relevant parts (which may be all) in this specification are cited as references. .

[0112] (Description of preferred embodiment)

[0113] The following describes a preferred embodiment, but the embodiment is only an example of the present disclosure, and it should be understood that the scope of the present disclosure is not limited to the preferred embodiment. It should be understood that those skilled in the art can also refer to the following preferred embodiments and easily make changes, modifications, etc. within the scope of the present disclosure.

[0114] <Medication>

[0115] In one aspect, the present disclosure provides a composition for preventing or treating symptoms, damage or diseases of the eye, comprising a compound of the present disclosure having endoplasmic reticulum stress inhibitory activity (e.g., compound 1 or compound 6 shown in the Examples described below). In particular, the compound of the present disclosure having endoplasmic reticulum stress inhibitory activity is effective for symptoms, damage or diseases of the corneal endothelium.

[0116] In one embodiment, the symptom, damage or disease of the corneal endothelium caused by transforming growth factor-β (TGF-β) in corneal endothelial cells is selected from the group consisting of Fuchs corneal endothelial dystrophy, damage after corneal transplantation, corneal endotheliitis, trauma, damage after ophthalmic surgery, damage after ophthalmic laser surgery, aging, posterior polymorphous corneal dystrophy (PPD: posterior polymorphous dystrophy), congenital hereditary corneal endothelial dystrophy (CHED: congenital hereditary endothelial dystrophy), primary corneal endothelial damage and cytomegalovirus corneal endotheliitis.

[0117] In a more preferred embodiment, the present disclosure provides a drug or method of treatment or prevention for treating or preventing the symptoms of Fuchs corneal endothelial dystrophy caused by excessive expression of extracellular matrix. As the above symptoms, warts (droplet degeneration) on the corneal endothelial surface, turbid droplet cornea of ​​Desmedes' membrane, hypertrophy of Desmedes' membrane, blurred vision, halos, glare, decreased vision, corneal turbidity, white spots and visual abnormalities can be listed. The symptoms caused by excessive production of extracellular matrix are further described as follows.

[0118] On the other hand, the present disclosure provides a drug for treating or preventing symptoms, damage or diseases of the corneal endothelium caused by overexpression of extracellular matrix in corneal endothelial cells, which contains a compound of the present disclosure having endoplasmic reticulum stress inhibitory activity (e.g., compound 1 or compound 6 shown in the examples described later). As described above, the compound of the present disclosure having endoplasmic reticulum stress inhibitory activity (e.g., compound 1 or compound 6 shown in the examples described later) can treat or prevent corneal endothelial damage caused by TGF-β signals, but surprisingly, compound 1 and compound 6 can further inhibit overexpression of extracellular matrix in corneal endothelial cells. This suggests that the compound of the present disclosure having endoplasmic reticulum stress inhibitory activity (e.g., compound 1 or compound 6 shown in the examples described later) can simultaneously treat corneal endothelial damage caused by overexpression of TGF-β signals and extracellular matrix in corneal endothelial cells. In particular, Fuchs' corneal endothelial dystrophy is a disease in which the density of corneal endothelial cells is significantly reduced due to TGF-β signals, which in turn causes extracellular matrix to be deposited on Desmedin's membrane and causes corneal guttate and hypertrophy of Desmedin's membrane. Therefore, inhibiting the overexpression of extracellular matrix means that significant improvement can be achieved in the treatment and prevention of Fuchs' corneal endothelial dystrophy, and sometimes even complete cure can be achieved. In addition, it is also possible to improve, treat or prevent corneal guttate and hypertrophy of Desmedin's membrane that may occur due to excessive production of extracellular matrix in corneal endothelial damage such as Fuchs' corneal endothelial dystrophy, as well as other symptoms related to turbidity or deposition (irreversible corneal stroma turbidity due to prolonged corneal edema, etc.).

[0119] In one embodiment, the condition, damage or disease of the corneal endothelium caused by overexpression of extracellular matrix in corneal endothelial cells may be caused by overexpression of fibronectin in corneal endothelial cells.

[0120] In one embodiment, the symptom, injury or disease of the corneal endothelium caused by overexpression of extracellular matrix in corneal endothelial cells is selected from the group consisting of Fuchs corneal endothelial dystrophy, formation of guttate cornea, hypertrophy of Desmedes' membrane, hypertrophy of corneal thickness, opacity, scarring, corneal stromal opacity, corneal epithelial edema, corneal epithelial damage, corneal clouding, corneal leukoma, photophobia and blurred vision.

[0121] On the other hand, the present disclosure provides a drug for treating or preventing symptoms, damage or diseases of corneal endothelium caused by overexpression of TGF-β signal and extracellular matrix in corneal endothelial cells, which contains a compound of the present disclosure having endoplasmic reticulum stress inhibitory activity (e.g., compound 1 or compound 6 shown in the examples described below). The compound of the present disclosure having endoplasmic reticulum stress inhibitory activity (e.g., compound 1 or compound 6 shown in the examples described below) can simultaneously treat or prevent corneal endothelial damage caused by overexpression of TGF-β signal and extracellular matrix in corneal endothelial cells.

[0122] In one embodiment, the symptoms, damage or disease of the corneal endothelium caused by overexpression of TGF-β signaling and extracellular matrix in corneal endothelial cells is selected from the group consisting of Fuchs corneal endothelial dystrophy, other corneal endothelial dystrophy, and corneal endothelial damage caused by drugs, surgery, trauma, infectious diseases, uveitis, etc.

[0123] In one embodiment, symptoms, damage or diseases of the corneal endothelium caused by overexpression of TGF-β signals and extracellular matrix in corneal endothelial cells include Fuchs corneal endothelial dystrophy. Fuchs corneal endothelial dystrophy is a disease in which the density of corneal endothelial cells is significantly reduced due to TGF-β signals, which causes extracellular matrix to be deposited in Desmeds' membrane and causes damage such as corneal guttae and hypertrophy of Desmeds' membrane. Therefore, inhibiting overexpression of extracellular matrix means that Fuchs corneal endothelial dystrophy can be significantly improved, and sometimes even completely cured. The improvement of damage such as corneal guttae and hypertrophy of Desmeds' membrane in diseases such as Fuchs corneal endothelial dystrophy brought about by Compound 1 and Compound 6 as endoplasmic reticulum stress inhibitors can bring about qualitative improvement for ophthalmic diseases, and can provide unprecedented therapeutic effects for diseases such as Fuchs corneal endothelial dystrophy that can only wait and die.

[0124] In one embodiment, the means of use of the present disclosure may be eye drops, but the invention is not limited thereto and may include injection into the anterior chamber of the eye, infiltration into a sustained-release agent, subconjunctival injection, systemic administration (oral administration, intravenous injection), and the like.

[0125] In the medicine of the present disclosure, the compounds of the present disclosure (for example, compound 1 or compound 6 shown in the examples described later) can be used alone or in combination. In addition, the compounds of the present disclosure can be, for example, compounds of the present disclosure having endoplasmic reticulum stress inhibitory activity (as endoplasmic reticulum stress inhibitors), but are not limited thereto.

[0126] The concentration of the compound of the present disclosure (eg, Compound 1) used in the present disclosure may be, for example, at least about 1 μM (nmol / L), but is not limited thereto.

[0127] As the upper limit of the concentration of the compound of the present disclosure used in the present disclosure (for example, the compound of the present disclosure as an endoplasmic reticulum stress inhibitor), about 100 μM (μmol / L) can be cited, but it is not limited thereto. As the concentration range of the compound of the present disclosure (for example, compound 1) used in the present disclosure, for example, about 1 μM to about 100 μM, about 10 μM to about 100 μM, about 1 μM to about 10 μM, about 1 μM to about 10 μM can be cited, but it is not limited thereto.

[0128] The concentration of the compound of the present disclosure (eg, Compound 6) used in the present disclosure may be, for example, at least about 10 nM (nmol / L), but is not limited thereto.

[0129] As the upper limit of the concentration of the compound of the present disclosure used in the present disclosure (for example, the compound of the present disclosure as an endoplasmic reticulum stress inhibitor), about 1 μM (μmol / L) can be cited, but it is not limited thereto. As the concentration range of the compound of the present disclosure (for example, compound 6) used in the present disclosure, for example, about 10 nM to about 1 μM, about 100 nM to about 1 μM, about 10 nM to about 100 nM can be cited, but it is not limited thereto.

[0130] In the present disclosure, for example, when two or more compounds of the present disclosure (for example, compounds of the present disclosure that are endoplasmic reticulum stress inhibitors) are used in combination, the concentrations of the various compounds of the present disclosure can be appropriately changed.

[0131] When the compounds of the present disclosure are used in eye drops, the concentration of the preparation can be determined based on about 1 to 10,000 times, preferably about 100 to 10,000 times, for example about 1,000 times the above-mentioned effective concentration, taking into account dilution caused by tears, etc., while paying attention to toxicity, and can also be set to a concentration exceeding these concentrations.

[0132] The concentration of the compound (e.g., Compound 1) used in the present disclosure may be, for example, about 1 mM to about 100 mM, about 10 mM to about 100 mM, or about 1 mM to about 10 mM, but is not limited thereto. These upper and lower limits may be appropriately combined and set, and may be appropriately changed when two or more compounds are used in combination.

[0133] The concentration of the compound (e.g., compound 6) used in the present disclosure may be, for example, about 10 μM to about 1 mM, about 100 μM to about 1 mM, or about 10 μM to about 100 μM, but is not limited thereto. These upper and lower limits may be set in combination as appropriate, and may be appropriately changed when two or more compounds are used in combination.

[0134] In one embodiment, the drug for treatment or prevention of the present disclosure can be used for any animal having corneal endothelium, such as mammals, and is preferably used for the treatment or prevention of corneal endothelium in primates. Preferably, the subject of treatment or prevention is human corneal endothelium.

[0135] <Preservation and growth of corneal endothelial cells>

[0136] On the other hand, the present disclosure provides a composition for preserving corneal endothelial cells comprising a compound of the present disclosure having endoplasmic reticulum stress inhibitory activity (e.g., Compound 1 or Compound 6). The present disclosure also provides a method for preserving corneal endothelial cells, comprising: a step of contacting a compound of the present disclosure having endoplasmic reticulum stress inhibitory activity (e.g., Compound 1 or Compound 6) with corneal endothelial cells in an effective amount. It can be understood that the embodiments of the endoplasmic reticulum stress inhibitor used in the preservation of corneal endothelial cells can utilize any of the embodiments described in the <Drug> of the present disclosure. The contact with the corneal endothelial cells can be in vivo, ex vivo, or in vitro, and can also be used for the preparation of cell preparations.

[0137] On the other hand, the present disclosure provides a composition for growing corneal endothelial cells containing a compound of the present disclosure (e.g., Compound 1 or Compound 6) having endoplasmic reticulum stress inhibitory activity, or promoting the growth thereof. The present disclosure also provides a method for growing corneal endothelial cells, or promoting the growth thereof, comprising: a step of contacting corneal endothelial cells with an endoplasmic reticulum stress inhibitor in an effective amount. It can be understood that the embodiments of the endoplasmic reticulum stress inhibitor used in the growth or promotion of growth of corneal endothelial cells can utilize any of the embodiments described in the <Drug> of the present disclosure. The contact with corneal endothelial cells can be in vivo, in vitro, or in vitro, and can also be used in the preparation of cell preparations.

[0138] References such as scientific literature, patents, and patent applications cited in the present disclosure are incorporated herein by reference in their entirety to the same extent as their specific descriptions.

[0139] For ease of understanding, the preferred embodiments are shown above to illustrate the present invention. Below, the present disclosure is described based on examples, but the purpose of the above description and the following examples is only to illustrate and is not intended to limit the present invention. Therefore, the scope of the present disclosure is not limited to the embodiments and examples specifically described in this specification.

[0140] Example

[0141] Hereinafter, examples of the present disclosure will be described, but the present disclosure is not limited to these examples.

[0142] The handling of applicable biological samples, etc., complied with the standards set by the Ministry of Health, Labor and Welfare, the Ministry of Education, Culture, Sports, Science and Technology, etc., and, where applicable, was carried out based on the Declaration of Helsinki or ethical regulations based on the Declaration. The donation of eyes for research was approved by the relatives of all deceased donors. This study was approved by the Ethics Committee of the University of Erlangen (Germany), SightLifeTM (Seattle, WA) Eye Bank, or their corresponding institutions.

[0143] [Reagents, instruments and methods]

[0144] Chemical reagents were the highest grade available provided by Tokyo Chemical Industry Co., Ltd., Fujifilm Wako, NACALAITESQUE, INC., or Sigma-Aldrich and were used without further purification. Phosphate buffered saline (PBS), Dulbecco's modified Eagle medium (DMEM) / high glucose medium, and trypsin-EDTA were purchased from Gibco or Sigma. Penicillin / streptomycin (PS) was purchased from NACALAI TESQUE, INC. Protein concentration was quantified using a BCA protein assay kit (Pierce). NMR spectra were obtained using a JEOL 600MHz JNM-ECP spectrometer. High-resolution mass spectra were obtained using a JEOLMStation JMS-700.

[0145] [Cell culture]

[0146] HEK293 cells and mouse embryonic fibroblasts were cultured in DMEM supplemented with 10% FBS and 1% PS at 37°C in a humidified atmosphere containing 5% CO2.

[0147] [Measurement method]

[0148] In the following examples, each measurement method was carried out as follows.

[0149] Heat-based turbidity change assay for cell lysates:

[0150] Self-assembling chemical substances (comprising about 140 compounds of the present disclosure: final concentration 50 μM) were added to 100 μL of whole-cell HEK293 lysate (1.0 mg / mL protein, 1% DMSO final concentration) in a 96-well plate. The mixture was heated at 60°C for 17 hours while being rotated and shaken at 300 rpm using an MBR-022UP incubator (TAITEC). Turbidity at 492 nm was measured using an MTP-880 microplate reader (Corona Electric).

[0151] Tunicamycin test:

[0152] HEK293 cells were seeded in 96-well plates (1×10 4 Cells / well) were added and cultured at 37°C for 2 hours. Then, the culture medium was replaced with 100 μL of DMEM (10% FBS) containing self-assembling chemical substances (including more than 20 compounds of the present disclosure) and 1% DMSO. After culturing for 12 to 18 hours with any of the compounds 1 to 6 at a specified concentration, HEK293 cells were treated with tunicamycin (5 μg / mL) or thapsigargin (10 μM) for 48 hours, and the cell viability was determined using a WST-8 cell counting kit (DOJINDO LABORATORIES.).

[0153] Flow cytometry:

[0154] HEK293 cells were cultured at 3 × 10 5 Cells / well were seeded in 12-well plates. After culturing at 37°C for 2 hours, the cells were treated with 1 (100 μM) and 9-(2,2-dicyanovinyl)julolidine (DCVJ, 1.0 μM) in DMEM (10% FBS) in the presence or absence of chloroquine (100 μM), chlorpromazine (20 μM) and genistein (100 μM) at 37°C for 16 hours. The cells were collected by culturing in 2 mM EDTA / PBS (pH 7.4) for 10 minutes. The fluorescence of the cells was measured by BD FACSAria (trade name) II and analyzed by BD FACSDiva software.

[0155] Fluorescence imaging in living cells using compound 1 and its derivatives:

[0156] HEK293 cells were cultured in the presence of 1.0 μM DCVJ in DMEM (10% FBS) with compounds 1, 4, 5, or 6 (25 or 100 μM). Fluorescence and bright field images were captured using a CV1000 confocal microscope with a 40x objective (Yokogawa Electric Corporation).

[0157] Imaging of the co-assembly of compound 1, compound 6 and BSA fluorescein:

[0158] Denatured BSA-flu was prepared by incubating a solution of BSA-flu (1.1 mg / mL) in PBS (pH 7.4) at 80°C for 1 hour. Native or denatured BSA-fluorescein (final 0.1 mg / mL) was added to a solution of compound 1 (100 μM) or compound 6 (25 μM) in PBS (pH 7.4) containing 2.0 mg / mL of BSA. After the mixture was incubated at 25°C for 19 hours, images were taken using a CV1000 confocal microscope. The fluorescence intensity of the co-assembly was quantified based on images obtained using ImageJ software.

[0159] Luciferase-based refolding assay in living cells:

[0160] HEK293 cells were seeded in 96-well plates (2 × 10 4 Cells / well) were transfected with luciferase expression plasmid (0.1 μg / well) using FuGENE HD (Promega). After 24 hours of incubation, the cells were treated with compound 1 (100 μM), compound 6 (25 μM) or PBA (2.0 mM) for 20 hours. The refolding assay was carried out according to the method described in the literature Walther, TV; Maddalo, D. Intracellular Refolding Assay. J Vis Exp 2012, No. 59. https: / / doi.org / 10.3791 / 3540. In short, luciferase was denatured in living cells by incubation at 45°C for 30 minutes in the presence of 200 mM MOPS and 20 μg / mL cycloheximide. After the denaturation step, the cells were cultured at 37°C for various lengths to allow luciferase to refold. The cells were lysed using ReporterLysis 5X Buffer (lysate for reporter gene) (Promega), and the luciferase activity was measured.

[0161] Quantitative RT-PCR:

[0162] First, total RNA was isolated using ISOGEN (trade name of NIPPON GENE CO., LTD.). cDNA was prepared using PrimeScript (trade name) 1-strand cDNA synthesis kit (TaKaRa). qRT-PCR was performed using QuantStudio3 real-time PCR system (Thermo Fisher) and Fast SYBR Green MasterMix (Thermo Fisher). The copy number of each transcription product was expressed based on β-actin. The sequences of the primers (forward and reverse) are as follows: ATF4 (GTTCTCCAGCGACAAGGCTA and ATCCTGCTTGCTGTTGTTGG), sXBP-1 (CTGAGTCCGAATCAGGTGCAG and ATCCATGGGGAGATGTTCTGG), CHOP (GAACGGCTCAAGCAGGAAATC and TTCACCATTCGGTCAATCAGAG), BIP (TAGCGTATGGTGCTGCTGTC and TGACACCTCCCACAGTTTCA), and ERDJ4 (TGGTGGTTCCAGTAGACAAAGG and CTTCGTTGAGTGACAGTCCTGC).

[0163] Non-denaturing PAGE analysis of BSA denaturation due to heat:

[0164] In the presence or absence of 100 μM of compound 1, compound 6 or 10 mM PBA, a solution of BSA (1.0 mg / mL) in PBS (100 μL, pH 7.4) was incubated at 25°C or 75°C for 1 hour. The samples were subjected to non-denaturing PAGE analysis using 8% acrylamide gel in 0.1 M Tris-HCl, pH 7.8 (cathode) and 68 mM glycine, 53 mM Tris-HCl, pH 8.9 (anode). After staining the gel with Coomassie Brilliant Blue, images were captured by ImageQuant LAS500 imager (Cytiva).

[0165] [Reference example: Screening of self-assembling compounds]

[0166] An in-house database of 142 self-assembling compounds was used to retrieve seed compounds (Jin, S.; Vu, HT; Hioki, K.; Noda, N.; Yoshida, H.; Shimane, T.; Ishizuka, S.; Takashima, I.; Mizuhata, Y.; Pe, KB; Ogawa, T.; Nishimura, N.; Packwood, D.; Tokitoh, N.; Kurata, H.; Yamasaki, S.; Ishii, KJ; Uesugi, M. Discovery of Self-Assembling Small Molecules as Vaccine Adjuvants. Angewandte Chemie Int Ed 2021, 60(2), 961-969. https: / / doi.org / 10.1002 / anie.202011604.). In the initial screening, the turbidity change of HEK293 cell lysate due to heat was measured as an index of aggregation of denatured proteins in the presence of 50 μM of each database compound. From the database compounds, 29 compounds were selected that showed equivalent inhibition to 10 mM PBA and TUDCA, which are surfactant-like chemical partners commonly used for solubilization of proteins ( Fig. 20 ). In the rescreening, 29 candidates were tested for their ability to prevent ER stress-induced cell death. HEK293 cells were treated with tunicamycin (tunicamycin, Tm, 5.0 μg / mL) in the presence of each compound (50 μM). Tunicamycin is an ER stress-inducing substance that inhibits N-glycosylation of proteins, thereby producing incompletely processed proteins in the ER. 48 hours of tunicamycin treatment resulted in a significant decrease in cell survival. Two different compounds (TD-4C8 and CB-6D7) out of the 29 compounds significantly rescued cells from tunicamycin-induced cell death at 50 μM, while PBA and TUDCA had little effect even at high concentrations ( Fig.21 ). For detailed evaluation, TD-4C8 showing the highest recovery rate was focused on.

[0167] [Example 1: Preparation of Compound 1]

[0168] As shown in the following scheme 1, compound (TD-4C8) is hydrolyzed, and the hydrolyzate is further irradiated with UV (ultraviolet light) to cyclize it, thereby preparing compound 1. A more detailed synthesis scheme is shown in the following scheme 2. In addition, as described in the following scheme 2, the following compounds 2 to 6 are also prepared in the same way. The structure of compound 1 is shown in 1 D NMR( 1 H. 13 C. 19 F), 2D 1 H- 1 H NOESY Fig. 22 ), HRMS and single crystal X-ray crystal structure analysis (Table S1 below) were performed to confirm.

[0169] [Chemical formula S1]

[0170]

[0171] [Chemical formula S2]

[0172]

[0173] The synthesis (production) of the compound shown in Scheme 2 is carried out as follows.

[0174] N 4 -Synthesis of phenylpyrimidine-2,4-diamine (Compound 7):

[0175] 2-Amino-4-chloropyrimidine (500 mg, 3.86 mmol) and aniline (0.530 mL, 5.80 mmol) were mixed in 5 mL of 2-propanol. A few drops of concentrated HCl were added to the mixture and stirred at 80 ° C for 3 hours. The stirred mixture was cooled to room temperature and diluted with 25 mL of ethyl acetate. The organic layer was washed twice with sodium bicarbonate aqueous solution and then further washed once with saturated brine. The washed organic phase was dried and concentrated with sodium sulfate. The residual solid obtained was recrystallized from ethyl acetate and hexane to obtain a light yellow powder of compound 7 as the target substance (484 mg, 2.60 mmol; yield 67.4%).

[0176] Instrumental analysis values ​​of compound 7:

[0177] 1H NMR (600MHz, DMSO-d6) δ9.08 (s, 1H), 7.80 (d, J=5.4Hz, 1H), 7.71 (dd, J=8.4, 1.2Hz, 2H), 7 .26 (dd, J=9.0, 7.8Hz, 2H), 6.94 (tt, J=7.2, 1.2Hz, 1H), 6.20 (s, 2H), 6.00 (d, J=5.4Hz, 1H)

[0178] 13 CNMR (150MHz, DMSO-d6) δ162.9, 160.7, 156.2, 140.5, 128.5, 121.3, 119.2, 96.5

[0179] HRMS (ESI+) [M+H] calcd., 187.0978; found, 187.0980 (0.2 mmu)

[0180] Synthesis of 4-((2-aminopyrimidin-4-yl)amino)benzenesulfonamide (Compound 8):

[0181] 2-Amino-4-chloropyrimidine (530 mg, 4.09 mmol) and sulfonamide (784 mg, 4.55 mmol) were suspended in 20 mL of 2-propanol. A few drops of concentrated hydrochloric acid were added to the mixture and stirred at 100 ° C for 5 hours. The stirred mixture was cooled to room temperature and concentrated using a rotary evaporator. The residual solid was suspended in 35 mL of 2N (2 mol / L) HCl aqueous solution. The suspension was neutralized with 70 mL of saturated NaHCO3 aqueous solution and extracted with ethyl acetate (60 mL×5). The organic layer after extraction was washed once with saturated NaHCO3 aqueous solution, and then washed once with saturated brine. It was concentrated to obtain the target product compound 8 (1.09 g, 4.10 mmol; yield 100%) as a light yellow powder.

[0182] Instrumental analysis values ​​of compound 8:

[0183] 1 HNMR (600MHz, DMSO-d6) δ9.50 (s, 1H), 7.92 (d, J=9.0Hz, 2H), 7.87 (d, J=6.0H z, 1H), 7.69 (d, J = 9.0Hz, 2H), 7.20 (s, 2H), 6.37 (s, 2H), 6.05 (d, J = 6.0Hz, 1H)

[0184] 13CNMR (150MHz, DMSO-d6) δ162.8, 160.4, 156.8, 143.7, 135.9, 126.4, 118.1, 97.0

[0185] HRMS (ESI+) [M+H] calcd., 266.0706; found, 266.0705 (-0.1 mmu)

[0186] N 4 Synthesis of -(4-(methylsulfonyl)phenyl)pyrimidine-2,4-diamine (Compound 9):

[0187] 2-Amino-4-chloropyrimidine (257 mg, 1.98 mmol) and 4-(methylsulfonyl)aniline (383 mg, 2.24 mmol) were suspended in 2 mL of 2-propanol. Several drops of concentrated hydrochloric acid were added to the mixture and stirred at 80 ° C for 3 hours. The stirred mixture was cooled to room temperature and 10 mL of 100 mM HCl aqueous solution was added. The mixture was neutralized with NaHCO3 to obtain a yellow precipitate. The precipitate was collected by filtration and washed twice with water. Recrystallization was performed from ethanol to obtain the target product compound 9 (328 mg, 1.24 mmol; yield 63%) as a light yellow powder.

[0188] Instrumental analysis values ​​of compound 9:

[0189] 1 HNMR (600MHz, DMSO-d6) δ9.64 (s, 1H), 8.02 (d, J=8.4Hz, 2H), 7.91 (d, J=5.4H z, 1H), 7.77 (d, J=9.0Hz, 2H), 6.41 (s, 2H), 6.08 (d, J=5.4Hz, 1H), 3.15 (s, 3H)

[0190] 13 CNMR (150MHz, DMSO-d6) δ162.8, 160.3, 157.0, 145.3, 132.0, 127.9, 118.3, 97.2, 43.9

[0191] HRMS (ESI+) [M+H] calcd., 265.0754; found, 265.0753 (-0.1 mmu)

[0192] Synthesis of tert-butyl (4-(phenylamino)pyrimidin-2-yl)carbamate (Compound 10):

[0193] Compound 7 (95.3 mg, 0.512 mmol) was mixed with di-tert-butyldicarbonate (135 mg, 0.619 mmol) in 1 mL of DMF (dimethylformamide). DIEA (N,N-diisopropylethylamine, 0.174 mL, 1.00 mmol) was added to the mixture and stirred at 25°C for 18 hours. The stirred mixture was diluted with ethyl acetate, washed twice with a saturated aqueous NaHCO3 solution, once with water, and once with saturated brine. The washed organic layer was dried and concentrated with Na2SO4. The crude product obtained was purified by column chromatography (50% to 100% ethyl acetate / hexane) to obtain 76.1 mg (0.266 mmol, yield 52%) of the target product compound 10 as a white powder.

[0194] Instrumental analysis values ​​of compound 10:

[0195] 1 HNMR (600MHz, DMSO-d6) δ9.69 (s, 1H), 9.52 (s, 1H), 8.06 (d, J = 6.0Hz, 1H), 7.92 (d, J = 7.8Hz, 2H ), 7.27 (dd, J=9.0, 7.2Hz, 2H), 6.97 (tt, J=7.2, 1.2Hz, 1H), 6.42 (d, J=6.0Hz, 1H), 1.48 (s, 9H)

[0196] 13 CNMR (150MHz, DMSO-d6) δ160.3, 157.1, 155.7, 150.9, 140.0, 128.5, 121.7, 119.2, 101.9, 78.9, 27.9

[0197] HRMS (ESI+) [M+H] calcd., 287.1503; found, 287.1501 (-0.2 mmu)

[0198] Synthesis of tert-butyl (4-((4-sulfamoylphenyl)amino)pyrimidin-2-yl)carbamate (Compound 11):

[0199] Compound 8 (530 mg, 2.00 mmol) was mixed with di-tert-butyl dicarbonate (895 mg, 4.10 mmol) in 5 mL of dry DMF. DIEA (0.600 mL, 3.44 mmol) was added to the mixture and stirred at 25 ° C for 18 hours. The stirred mixture was diluted with 60 mL of ethyl acetate, washed 5 times with saturated NaHCO3 aqueous solution, and further washed once with saturated brine. The organic layer was dried using Na2SO4 and concentrated using a rotary evaporator to obtain the target product compound 11 (350 mg, 0.958 mmol; yield 48%) as a white powder.

[0200] Instrumental analysis data of compound 11:

[0201] 1 HNMR (600MHz, DMSO-d6) δ9.92 (s, 1H), 9.85 (s, 1H), 8.17 (d, J=9.0Hz, 2H), 8.15 (d, J =5.4Hz, 1H), 7.71 (d, J = 9.0Hz, 2H), 7.21 (s, 2H), 6.48 (d, J = 5.4Hz, 1H), 1.50 (s, 9H)

[0202] 13 CNMR (150MHz, DMSO-d6) δ159.9, 157.1, 156.4, 150.9, 143.1, 136.4, 126.4, 118.4, 102.3, 79.1, 27.9

[0203] HRMS (ESI+) [M+H] calcd., 366.1231; found, 366.1227 (-0.4 mmu)

[0204] Synthesis of tert-butyl (4-((4-(methylsulfonyl)phenyl)amino)pyrimidin-2-yl)carbamate (Compound 12):

[0205] Compound 9 (106 mg, 0.401 mmol) and di-tert-butyl dicarbonate (196 mg, 0.898 mmol) were mixed in 2 mL of dry DMF. DIEA (0.150 mL, 0.861 mmol) was added to the mixture and stirred at 50 ° C for 16 hours. The stirred mixture was cooled to room temperature, diluted with 20 mL of ethyl acetate, washed twice with a saturated NaHCO3 aqueous solution, and further washed once with saturated brine. The organic layer was dried and concentrated using Na2SO4. The obtained residual oil was solidified by ultrasonic treatment in 2 mL of ethyl acetate. The obtained solid was collected by filtration and dried under vacuum to obtain compound 12 (62.0 mg, 0.170 mmol, yield 42%) as the target substance.

[0206] Instrumental analysis values ​​of compound 12:

[0207] 1 HNMR (600MHz, DMSO-d6) δ10.0 (s, 1H), 9.89 (s, 1H), 8.26 (d, J=9.0Hz, 2H), 8.18 (d, J =6.0Hz, 1H), 7.78 (d, J = 9.0Hz, 2H), 6.51 (d, J = 6.0Hz, 1H), 3.17 (s, 3H), 1.50 (s, 9H)

[0208] 13 CNMR (150MHz, DMSO-d6) δ159.9, 157.1, 156.6, 150.9, 144.7, 132.6, 127.9, 118.7, 102.5, 79.2, 43.9, 27.9

[0209] HRMS (ESI+) [M+H] calcd., 365.1278; found, 365.1275 (-0.3 mmu)

[0210] 3-Chlorobenzo[b]thiophene-2-carbonyl chloride and its derivatives were prepared according to the methods described in the following references 4 to 6.

[0211] (Reference 4) Wright, WB, Jr.; Brabander, HJ Preparation of 3-chlorobenzo[b]thiophene derivatives from cinnamic acids. J. Heterocycl. Chem. 1971, 8 (5), 711-714.

[0212] (Reference 5) Higa, T.; Krubsack, AJ Oxidations by thionyl chloride. 8. Aconvenient synthesis of benzo[b]thiophenes from carboxylic acids and ketones. J. Org. Chem. 1976, 41, 21, 3399-3403.

[0213] (Reference 6) Pakray, S.; Castle, RN The synthesis of dimethoxy[1]benzothieno[2,3-c]quinolines. J. Heterocycl. Chem. 1986, 23(5), 1571-1577.

[0214] Synthesis of compound 1:

[0215] Compound 11 (109 mg, 0.299 mmol) was dissolved in 3 mL of dry THF (tetrahydrofuran). 3-Chloro-6-fluorobenzo[b]thiophene-2-carbonyl chloride (83.0 mg, 0.333 mmol) and DIEA (62.6 μL, 0.359 mmol) were added to the solution at 25°C. After the mixture was stirred at 25°C for 20 minutes, it was diluted with 30 mL of ethyl acetate and washed twice with saturated NaHCO3 aqueous solution and once with saturated brine. The washed organic layer was dried and concentrated using Na2SO4. The obtained residual solid was suspended in 1 mL of dry dichloromethane. Trifluoroacetic acid (1 mL) was added to the mixture at 25°C and stirred at 25°C for 1 hour. The obtained mixture was concentrated by a rotary evaporator, and the addition and evaporation of 2 mL of dichloromethane were repeated 3 times. 5 mL of ethyl acetate was added to the residual oil to obtain a precipitate of the resultant. The precipitate was collected by filtration and washed with ethyl acetate (yield: 136 mg). Next, a portion of the obtained crude product (38.2 mg) was dissolved in 20 mL of dry DMF. The solution was irradiated with UV (365 nm, 80 W) for 3 hours in a low temperature room (4°C), and the reaction was monitored by LC-MS. After the reaction was completed, DMF was removed by evaporation, and 2 mL of acetone was added to the mixture to obtain a precipitate of compound 1. The mixture was transferred to a 1.5 mL microtube and simply centrifuged. The obtained pellets were washed three times with 1 mL of acetone and dried overnight to obtain the target compound 1 as a light yellow solid (10.6 mg, 0.0197 mmol as TFA (trifluoroacetic acid) salt; the yield was 29% based on the three-stage steps).

[0216] Instrumental analysis data of compound 1:

[0217] 1 HNMR (600MHz, DMSO-d6) δ11.0 (s, 1H), 9.29 (d, 1H, J=9.6Hz), 8.68 (dd, 1H, J=9.6, 3.5Hz), 8.24 (d, 1H, J=2.4Hz ), 8.11 (d, 2H, J = 6.6Hz), 7.87 (d, 2H, J = 8.4Hz), 7.59 (dd, 1H, J = 9.0, 2.4Hz), 7.38 (s, 2H), 6.89 (d, 1H, J = 7.2Hz)

[0218] 13 CNMR (150MHz, DMSO-d6) δ163.2, (162.0, 160.4), 157.5, 151.4, (141.54, 141.46), (141.1, 139.0), 138.8, 1 34.2, 126.7, (126.3, 126.2), 126.1, 125.6, 124.7, (123.2, 120.1), (115.0, 114.8), (111.0, 110.9), 102.8

[0219] HRMS (ESI+) [M+H] calcd., 442.0438; found, 442.0439 (0.1 mmu)

[0220] Synthesis of compound 2:

[0221] Compound 2 was synthesized from compound 10 and 3-chloro-6-fluorobenzo[b]thiophene-2-carbonyl chloride according to the same synthetic procedure as compound 1. As a result, compound 2 as the target product was obtained as a pale yellow solid (yield of 24% based on the three-step procedure). The NMR spectrum showed that the solid contained about 25% of other regioisomers that could not be separated by HPLC.

[0222] Instrumental analysis values ​​of compound 2:

[0223] 1 HNMR (600MHz, DMSO-d6) δ10.8 (s, 1H), 9.26 (d, J=7.2Hz, 1H), 8.70 (m, 1H), 8.26 (dd, J=9.0, 2.4Hz, 2 H), 7.95 (d, J=4.8Hz, 1H), 7.60 (td, J=9.0, 2.0Hz, 1H), 7.45 (m, 2H), 7.20 (m, 1H), 6.86 (d, J=6.0Hz)

[0224] 13 CNMR (150MHz, DMSO-d6) δ (162.0, 160.3), 157.6, 151.4, 0 (141.6, 141.5), 138.1, 137.0, 134.3, 128.9 ,128.5, (126.4, 126.3), 125.9, 125.7, 124.4, (123.8, 120.6), (114.9, 114.8), (111.0, 110.9), 102.9

[0225] HRMS (ESI+) [M+H] calcd., 363.0710; found, 363.0711 (0.1 mmu)

[0226] Synthesis of compound 3:

[0227] Compound 3 was synthesized from compound 12 and 3-chloro-6-fluorobenzo[b]thiophene-2-carbonyl chloride according to the same synthetic procedure as compound 1. As a result, compound 3 as the target product was obtained as a pale yellow solid (the yield was about 39% based on the three-step procedure). The NMR spectrum showed that the obtained solid contained about 15% of other regioisomers that could not be separated by HPLC.

[0228] Instrumental analysis values ​​of compound 3:

[0229] 1 HNMR (600MHz, DMSO-d6) δ10.9 (s, 1H), 9.30 (d, J = 7.8Hz, 1H), 8.69 (dd, J = 9.6, 4.8Hz, 1H), 8.26 (dd, J = 9.0, 2.4Hz, 1H), 8.18 (d, J=9.0Hz, 2H), 7.98 (d, J=9.0Hz, 2H), 7.59 (td, J=9.0, 2.4Hz, 1H), 6.84 (d, J=7.2Hz, 1H), 3.22 (s, 3H)

[0230] 13 CNMR (150MHz, DMSO-d6) δ164.6, (161.9, 160.3), 157.6, 151.9, 143.1, (141.33, 141.26), 138.9, (135.0, 134. 2), 128.2, 127.6, (126.3, 126.2), 125.9, 125.2, (123.2, 120.0), (114.7, 114.6), (111.0, 110.9), 102.1, 43.7

[0231] HRMS (ESI+) [M+H] calcd., 441.0486; found, 441.0485 (-0.1 mmu)

[0232] Synthesis of compound 4:

[0233] Compound 4 was synthesized from Compound 11 and 3-chlorobenzo[b]thiophene-2-carbonyl chloride according to the same synthesis procedure as Compound 1. As a result, the target product Compound 4 was obtained as a pale yellow solid (yield of about 27% in three steps).

[0234] Instrumental analysis values ​​of compound 4:

[0235] 1 HNMR (600MHz, DMSO-d6) δ10.9 (s, 1H), 9.34 (d, J = 7.2Hz, 1H), 8.65 (d, J = 7.8Hz, 1H), 8.29 (dd, J = 7.8, 1. 2Hz, 1H), 8.11 (d, J = 7.8Hz, 2H), 7.87 (d, J = 9.0Hz, 2H), 7.70 (m, 2H), 7.37 (s, 2H), 6.87 (d, J = 7.8Hz, 1H)

[0236] 13 CNMR (150MHz, DMSO-d6) δ164.2, 157.4, 151.8, 141.4, 139.5, 138.9, 138.8, 134.5, 128.8, 127.9, 126.7, 125.9, 125.0, 124.8, 124.1, 119.9, 102.4

[0237] HRMS (ESI+) [M+H] calcd., 424.0533; found, 424.0530 (-0.3 mmu)

[0238] Synthesis of compound 5:

[0239] Compound 5 was synthesized from Compound 11 and 3-chloro-6-methylbenzo[b]thiophene-2-carbonyl chloride according to the same synthesis procedure as Compound 1. As a result, the target product was obtained as a light yellow solid (yield of 23% based on three steps).

[0240] 1HNMR (600MHz, DMSO-d6, 50℃) δ11.0 (s, 1H), 9.32 (d, J=7.8Hz, 1H), 8.53 (d, J=9.0Hz, 1H), 8.10 (m, 3H) , 7.88 (d, J = 9.0Hz, 2H), 7.53 (dd, J = 9.0, 1.2Hz, 1H), 7.27 (s, 2H), 6.94 (d, J = 7.8Hz, 1H), 2.53 (s, 3H)

[0241] 13 CNMR (150MHz, DMSO-d6) δ163.8, 157.4, 151.4, 141.3, 139.9, 138.9, 138.8, 138.3, 134.5, 127.6, 126.7, 126.4, 124.4, 123.9, 123.7, 119.9, 102.6, 20.9

[0242] HRMS (ESI+) [M+H] calcd., 438.0689; found, 438.0686 (-0.3 mmu)

[0243] Synthesis of compound 6:

[0244] Compound 6 was synthesized from Compound 11 and 3-chloro-6-methoxybenzo[b]thiophene-2-carbonyl chloride according to the same synthesis procedure as Compound 1. As a result, the target product was obtained as a light yellow solid (yield of 24% based on three steps).

[0245] Instrumental analysis values ​​of compound 6:

[0246] 1 HNMR (600MHz, DMSO-d6) δ10.7 (s, 1H), 9.22 (d, J = 8.4Hz, 1H), 8.49 (d, J = 9.6Hz, 1H), 8.10 (d, J = 8.4Hz, 2H), 7.87 (d , J=9.0Hz, 2H), 7.84 (d, J=2.4Hz, 1H), 7.35 (s, 2H), 7.22 (dd, J=9.0, 2.4Hz, 1H), 6.80 (d, J=7.8Hz, 1H), 3.91 (s, 3H)

[0247] 13 CNMR (150MHz, DMSO-d6) δ159.2, 157.3, 151.1, 142.3, 141.2, 139.0, 138.7, 134.6, 126.7, 125.1, 122.0, 120.0, 118.5, 116.0, 106.9, 104.9, 102.8, 55.7

[0248] HRMS (ESI+) [M+H] calcd., 454.0638; found, 454.0636 (-0.2 mmu)

[0249] HPLC chromatogram:

[0250] HPLC analysis of compounds 1 to 6 was performed using a Prominence HPLC System (trade name of SHIMADZU CORPORATION) equipped with an Intertsil ODS-3 column with a linear gradient (20% acetonitrile / H2O (0 min) to 90% acetonitrile / H2O (30 min), followed by 100% acetonitrile (30-40 min), each containing 0.1% trifluoroacetic acid, flow rate = 1.0 mL / min). According to the HPLC analysis, it was confirmed that compounds 1 to 6 were synthesized with a purity exceeding 94%.

[0251] X-ray crystal structure analysis of compound 1·DMSO·methanol was performed as follows. Crystals of compound 1 were prepared by vapor diffusion using DMSO and methanol. Appropriate crystals were mounted in Fomblin (registered trademark) Y oil on glass fiber. MoKα radiation ( (0.071073 nm)), low temperature (90 K) data were collected using a Bruker D8VENTURE system with 1 μS diamond MoOptics. Empirical absorption correction was applied to the diffraction data using SADABS-2016 / 2 (reference 1 below). The structure was solved using SHELXT-2014 / 5 (reference 2 below), and the F2 of all data was refined by full matrix least squares using SHELXL-2018 / 1 (reference 3 below). All non-hydrogen atoms were anisotropically refined. All hydrogen atom parameters were refined. Details of the data quality and a summary of the improved residual values ​​for all structures are included in Table S1 below. Crystallographic data supplementing this paper are included in No. 2121059. The data are provided free of charge by the Cambridge Crystallographic Data Centre in collaboration with the FachinformationszentrumKarlsruhe Access Structures service www.ccdc.cam.ac.uk / structures.

[0252] (Reference 1) Krause, L.; Herbst-Irmer, R.; Sheldrick GM; Stalke D. Comparison of Silver and Molybdenum Microfocus X-ray Sources for Single-crystal Structure Determination. J. Appl. Cryst. 2015, 48 (1), 3-10.

[0253] (Reference 2)Sheldrick,GMSHELXT-Integrated Space-Group and Crystal-Structure Determination.Acta Cryst.A2015,71(1),3-8.

[0254] (Reference 3)Sheldrick,GMCrystal Structure Refinement withSHELXL.Acta Cryst.C 2015,71(1),3-8.

[0255] [Table S1]

[0256]

[0257] [Example 2: Biological activity of compound 1]

[0258] HEK293 cells were used to verify the ability of compound 1 to alleviate ER (endoplasmic reticulum) stress. Figure 1 and Figure 2 is a graph showing the biological activity of Compound 1 for reducing cytotoxicity under ER stress. Figure 1This is a diagram showing the relief of cell death under ER stress achieved by PBA and compound 1. HEK293 cells were pre-cultured with compound 1 (100 μM) or PBA (2.0 mM) for 12 hours, and then treated with thapsigargin (10 μM) or tunicamycin (5.0 μg / mL) for 48 hours. The error bar is sd (n=3). Statistical analysis was performed by one-way ANOVA and Dunnett's test using R software. As shown in the figure, when treated with compound 1, the survival rate of cells increased under ER stress conditions. In order to further verify the effect of compound 1 on endoplasmic reticulum stress that restored the activity of the screening compound, the mRNA levels of representative UPR genes such as ATF4, s-XPB1, CHOP, BiP, and ERDJ4 were examined. In addition, the same experiment was performed not only on compound 1, but also on compound 6. Figure 2 It is a graph showing the results obtained by measuring the mRNA expression level of genes related to ER stress by quantitative PCR. That is, the figure shows the changes in relative mRNA levels induced by compound 1 or compound 6 under ER stress. In addition, quantitative RT-PCR was implemented by the aforementioned method. After treating HEK293 cells with compound 1 (100 μM) for 10 hours, they were cultured with tunicamycin (1.0 μg / mL) for 24 hours. Reverse transcription and quantitative RT-PCR were performed on the isolated RNA samples. The bars in the bar graph show from the left: the results of the measurement in the presence of tunicamycin (without compounds 1 and 6), the results of the measurement when tunicamycin is not present (without compounds 1 and 6, only DMSO), the results of the measurement under the coexistence of tunicamycin and compound 1, and the results of the measurement under the coexistence of tunicamycin and compound 6. The error bar is sd (n=3). Statistical analysis was implemented by Student's t-test. *P<0.05, **P<0.01; and ns, no significant difference. Based on these measurement results, it was confirmed that Compound 1 and Compound 6 inhibited the mRNA level of CHOP. In addition, under this condition, tunicamycin treatment upregulated the mRNA levels of two genes, CHOP for apoptosis induction and BiP, a molecular chaperone of ER. The upregulated CHOP level was completely suppressed by pretreatment with Compound 1 or Compound 6, but the effect on Bip was limited with the same pretreatment. This response pattern is consistent with the possibility that Compound 1 reduces the apoptosis-promoting UPR, thereby leading to higher cell survival under ER stress conditions.

[0259] [Example 3: Synthesis of Compounds 1 to 6]

[0260] Furthermore, compounds 2 to 6 were prepared as derivatives of compound 1. The structures of compounds 1 to 6 are shown in the following chemical formulas. The preparation of compounds 2 to 6 was carried out in the same manner as the preparation of compound 1, except that raw materials corresponding to the structures of compounds 2 to 6 were used instead of TD-4C8 as shown in Scheme 2. In addition, the biological activities of compounds 1 to 6 were measured in Examples 4 to 9 described below.

[0261] [Chemical formula 1 to 6]

[0262]

[0263] [Example 4: Assembly of Compound 1 in Aqueous Solution and Living Cells]

[0264] Compound 1 was easily soluble in DMSO, but at 100 μM, it quickly formed independent assemblies in PBS buffer and cell culture medium (DMEM containing 10% FBS). Dynamic light scattering (DLS) analysis confirmed that the average size of the assemblies was approximately 700 and 200 nm in diameter in PBS (pH 7.4) and DMEM (10% FBS), respectively. Fig.23 ). By doping Nile red with 9-(2,2-dicyanovinyl)julolidine (DCVJ), which is an environmentally sensitive pigment, the formation of the assembly can be detected by fluorescence spectroscopy and confocal microscopy. The relative amount of self-organization of compound 1 was quantified using DCVJ to obtain a normalized dose-organization curve in DMEM ( Fig.24 ). By using the sigmoidal curve fitting, the apparent half-maximum assembly concentration (AC50) of the compound 1 molecule was 29.7 μM. Dilution of the preformed compound 1 assembly resulted in the disassembly of the particles, indicating the reversibility of self-assembly ( Fig.25 ). Under confocal microscopy, the Nile red-stained assemblies of compound 1 can be quickly detected in PBS (pH 7.4). In cell culture medium, the Nile red-stained assemblies of compound 1 were not initially observed due to their small particle size, but after long-term incubation (>5 hours), larger assemblies (diameter>1μm) that could be detected were formed.

[0265] Figure 3 is a diagram showing the self-assembly of compound 1 in living HEK293 cells. Figure 3 (A) is the fluorescence image after HEK293 cells were treated with compound 1 (100 μM) and DCVJ (1.0 μM). Figure 3(B) is a graph showing the quantification of compound 1 (100 μM) in cells stained with DCVJ (1.0 μM) by flow cytometry in the presence or absence of endocytosis inhibitors (100 μM chloroquine, 20 μM chlorpromazine, and 100 μM genistein). Statistical analysis was performed by one-way analysis of variance and Dunnett's test. *P < 0.05, **P < 0.01, and ns, no significant difference. In addition, the fluorescence image was measured as described above. After HEK293 cells were treated with 100 μM of compound 1 and 1.0 μM of DCVJ, fluorescent particles were observed in the cells after 8 hours of incubation, but no detectable particles were shown when only DCVJ was used ( Figure 3 A in the figure). The phenomenon that the assembly is localized inside the cell can be explained by two possibilities: (i) the self-assembled compound 1 enters the cell through endocytosis (endocytosis), or (ii) the nanoparticles of compound 1 directly penetrate the cell (direct penetration) (references 15 to 17 below). In order to speculate on the contribution of endocytosis, the amount of compound 1 assembled in the cell was quantified by flow cytometry, and three inhibitors that act on different endocytosis pathways (chloroquine, chlorpromazine and genistein) were used. Among the inhibitors tested, chloroquine and chlorpromazine reduced the average DCVJ signal by about 30%, suggesting that endocytosis partially contributes to the accumulation of compound 1 in the cell ( Figure 3 B). The results show that endocytosis and direct permeation contribute equally to the intracellular accumulation of compound 1. Considering the reversibility of assembly, it is also possible that the preformed particles are partially decomposed and the free monomers passively diffuse into the cell, thereby forming an assembly in the cell.

[0266] (Reference 15) Verma, A.; Uzun, O.; Hu, Y.; Hu, Y.; Han, H.-S.; Watson, N.; Chen, S.; Irvine, DJ; Stellacci, F. Surface-Structure-Regulated Cell-Membrane Penetration by Monolayer-Protected Nanoparticles. Nat Mater 2008,7(7),588-595.https: / / doi.org / 10.1038 / nmat2202.

[0267] (Reference 16) Nakamura, H.; Watano, S. Direct Permeation of NanoparticlesAcross Cell Membrane: A Review. Kona Powder Part J 2018, 35(0), 2018011. https: / / doi.org / 10.14356 / kona.2018011.

[0268] (Reference 17) Guo, Y.; Terazzi, E.; Seemann, R.; Fleury, JB; Baulin, VADirect Proof of Spontaneous Translocation of Lipid-Covered HydrophobicNanoparticles through a Phospholipid Bilayer.Sci Adv 2016,2(11),e1600261.https: / / doi.org / 10.1126 / sciadv.1600261.

[0269] [Example 5: Determination of biological activity of compound 6]

[0270] As described above, compounds 2 to 6 were synthesized as five derivatives of compound 1 to evaluate the structure-activity relationship. Figure 4 , Fig.26 and Fig. 27 It is a diagram showing the structure-activity relationship of compound 1 and compounds 2 to 6 which are its derivatives. Figure 4 and Fig.26 A in FIG. 1 is a graph showing changes in cell survival rate under ER stress caused by compound 1 and its derivatives compounds 2 to 6. HEK293 cells were treated with tunicamycin (5.0 μg / mL) for 48 hours in the presence of the indicated compounds. When R is replaced by hydrogen (compound 2) or methylsulfonyl (compound 3), 1 The addition of a sulfonamide at the position of Fig.26 A in R 2 The substitution of the fluoride group at the position also has a significant effect on the activity. For example, the derivative with a methyl group (compound 5) lost its activity, but the derivative with a methoxy group (compound 6) showed activity at a concentration lower than that of compound 1 (100 μM) (25 μM). Figure 4No obvious cytotoxicity was observed for compounds 1 and 4 up to 100 μM and compounds 5 and 6 at 25 μM, but the cell survival rate was slightly decreased when treated with 100 μM of compounds 5 and 6 ( Fig. 27 ).

[0271] [Example 6: Determination of the ability of compounds 1 to 6 to form self-assemblies]

[0272] The ability of compound 1 and its derivatives, compounds 4 to 6, to form assemblies was also monitored using living cells. Figure 5 The fluorescence images of the self-assembly of compound 1 and its derivatives in living cells. HEK293 cells were treated with compound 1, 4, 5 or 6 (25 μM or 100 μM) and 1.0 μM DCVJ for 8 hours. Fluorescence and bright field images were taken by confocal microscope CV1000. HEK293 cells were treated with compound 1, 4, 5 or 6 (25 or 100 μM) and DCVJ (1.0 μM) for 8 hours and observed by confocal microscope. All compounds showed particle formation at 100 μM. Compounds 1, 4 and 6, which are active derivatives, showed smaller (<1 μm) assemblies in cells, while compound 5 (inactive derivative 5) formed larger particles (~5 μm) that did not appear to enter the cells. At 25 μM, the molecule of compound 6 was the only derivative that showed an assembly that could be detected in cells. Even at 25 μM, the self-assembly ability of the molecule of compound 6 may be triggered by cell activity at this concentration. DLS analysis showed that the molecules of compound 6 (25 μM) formed assemblies with an average size of 130 nm in diameter in the cell culture medium ( Fig.28 The normalized dose-assembly curve for the molecule of compound 6 showed that the half-maximal assembly concentration (AC50) was 9.30 μM in cell culture medium ( Fig.29 ), showing that the molecules of compound 6 form assemblies at a concentration lower than that of the molecules of compound 1. In order to further verify the importance of self-organization formation in cell activities, the dose-response curves of compounds 1 and 6 were determined. It is predicted that the biological activity of the molecules of the assembled compound is more cooperative than that of the monomers, and a steep dose-response curve will be shown (reference 18 below). The tunicamycin test was implemented using various concentrations of compound 1, compound 6 and PBA. Figure 6The graph shows the dose response curve of tunicamycin test using compound 1, compound 6 and PBA. HEK293 cells were treated with tunicamycin (5.0 μg / mL) for 48 hours in the presence of various concentrations of compound 1, compound 6 or PBA. In the calculation of the dose response curve using the Hill equation, EC50s of 38.1, 13.7 and 483 μM were obtained for compound 1, compound 6 and PBA, respectively. Importantly, compound 1 and compound 6 showed steep dose response curves with high Hill coefficients (n=3.50 and 4.34 for compound 1 and compound 6, respectively). These results show that self-organization is an important factor in exerting the biological activity of compound 1 and its derivatives, and compound 6 is the strongest molecule. Hereinafter, compound 6 will be referred to as "self-organizing amide". In addition, for compounds 2 and 3, self-assembly activity (self-assembly ability) was confirmed by the same method as compounds 1, 4, 5 and 6.

[0273] (Reference 18) Feng, BY; Simeonov, A.; Jadhav, A.; Babaoglu, K.; Inglese, J.; Shoichet, BK; Austin, CPA High-Throughput Screen for Aggregation-BasedInhibition in a Large Compound Library. J Med Chem 2007,50(10),2385-2390.https: / / doi.org / 10.1021 / jm061317y.

[0274] [Example 7: Cellular activity of self-assembly of compound 1 and self-assembly of compound 6 (1)]

[0275] Confirmation experiments were performed to provide insight into how the self-assembly of the molecules of compound 1 and compound 6 exert cellular activity. First, the ability of these compounds to inhibit the heat-induced denaturation of BSA in vitro was examined. BSA (1.0 mg / mL) in PBS (pH 7.4) was heated at 75°C for 1 hour in the presence or absence of compound 1, compound 6, and PBA. The samples were analyzed by non-denaturing PAGE to monitor the denaturation of BSA ( Fig.11). PBA, a representative surfactant-type chemical chaperone, prevented the heat-induced denaturation of BSA, but failed to exert the same effect as compound 1 and compound 6. This suggests that the mechanism of action of the two compounds is different from that of PBA. One of the mechanisms is believed to be that the assembly of compound 1 and compound 6 selectively interacts with denatured proteins. BSA was fluorescently labeled with 5-carboxyfluorescein N-succimidyl ester, and the obtained fluorescently labeled BSA (fluorescently labeled BSA, BSA-flu) was denatured by heating at 80°C for 1 hour. Each compound was incubated with undenatured or denatured BSA-flu (0.1 mg / mL) in the presence of excess unlabeled original BSA (2.0 mg / mL) in PBS (pH 7.4). After 19 hours of incubation, the particles were examined by confocal microscopy ( Figure 7 , Fig.30 ). Figure 7 A diagram showing the co-assembly formation between self-assembling chemical substances (compounds disclosed in the present invention) and fluorescently labeled BSA (BSA-flu). Compound 1 or compound 6 was incubated with native (Nat.) or denatured (De.) BSA-flu (0.10 mg / mL) at 25°C in the presence of excess non-labeled BSA (2.0 mg / mL) and Nile Red (1.0 μM) for 19 hours. The average fluorescence of the particles was quantified using ImageJ software. Error bars are sd (n>6). Statistical analysis was performed using Student's t-test. *P<0.05, **P<0.01; and ns, no significant difference. In addition, regarding Figure 7The same image can also be confirmed by separating the transmitted light image and the fluorescent image and displaying them separately: Compound 1 and Compound 6 selectively form co-assemblies with heat-denatured BSA, and basically do not form co-assemblies with non-denatured (normal) BSA. These results indicate that by quantification of the fluorescence signal from the particles, both Compound 1 and Compound 6 show an increase in the fluorescence intensity of denatured BSA-flu compared to non-denatured BSA-flu, and the compound is preferably co-assembled with denatured BSA. In addition, non-denatured PAGE analysis based on heat denaturation of BSA is performed in the above manner. In addition, the preparation of fluorescently labeled BSA (BSA-flu) is implemented as follows. 30 μL of 10 mM 5-carboxyfluorescein N-succinimidyl ester in DMSO and 200 μL of 1.0 M sodium bicarbonate in water were added to a solution of BSA (2.0 mg / mL) in 1.9 mL of PBS (pH 7.4). After the mixture was incubated at 25°C for 1 hour, it was purified using a PD-10 desalting column (GE Healthcare). Fig.11 This is a photograph showing the CBB staining results of electrophoresis in non-denaturing polyacrylamide gel electrophoresis (8% acrylamide gel). According to the figure, it was confirmed that when heated at 75°C for 1 hour, no undenatured BSA remained, regardless of whether compound 1 or compound 6 co-existed in BSA. It was thus confirmed that no activity was observed to inhibit the thermal denaturation of BSA for compound 1 and compound 6. On the other hand, PBA, as an existing chemical partner, inhibited the thermal denaturation of BSA, indicating that compounds 1 and 6 have a mechanism of action different from that of existing chemical partners. In summary, the above results indicate that the molecules of compound 1 and compound 6 will not stabilize native proteins, will not hinder the process of protein denaturation, but will form co-assemblies with existing denatured proteins.

[0276] [Example 8: Cellular activity of self-assembly of compound 1 and self-assembly of compound 6 (2)]

[0277] Experiments were conducted to confirm the role of the co-assembly in achieving activity. It is believed that the molecules of compound 1 and compound 6 may accelerate the refolding of the co-assembled protein. In order to explore this possibility, a luciferase-based refolding assay was performed using living cells to monitor the effects of compound 1 and compound 6 on protein refolding (reference 19 below). The results are shown in Figure 8 .Right now, Figure 8A graph showing the results of a luciferase-based refolding assay in living HEK293 cells. In this assay, a luciferase expression construct was transferred into HEK293 cells and treated with compound 1 or compound 6 for 20 hours. After the living cells (luciferase-expressing cells) were heated at 45°C in a water bath for 30 minutes to denature the luciferase, the denatured luciferase was refolded in the living cells at 37°C for various lengths of time. Cycloheximide (20 μg / mL) was added to the cell culture during the denaturation and refolding steps to exclude the influence of newly synthesized luciferase. After the refolding step, the cells were lysed, and the luciferase activity was measured to infer the refolding efficiency, and the degree of refolding was evaluated. The error bar is sd (n=4). Statistical analysis was performed using a one-way ANOVA and Dunnett's test using 4-hour samples. ***P<0.001; and ns, no significant difference. Unexpectedly, compound 1 and compound 6 failed to accelerate the refolding of luciferase. Instead, it is possible that the denatured state of the protein is stabilized by coassembly, which slightly inhibits refolding. These data suggest that refolding is not involved in the activity of compounds 1 and 6.

[0278] (Reference 19) Walther, TV; Maddalo, D. Intracellular Refolding Assay. J Vis Exp 2012, No. 59. https: / / doi.org / 10.3791 / 3540.

[0279] [Example 9: Inhibition of cytotoxicity by Compound 1 and Compound 6]

[0280] Cellular protein aggregates are often removed by cellular mechanisms such as autophagy or the ubiquitin-proteasome system. To investigate the importance of these protein degradation pathways for the activity of Compounds 1 and 6, the ability to block tunicamycin-induced cytotoxicity was determined in the presence of autophagy or proteasome inhibitors (bafilomycin A1 or MG132, respectively). Fig. 9 This is a graph showing the results of tunicamycin detection using an autophagy and proteasome inhibitor. After pre-incubating cells with Compound 1 or Compound 6 for 16 hours, they were treated with tunicamycin (5.0 μg / mL) for 48 hours in the presence or absence of a specific substance. Fig. 9 (A) is a graph showing the measured values ​​in the presence or absence of bafilomycin A1 (BafA1, autophagy inhibitor). Fig. 9(B) is a graph showing the measured values ​​in the presence or absence of MG132 (proteasome inhibitor). Error bars are sd (n=3). Statistical analysis was performed by one-way ANOVA and Dunnett's test. *P<0.05; ns, no significant difference. Bafilomycin A1 (BafilomycinA1, Baf.) abolished some of the activities of compound 1 and compound 6 ( Fig. 9 A in the figure), while MG132 had a significant effect on the activity of molecules 1 and 6 ( Fig. 9 These results suggest that the autophagy system plays a partial role in the protein toxicity resistance activity of both Compound 1 and Compound 6. In addition, it was confirmed that the concentration of the inhibitor used was non-toxic to the cells ( Fig.31 , Fig.32 ). To further verify the role of autophagy, autophagy-deficient atg7- / - and p62- / - mouse embryonic fibroblasts (MEFs) were subjected to tunicamycin assay. Fig.10 This is a graph showing the results of tunicamycin detection using the autophagy-deficient cells. Wild-type (wt), atg7- / - or p62- / - mouse embryonic fibroblasts (MEF) were treated with molecule 1 (100 μM) or 6 (25 μM) for 18 hours, and then cultured with tunicamycin (5.0 μg / mL) for 48 hours. Error bars are sd (n=3). Statistical analysis was performed by one-way analysis of variance and Dunnett's test. *P<0.05, **P<0.01. ATG7 is an E1-like enzyme important for phagophore expansion, and p62 is an autophagy receptor for ubiquitinated substrates (reference 20 below). Wild-type (wt), atg7- / - or p62- / - MEF cells were treated with compound 1 or compound 6 for 18 hours, and then treated with tunicamycin (5.0 μg / mL) for 48 hours. Compounds 1 and 6 rescued wild-type MEFs from ER stress-induced cell death, but their abilities were significantly impaired in atg7- / - and p62- / - MEFs, indicating that autophagy plays an important role in the activities of these two molecules.

[0281] (Reference 20) Dikic, I.; Elazar, Z. Mechanism and Medical Implications of Mammalian Autophagy. Nat Rev Mol Cell Bio 2018, 19(6), 349-364. https: / / doi.org / 10.1038 / s41580-018-0003-4.

[0282] [Inspection of Examples 1 to 9]

[0283] Self-assembling chemicals containing amphiphilic lipids have been studied as carriers of small molecule drugs or bioactive molecules containing nucleic acids (reference 21 below). However, the biological activity of the self-assembling chemicals themselves has not been fully investigated. The reported bioactive self-assembling molecules usually use peptide building blocks, but most of them induce cell death (references 22 to 27 below). Recently, Hamilton and colleagues reported peptide-mimicking self-assembly that attenuated the cytotoxicity of amyloid-β fibers (reference 28 below). However, to date, only a few studies have reported the use of non-peptide self-assembling small molecules to control biological processes (references 14, 29 to 32 below). This lack of investigation is due to physical and pharmacological properties that are not expected by traditional medicinal chemistry (reference 18 above). This study shows a new aspect of self-assembling chemicals as blockers or "molecular absorbers" for cytotoxic denatured proteins in cells. To the best of the knowledge of the inventors of the present application, self-organizing amides (Compound 6) represent the first self-organizing organic molecules that absorb denatured proteins and sometimes even remove them in order to alleviate the toxicity caused by ER stress.

[0284] Denatured proteins are involved in various diseases such as neurodegenerative diseases and metabolic diseases. Chemical chaperones are considered as candidates for the treatment of these diseases, but have not been successful in clinical trials (non-patent document 2). The biggest disadvantage of existing chemical chaperones is that they are only effective in the early stages of protein denaturation, and their ability to deal with existing denatured proteins is limited. The above characteristics of chemical chaperones are different from the characteristics of molecular absorbents (compounds disclosed in this embodiment) that the inventors of the present application have identified through research. Molecular absorbents fail to prevent heat-induced protein denaturation, but are found to be able to co-assemble preferentially with pre-denatured proteins. For the same selective co-assembly with denatured proteins, a type of pullulan (CHP) hydrogel nanoparticle with a cholesterol group has been reported (references 33 and 34 below). In order to promote protein refolding or reduce aggregated proteins, various nanoparticles have also been reported (references 39 and 40 below). In general, denatured or misfolded proteins that expose hydrophobic amino acids on the surface tend to form hydrophobic interactions and insoluble protein aggregates (reference 41). This property may be involved in the coassembly of denatured proteins with self-organizing amides. Further studies are needed to further the understanding of the selective coassembly with denatured proteins that may eventually enable the rational design of molecular absorbents.

[0285] The unique feature of self-histamides is that co-assembly with denatured proteins appears to be removed by autophagy. This discovery raises several important questions that serve as the basis for future detailed investigations. However, the most important question is how the co-assembly of self-histamides and denatured proteins is recognized by the autophagic mechanism of the cell. The inventors of the present application speculate that the removal of biomolecular condensates or misfolded proteins may be mediated by selective autophagy, which maintains the homeostasis of the cell and plays a role in preventing aggregation-induced diseases (reference 42 below). Self-histamide assemblies may accelerate the selective autophagy of denatured proteins by functioning as phase separation points between denatured proteins and autophagy receptors.

[0286] The inventors of the present application have shown that the mammalian selective autophagy receptor p62 is necessary for the full activity of autophagy (references 43 to 45 below). However, denatured proteins blocked by autophagy are not necessarily ubiquitinated. It is still unclear how p62 participates in the action of autophagy.

[0287] There are various possibilities for the potential medical usefulness of self-organizing amides (compound 6) and their derivatives. In this regard, various proteins undergo denaturation under various pathological conditions such as neurological diseases (references 6 and 7 below), metabolism (reference 9 below), and eye diseases (reference 46 below). In particular, self-organizing molecules may be suitable for eye drops and ophthalmology that can be locally injected. This preclinical test is underway. Furthermore, careful optimization and evaluation are required in the further clinical application of self-assembling molecular absorbents. The safety of pharmacology, formulations, and various indications needs to be evaluated. The new mechanism of action of the compounds disclosed in the present invention shows that self-assembling molecules (compounds disclosed in the present invention) have the possibility of acting as a rich source of "molecular absorbents" that reduce the toxicity of denatured proteins and protein aggregates.

[0288] (Reference 21) Roesler, A.; Vandermeulen, GWM; Klok, H.-A. Advanced DrugDelivery Devices via Self-Assembly of Amphiphilic Block Copolymers. Adv DrugDeliver Rev 2012, 64, 270-279. https: / / doi.org / 10.1016 / j.addr.2012.09.026.

[0289] (Reference 22) Tanaka, A.; Fukuoka, Y.; Morimoto, Y.; Honjo, T.; Koda, D.; Goto, M.; Maruyama, T. Cancer Cell Death Induced by the Intracellular Self-Assembly of an Enzyme-Responsive Supramolecular Gelator. J Am Chem Soc 2015, 137(2), 770 - 775. https: / / doi.org / 10.1021 / ja510156v.

[0290] (Reference 23) Zhou, J.; Du, X.; Yamagata, N.; Xu, B. Enzyme-Instructed Self-Assembly of Small D-Peptides as a Multiple-Step Process for Selectively Killing Cancer Cells. J Am Chem Soc 2016, 138(11), 3813 - 3823. https: / / doi.org / 10.1021 / jacs.5b13541.

[0291] (Reference 24) Feng, Z.; Wang, H.; Chen, X.; Xu, B. Self-Assembling Ability Determines the Activity of Enzyme-Instructed Self-Assembly for Inhibiting Cancer Cells. J Am Chem Soc 2017, 139(43), 15377 - 15384. https: / / doi.org / 10.1021 / jacs.7b07147.

[0292] (Reference 25) Shoshan, M.S.; Vonderach, T.; Hattendorf, B.; Wennemers, H. Peptide-Coated Platinum Nanoparticles with Selective Toxicity against Liver Cancer Cells. Angewandte Chemie Int Ed 2019, 58(15), 4901 - 4905. https: / / doi.org / 10.1002 / anie.201813149.

[0293] (Reference 26) Hu, L.; Li, Y.; Lin, X.; Huo, Y.; Zhang, H.; Wang, H. Structure-Based Programming of Supramolecular Assemblies in Living Cells for Selective Cancer Cell Inhibition. Angewandte Chemie Int Ed 2021, 60(40), 21807 - 21816. https: / / doi.org / 10.1002 / anie.202103507.

[0294] (Reference 27) Zhang, L.; Jing, D.; Jiang, N.; Rojalin, T.; Baehr, C.M.; Zhang, D.; Xiao, W.; Wu, Y.; Cong, Z.; Li, J.J.; Li, Y.; Wang, L.; Lam, K.S. Transformable Peptide Nanoparticles Arrest HER2 Signalling and Cause Cancer Cell Death in Vivo. Nat Nanotechnol 2020, 15(2), 145 - 153. https: / / doi.org / 10.1038 / s41565-019-0626-4.

[0295] (Reference 28) Maity, D.; Howarth, M.; Vogel, M. C.; Magzoub, M.; Hamilton, A. D. Peptidomimetic-Based Vesicles Inhibit Amyloid-β Fibrillation and Attenuate Cytotoxicity. J Am Chem Soc 2021, 143(8), 3086 - 3093. https: / / doi.org / 10.1021 / jacs.0c09967.

[0296] (Reference 14) Jin, S.; Vu, H. T.; Hioki, K.; Noda, N.; Yoshida, H.; Shimane, T.; Ishizuka, S.; Takashima, I.; Mizuhata, Y.; Pe, K. B.; Ogawa, T.; Nishimura, N.; Packwood, D.; Tokitoh, N.; Kurata, H.; Yamasaki, S.; Ishii, K. J.; Uesugi, M. Discovery of Self-Assembling Small Molecules as Vaccine Adjuvants. Angewandte Chemie Int Ed 2021, 60(2), 961 - 969.

[0297] (Reference 29) Zorn, J. A.; Wille, H.; Wolan, D. W.; Wells, J. A. Self-Assembling Small Molecules Form Nanofibrils That Bind Procaspase-3 To Promote Activation. J Am Chem Soc 2011, 133(49), 19630 - 19633. https: / / doi.org / 10.1021 / ja208350u.

[0298] (Introduction 30)Takemoto,N.;Suehara,T.;Frisco,HL;Sato,S.;Sezaki,T.Kusam ori,K.;Kawazoe,Y.;Park,SM.Yamazoe,S.;Mizuhata,Y.;Inoue,R.;Miller, GJ;Hansen,SUJayson,GCGardiner,JMKanaya,T.Tokitoh,N.Ueda,K.Takakura,Y.Kioka,N.Nishikawa,M.Uesugi,M.Small-Molecule-Induced Clustering ofHeparan Sulfate Promotes Cell Adhesion.J Am Chem Soc 2013,135(30),11032–11039.

[0299] (Introduction 31)Lee,Y.andKim,H.andKang,S.andLee,J.andPark,J.andJon,S.BilirubinNanoparticles as a Nanomedicine for Anti-inflammation Therapy.AngewandteChemistry Int Ed 2016,55(26),7460–7463.

[0300] (Ref. 32)Slabicki,M.Yoon,H.Koeppel,J.;Nitsch,L.Burman,SSR.Genua,CD;Donovan,KA;Sperling,AS.Hunkeler,M.Tsai,JM.Sharma,R.1G uirguis,A.Zou,C.Chudasama,P.Gasser,JAMiller,PGScholl,C.Froehling,S.Nowak,RP.Fischer,ESEbert,BLSmall-Molecule-Induced PolymerizationTriggers Degradation of BCL6.Nature 2020,588(7836),164-168.

[0301] (Introduction 33)Akiyoshi,K.andSasaki,Y.andSunamoto,J.Molecular Chaperone-Like Activity of Hydrogel Nanoparticles of Hydrophobized Pullulan:ThermalStabilization with Refolding ofCarbonic Anhydrase B.Bioconjugate Chem https: / / doi.org / 10.1021 / bc9801272 , 1999, 10(3), 321–324.

[0302] (Introduction 34)Sawada,S.-I.Nomura,Y.Aoyama,Y.Akiyoshi,K.Heat ShockProtein-like Activity of NanogelArtificial Chaperone for Citrate Synthase.JBioact CompatPol 2006,21(6), 487–501.

[0303] (Introduction 39)Huang, F. and Wang, J. Qu, A. and Shen, L. and Liu, J. and Liu, J. and Zhang, Z. and An, Y. and Shi, L. Maintenance of AmyloidβPeptide Homeostasis by Artificial ChaperonesBased on Mixed-Shell Polymeric Micelles.Applied Chemistry Int Ed2014,53(34),8985-8990.

[0304] (Introduction 40)Luo, Q.;Lin,Y.-X.;Yang,P.-P.,Wang,Y.,Qi,G.-B.,Q iao, Z.-Y. Li, B.-N. Zhang, K. Zhang, J.-P. Wang, L. Wang, HA Self-Destructive NanosweeperThat Captures and Clears Amyloidβ-Peptides.Nat Commun 2018,9(1),1802.

[0305] (Rev. 41)Herczenik,E.andGebbink,MFBGMolecular and CellularAspects of Protein Misfolding and Disease.Faseb J 2008,22(7),2115-2133.https: / / doi.org / 10.1096 / fj.07-099671.

[0306] (Introduction 42)Deng,Z.;Purtell,K.;Lachance,V..Wold,MS.Chen,S..Yue,Z.Autophagy Receptors andNeurodegenerative Diseases.Trends Cell Biol 2017,27(7), 491–504.

[0307] (Rev. 43)Jacobi,AJ;Huber,ST;Mortensen,SA;Schultz,SW:Palara,A.;Kuhm,T.Shresth a,BK;Lamark,T.Hagen,WJH;Wilmanns,M.Johansen,T.Brech,A.Sachse,C.Structural Basis of P62 / SQSTM1 Helical Filaments andTheir Role in Cellular Cargo Uptake.Nat Commun 2020,11(1),440.

[0308] (Introduction 44)Sun, D. and Wu, R. and Zheng, J. and Li, P. and Yu, L. Polyubiquitin Chain-Induced P62 Phase Separation DrivesAutophagic Cargo Segregation.Cell Res2018,28(4), 405–415.

[0309] (References 45)Zaffagnini,G.Savova,A.Danieli,A.Romanov,J.Tremel,S.Ebner,M. Peterbauer,T.Sztacho,M.Trapannone,R.Tarafder,AK;Sachse,C.Martens,S.P62 Filaments Capture and Present Ubiquitinated CargoforAutophagy.Embo J 2018,37(5),e98308.

[0310] (Chapter 6)Romoli, M. and Sen, A. Parnetti, L. and Calabresi, P. and Costa, C. Amyloid-β: A Potential Link between Epilepsy and Cognitive Decline Neurol2021,1–17.https: / / doi.org / 10.1038 / s41582-021-00505-9.

[0311] (Part 7)Aarsland,D.Creese,B.Politis,M.Chaudhuri,KR,ffytche,DH,Weintraub,D.Ballard,C.Cognitive Decline in Parkinson's Disease.Nat RevNeurol 2017,13(4), 217–231.

[0312] (Chapter 9)Gomes,CMProtein Misfolding in Disease and Small MoleculeTherapies.Curr Top Med Chem 2013,12(22),2460-2469.

[0313] (Eds. 46)Makley,LN;McMenimen,KA;DeVree,BT;Goldman,JW;McGlasson,BN;Rajagopal,P.Dunyak, BM:McQuade,TJThompson,ADSunahara,R.Klevit,REAndley,UPGestwicki,JEPharmacological Chaperone forα-Crystallin Partially Restores Transparency in Cataract Models.

[0314] (Ref. 47)Ikeda et al., Nat Commun, 2022.

[0315] [Example 10: Preparation of compounds XD8 to XD28 and confirmation of endoplasmic reticulum stress inhibitory activity]

[0316] Furthermore, compounds XD8 to XD28 were prepared as derivatives of compound 1, and their biological activities were determined. The structures of compounds XD8 to XD28 are shown in the following chemical formula. Compounds XD8 to XD28 were prepared in the same manner as compound 1, except that raw materials corresponding to the structures of compounds XD8 to XD28 were used instead of TD-4C8. In addition, the successful preparation of compounds XD8 to XD28 was confirmed by confirming the structure by instrumental analysis based on the same method as compounds 1 to 6, and confirming that the target substance was obtained with high purity by HPLC.

[0317] [Chemical formula XD8~XD18]

[0318]

[0319] [Chemical formula XD19~XD28]

[0320]

[0321] In addition, the calculated values ​​and measured values ​​of the molecular weights of XD8 to XD28 based on HRMS (LC-MS) (ESI+) [M+H] are as follows:

[0322] XD8: HRMS (ESI+) [M+H] calcd, 458.0143; found, 458.0147 (0.4 mmu)

[0323] XD9: HRMS (ESI+) [M+H] calcd, 469.0383; found, 469.0384 (0.1 mmu)

[0324] XD10: HRMS (ESI+) [M+H] calcd., 468.0431; found, 468.0433 (0.2 mmu)

[0325] XD11: HRMS (ESI+) [M+H] calcd, 484.0744; found, 484.0745 (0.1 mmu)

[0326] XD12: HRMS (ESI+) [M+H] calcd, 501.9638; found, 501.9638 (0.0 mmu)

[0327] XD13: HRMS (ESI+) [M+H] calcd, 460.0344; found, 460.0345 (0.1 mmu)

[0328] XD14: HRMS (ESI+) [M+H] calcd., 468.0795; found, 468.0792 (-0.3 mmu)

[0329] XD15: HRMS (ESI+) [M+H] calcd., 482.0951; found, 482.0953 (0.2 mmu)

[0330] XD16: HRMS (ESI+) [M+H] calcd, 496.1108; found, 496.1109 (0.1 mmu)

[0331] XD17: HRMS (ESI+) [M+H] calcd, 524.1421; found, 524.1421 (0.0 mmu)

[0332] XD18: HRMS (ESI+) [M+H] calcd, 530.0951; found, 530.0952 (0.1 mmu)

[0333] XD19: HRMS (ESI+) [M+H] calcd, 484.0656; found, 484.0657 (0.1 mmu)

[0334] XD20: HRMS (ESI+) [M+H] calcd, 511.0601; found, 511.0604 (0.3 mmu)

[0335] XD21: HRMS (ESI+) [M+H] calcd, 496.0856; found, 496.0853 (-0.3 mmu)

[0336] XD22: HRMS (ESI+) [M+H] calcd, 502.0562; found, 502.0559 (-0.3 mmu)

[0337] XD23: HRMS (ESI+) [M+H] calcd, 510.0649; found, 510.0651 (0.2 mmu)

[0338] XD24: HRMS (ESI+) [M+H] calcd, 510.1013; found, 510.1017 (0.4 mmu)

[0339] XD25: HRMS (ESI+) [M+H] calcd, 524.1169; found, 524.1171 (0.2 mmu)

[0340] XD26: HRMS (ESI+) [M+H] calcd., 538.1326; found, 538.1331 (0.5 mmu)

[0341] XD27: HRMS (ESI+) [M+H] calcd, 566.1639; found, 566.1640 (0.1 mmu)

[0342] XD28: HRMS (ESI+) [M+H] calcd, 572.1169; found, 572.1173 (0.4 mmu)

[0343] The prepared XD8 to XD28 were subjected to tunicamycin detection in the same manner as in Examples 1 to 9. Specifically, HEK293 cells were first seeded in a 96-well plate (1×10 4 cells / well) and cultured at 37°C for 2 hours. Then, the culture medium was replaced with 100 μL of DMEM (10% FBS) containing self-assembling chemical substances (each compound of XD8 to XD28) and 1% DMSO. After culturing with any one of XD8 to XD28 at a concentration of 5.0 μM, 25 μM or 100 μM for 12 to 18 hours, HEK293 cells were treated with tunicamycin (5 μg / mL) for 48 hours, and the cell survival rate was measured using a WST-8 cell counting kit (DOJINDO LABORATORIES.). In addition, as positive controls, samples cultured with PBA (2 mM) instead of XD8 to XD28, samples cultured with compound 1 (100 μM) instead of XD8 to XD28, and samples cultured with compound 6 (25 μM) instead of XD8 to XD28 were used.

[0344] The results of tunicamycin detection of XD8 to XD28 are summarized in the following Tables 1 and 2. "Efficacy" indicates ER (endoplasmic reticulum) stress inhibitory activity. "Toxicity" indicates cytotoxicity. For ER stress inhibitory activity (Efficacy), "-" indicates inactivity, "+" indicates weak activity, and "++" indicates strong activity. In addition, "XD7" in the following Table 1 indicates compound 6. That is, "XD7" and "Compound 6" are the same compound.

[0345] [Table 1]

[0346]

[0347] [Table 2]

[0348]

[0349] In addition, the original data of the data in Table 1 and Table 2 are shown in Figures 12 to 15 of charts.

[0350] Furthermore, XD8 to XD28 were confirmed to have the same self-assembly activity (self-assembly ability) as compounds 1 to 6 by the same method as compounds 1 to 6. It is believed that compounds 1 to 6 and XD8 to XD28 have a common structure within the scope of the chemical formula (I) and therefore have self-assembly activity. Fig.33 and Fig.34 It is a graph showing dynamic light scattering (DLS) of the molecules of compounds XD8 to XD28, which shows the self-assembly activity of compounds XD8 to XD28. Fig.33 In the formula, Z-average represents the average size of the particles. Fig.34 In the figure, Derived count rate (kcps) represents the derived count rate. Fig.33 and Fig.34 In the table, the error bars are sd (n=3). Fig.33 and Fig.34 As shown, it was confirmed that compounds XD8 to XD28 all had self-assembly activity, although there were some differences in their self-assembly activities.

[0351] [Examples 11 to 13: Endoplasmic reticulum stress inhibitory activity of Compound 1 and Compound 6]

[0352] In Examples 11 to 13, the endoplasmic reticulum stress inhibitory activity of Compound 1 and Compound 6 was further confirmed. Figures 16 to 19 , etc.), "X441A" represents compound 1, and "XD7" represents compound 6. That is, "X441A" and "compound 1" are the same compound, and "XD7" and "compound 6" are the same compound.

[0353] (Production Example: Production of an Immortalized Corneal Endothelial Cell Line (iFECD) Model from a Patient with Fuchs' Corneal Endothelial Dystrophy)

[0354] In this example, an immortalized corneal endothelial cell line (iFECD) was prepared from corneal endothelial cells from a patient with Fuchs' corneal endothelial dystrophy.

[0355] (Cultivation Method)

[0356] The corneal endothelial cells were physically peeled off from the research cornea purchased from SightLifeTM together with the basement membrane, and the corneal endothelial cells were peeled off from the basement membrane using collagenase and recovered, and then primary culture was performed. As the culture medium, an acclimated culture medium for 3T3 feeder cells obtained by adding 8% FBS (BIOWEST, catalog number: S1820-500), 200 mg / ml CaCl2·2H2O (SIGMA catalog number: C7902-500G), 0.08% chondroitin sulfate (SIGMA catalog number: C9819-5G), 20 μg / ml ascorbic acid (SIGMA catalog number: A4544-25G), 50 μg / ml gentamicin (INVITROGEN catalog number: 15710-064) and 5 ng / ml EGF (INVITROGEN catalog number: PHG0311) to Opti-MEM I Reduced-Serum Medium, Liquid (INVITROGEN catalog number: 31985-070) was used as the basic culture medium. In addition, culture was carried out in a culture medium obtained by adding SB431542 (1 μmol / l) and SB203580 (4-(4-fluorophenyl)-2-(4-methylsulfonylphenyl)-5(4-pyridyl)imidazole<4-[4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-1H-imidazol-5-yl]pyridine) (1 μmol / l) to a basic culture medium (also referred to as "SB203580+SB431542+3T3 acclimation medium" in this specification).

[0357] (How to obtain)

[0358] Based on the consent obtained based on the documents and the approval of the ethics committee, corneal endothelial cells were obtained from 3 human patients whose clinical diagnosis of Fuchs corneal endothelial dystrophy evolved into bullous keratopathy and corneal endothelial transplantation (Desmeder's membrane endothelial keratoplasty = DMEK) was performed. When performing DMEK, the corneal endothelial cells of the disease are physically peeled off together with the Desmeder's membrane as the basement membrane and immersed in Optisol-GS (BLJ Company, Ltd.) as a corneal preservation solution. Then, collagenase treatment is performed, and the corneal endothelial cells are recovered by enzymes and cultured by SB203580+SB431542+3T3 acclimation medium. For the cultured corneal endothelial cells from patients with Fuchs corneal endothelial dystrophy, SV40 large T antigen and hTERT gene are amplified by PCR and introduced into lentiviral vectors (pLenti6.3_V5-TOPO; Life Technologies Inc). Then, the lentiviral vector was used to infect 293T cells (RCB2202; Riken Bioresource Center, Ibaraki, Japan) together with three auxiliary plasmids (pLP1, pLP2, pLP / VSVG; Life Technologies Inc.) using a transfection reagent (Fugene HD; Promega Corp., Madison, WI). After 48 hours of infection, the culture supernatant containing the virus was recovered and added to the culture medium of corneal endothelial cells from patients with Fuchs' corneal endothelial dystrophy using 5 μg / ml of polybrene to introduce the SV40 large T antigen and hTERT gene. Confirm the phase contrast microscopy image of the immortalized corneal endothelial cell line (iFECD) from patients with Fuchs' corneal endothelial dystrophy. As a control, the corneal endothelial cells cultured from the research cornea imported from the Seattle Eye Bank were immortalized by the same method to produce an immortalized cell line of normal corneal endothelial cells (iHCEC). Observation of phase contrast microscopic images of immortalized corneal endothelial cell line (iFECD) showed that iFECD had a single layer of polygonal morphology like normal corneal endothelial cells. iFECD was maintained and cultured in Dulbecco's modified Eagle's medium (DMEM) + 10% fetal bovine serum (FBS).

[0359] (Example 11-1: Inhibitory effect of compound 1 on cell damage induced by TGF-β2)

[0360] In this example, the effect of Compound 1 as an endoplasmic reticulum stress inhibitor on ocular cell damage was confirmed.

[0361] (Materials and methods)

[0362] Remove the culture medium from the culture dish where iFECD is being cultured, add to 1×PBS(-) pre-warmed to 37°C, and wash. Repeat this operation twice. Add 1×PBS(-) again and culture at 37°C (5% CO2) for 3 minutes. After removing PBS(-), add 0.05% Trypsin-EDTA (NACALAI TESQUE, INC., 32778-34) and culture at 37°C (5% CO2) for 5 minutes. Then, suspend in the culture medium and centrifuge at 1500 rpm for 3 minutes to recover the cells. The culture medium uses DMEM (NACALAI TESQUE, INC., 08456-36) + 10% FBS (Biowest, S1820-500) + 1% P / S (NACALAI TESQUE, INC., 26252-94).

[0363] The average number of cells per hole is 0.5×10 5 iFECD was seeded into a 12-well plate at a ratio of 1:1 and cultured at 37°C (5% CO2) for 24 hours (the culture medium used was DMEM + 10% FBS + 1% P / S). After 24 hours, the culture medium was removed, compound 1 was added, and culture was carried out for 24 hours (the culture medium used was DMEM + 2% FBS + 1% P / S). After 24 hours, the culture medium was removed, and a culture medium containing 10 ng / ml of recombinant human TGF-β2 (Wako, 200-19911) and compound 1 was added, and culture was carried out for 24 hours (the culture medium used was DMEM + 2% FBS + 1% P / S). After 30 hours, cell morphology and apoptosis were observed under a phase contrast microscope.

[0364] (result)

[0365] (Compound 1 as an endoplasmic reticulum stress inhibitor inhibits cell damage induced by TGF-β2)

[0366] The results are shown in Fig.16 . It was confirmed that in the absence of compound 1, an inhibitor of endoplasmic reticulum stress, cells were severely damaged after stimulation of iFECD with recombinant human TGF-β2. However, after pretreatment with compound 1, it was observed that damage to corneal endothelial cells was suppressed. Therefore, it was recognized that compound 1 inhibited cell damage induced by recombinant human TGF-β2.

[0367] (Example 11-2: Inhibitory effect of compound 6 on cell damage induced by TGF-β2)

[0368] In this example, the effect of Compound 6 as an endoplasmic reticulum stress inhibitor on ocular cell damage was confirmed.

[0369] (Materials and methods)

[0370] In addition, compound 6 was used instead of compound 1, and the iFECD seeded per well of a 12-well plate was 0.5 × 10 5 The ratio was changed to 0.9×10 per hole on average. 5 The same method as described in "Materials and Methods" of Example 11-1 was carried out except for the ratio of each.

[0371] (result)

[0372] (Compound 6 as an endoplasmic reticulum stress inhibitor inhibits cell damage induced by TGF-β2)

[0373] The results are shown in Fig.17 . It was confirmed that in the absence of compound 6, an inhibitor of endoplasmic reticulum stress, cells were severely damaged after stimulation of iFECD with recombinant human TGF-β2. However, after pretreatment with compound 6, it was observed that damage to corneal endothelial cells was suppressed. Therefore, it was recognized that compound 6 inhibited cell damage induced by recombinant human TGF-β2.

[0374] (Example 12-1: Inhibitory effect of compound 1 on caspase activity induced by TGF-β2)

[0375] In this example, the effect of Compound 1, an endoplasmic reticulum stress inhibitor, on caspase activity was confirmed.

[0376] (Materials and methods)

[0377] The same method as described in "Materials and Methods" of Example 11-1 was used for the experiment.

[0378] After observation, western blotting of proteins was performed according to the following procedure.

[0379] 1) Protein recovery

[0380] In order to recover both suspended cells and dead cells, the culture medium was recovered on ice, the cells were washed twice with 1×PBS(-), and the solution thus obtained was recovered, centrifuged at 800g for 12 minutes at 4°C, and the supernatant was discarded to obtain a precipitate. For the washed cells, a protein extraction buffer (RIPA; 50mM Tris-HCl (pH7.4), 150mM NaCl, 1mMEDTA, 0.1% SDS, 0.5% DOC, 1% NP-40) was added on ice to extract the protein. Then, the above-mentioned suspended cells and the precipitate after centrifugation of the dead cells were suspended together for extraction. The recovered liquid was pulverized three times in cold water for 30 seconds using an ultrasonic device (BIORUPTOR, manufactured by TOSHO DENKI), and then centrifuged at 15,000 rpm for 10 minutes at 4°C to recover the supernatant of the protein.

[0381] 2) Western blotting

[0382] 5-8 μg of the extracted protein was separated by SDS-PAGE and transferred to a nitrocellulose membrane. The first antibody used was rabbit anti-caspase 3 antibody (Cell Signaling, 9662), rabbit anti-PARP antibody (Cell Signaling, 9542), and mouse anti-GAPDH antibody (MBL, M171-3). The second antibody used was an anti-rabbit antibody and an anti-mouse antibody labeled with peroxidase (GE Healthcare Biosciences, NA931V, NA934V). The first antibody was diluted at the following dilution multiples, i.e., rabbit anti-caspase 3 antibody: 1000-fold dilution, rabbit anti-PARP antibody: 1000-fold dilution, mouse anti-GAPDH antibody: 5000-fold dilution, and the second antibody was diluted 5000-fold. Chemi Lumi ONEUltra (NACALAI TESQUE, INC., 11644-40) was used for detection. The intensity of the detected bands was analyzed using Luminescent Image Analyzer LAS-4000mini (Fuji Film Corporation) and ImageQuantTM software (GE Healthcare Corporation).

[0383] (result)

[0384] (Compound 1 as an endoplasmic reticulum stress inhibitor inhibits caspase activity induced by TGF-β2)

[0385] The results of Western blotting for caspase are shown in Fig.18. In the absence of compound 1, after iFECD was stimulated by recombinant human TGF-β2, active cleaved caspase 3 of about 17 kDa (about 17 kDa) was confirmed. However, in the group to which compound 1 was added, active cleaved caspase 3 was hardly confirmed. Therefore, it was confirmed by the analysis based on protein immunoblotting that compound 1 inhibited the activation of caspase induced by recombinant human TGF-β2.

[0386] (Example 12-2: Inhibitory effect of compound 6 on caspase activity induced by TGF-β2)

[0387] In this example, the effect of Compound 6, an endoplasmic reticulum stress inhibitor, on caspase activity was confirmed.

[0388] (Materials and methods)

[0389] In addition, compound 6 was used instead of compound 1, and the iFECD seeded per well of a 12-well plate was 0.5 × 10 5 The ratio was changed to 0.9×10 per hole on average. 5 The same method as described in "Materials and Methods" of Example 11-1 was used except for the ratio of . That is, the same method as described in "Materials and Methods" of Example 11-2 was used.

[0390] After observation, protein immunoblotting was performed. The method and procedure for performing protein immunoblotting were the same as those described in "1) Recovery of protein" and "2) Western blotting" described in Example 12-1.

[0391] (result)

[0392] (Compound 6 as an ER stress inhibitor inhibits caspase activity induced by TGF-β2)

[0393] The results of Western blotting for caspase are shown in Fig.19 . In the absence of compound 6, after iFECD was stimulated by recombinant human TGF-β2, active cleaved caspase 3 of about 17 kDa (about 17 kDa) was confirmed. However, in the group to which compound 6 was added, active cleaved caspase 3 was hardly confirmed. Therefore, it was confirmed by the analysis based on protein immunoblotting that compound 6 inhibited the activation of caspase induced by recombinant human TGF-β2.

[0394] (Example 13-1: Inhibitory effect of compound 1 on the production of fibronectin induced by TGF-β2)

[0395] In this example, the inhibitory effect of Compound 1, which is an endoplasmic reticulum stress inhibitor, on the production of fibronectin induced by TGF-β2 was confirmed.

[0396] (Materials and methods)

[0397] The same method as the method described in "Materials and Methods" of Example 11-1 and Example 12-1 was carried out.

[0398] After observation, protein immunoblotting was performed according to the following procedure.

[0399] 1) Protein recovery

[0400] The protein was recovered by the same method and procedure as that described in "1) Recovery of protein" in Example 12-1.

[0401] 2) Western blotting

[0402] 5 μg of the above-extracted protein was separated by SDS-PAGE and transferred to a nitrocellulose membrane. Mouse anti-fibronectin antibody (BD Bioscience, 610077) and mouse anti-GAPDH antibody (MBL, M171-3) were used as the first antibody. Anti-rabbit antibody and anti-mouse antibody (GE Healthcare Biosciences, NA931V, NA934V) labeled with peroxidase were used as the second antibody. The first antibody was diluted with the following dilution multiples, i.e., mouse anti-fibronectin antibody: 15000 times dilution, mouse anti-GAPDH antibody: 5000 times dilution, and the second antibody was diluted 5000 times. Chemi Lumi ONE Ultra (NACALAI TESQUE, INC., 11644-40) was used for detection. The intensity of the detected band was analyzed by luminescence imaging analyzer LAS-4000mini (Fuji Film Corporation) and ImageQuantTM software (GE Healthcare Corporation).

[0403] (result)

[0404] (Compound 1 inhibits the production of fibronectin induced by TGF-β2)

[0405] The results are shown in Fig.18 In the absence of compound 1, fibronectin was confirmed to be produced in iFECD after stimulation by recombinant human TGF-β2. However, in the group to which compound 1 was added, the production of fibronectin was basically not confirmed. Therefore, through analysis based on protein immunoblotting, it was confirmed that compound 1 inhibited the expression of fibronectin induced by recombinant human TGF-β2.

[0406] (Example 13-2: Inhibitory effect of compound 6 on the production of fibronectin induced by TGF-β2)

[0407] In this example, the inhibitory effect of Compound 6, which is an endoplasmic reticulum stress inhibitor, on the production of fibronectin induced by TGF-β2 was confirmed.

[0408] (Materials and methods)

[0409] In addition, compound 6 was used instead of compound 1, and the iFECD seeded per well of a 12-well plate was 0.5 × 10 5 The ratio was changed to 0.9×10 per hole on average. 5 The same method as described in "Materials and Methods" of Example 11-1 was used except for the ratio of . That is, the same method as described in "Materials and Methods" of Example 11-2 and Example 12-2 was used.

[0410] After observation, protein immunoblotting was performed. The method and procedure for performing protein immunoblotting were the same as those described in "1) Recovery of protein" and "2) Western blotting" described in Example 13-1.

[0411] (result)

[0412] (Compound 6 inhibits the production of fibronectin induced by TGF-β2)

[0413] The results are shown in Fig.19 In the absence of compound 6, fibronectin was confirmed to be produced in iFECD after stimulation by recombinant human TGF-β2. However, in the group to which compound 6 was added, the production of fibronectin was basically not confirmed. Therefore, through analysis based on protein immunoblotting, it was confirmed that compound 6 inhibited the expression of fibronectin induced by recombinant human TGF-β2.

[0414] In Fuchs' endothelial dystrophy, damage occurs, such as thickening of Desmery's membrane and formation of guttate cornea, caused by the overproduction of extracellular matrix such as fibronectin and its deposition on Desmery's membrane. These damages usually begin to occur in patients with Fuchs' endothelial dystrophy from the age of 30 to 40 and will further progress throughout life. As the disease progresses, visual disturbances such as blurred vision, halos, glare, and decreased vision will occur. Furthermore, in Fuchs' endothelial dystrophy, corneal endothelial cells continue to be damaged until the cell density drops to approximately 1000 / mm 2, the corneal endothelium with pump function is retained at the expense of maintaining corneal transparency. However, if it drops to about 1000 / mm 2 , then the aqueous humor will enter the cornea, thus causing corneal edema and visual impairment. It can be seen that for patients with Fuchs' corneal endothelial dystrophy, visual function impairment occurs mainly due to two reasons: excessive production of extracellular matrix and death of corneal endothelial cells. The action of the caspase inhibitor in the present disclosure can be said to be particularly useful for the treatment of Fuchs' corneal endothelial dystrophy by inhibiting the production of extracellular matrix and inhibiting the death of corneal endothelial cells.

[0415] As shown in the results of Examples 11 to 13, according to the present disclosure, a drug for treating or preventing corneal endothelial damage caused by, for example, overexpression of transforming growth factor-β (TGF-β) signals and / or extracellular matrix in corneal endothelial cells can be provided, and in particular, a drug for treating or preventing corneal endothelial damage caused by Fuchs corneal endothelial dystrophy can be provided. The present disclosure can be used, for example, in industries (pharmaceuticals, etc.) related to related technologies such as preparations based on the above-mentioned technology.

[0416] [Example 14: Inhibition of myopia progression by X441A eye drops]

[0417] This example demonstrates whether the progression of myopia can be suppressed by X441A eye drops.

[0418] (method)

[0419] The right eye of a 3-week-old C57BL6J male mouse was made to wear a -30 diopter (unit of refractive index, D) lens, and as a control eye, the left eye was made to wear only the frame. The wearing period of the lens was set to 3 weeks, and the refractive index and axial length of the eye were measured before and after wearing. While inducing myopia, X441A was dissolved in PBS in a manner of a 0.025% solution, and the eye drops thus obtained were administered once a day. The control group was given PBS for eye drops (PBS administration group). After 3 weeks of myopia induction and eye drops, the eyeballs were removed from the mice, the sclera was separated, and the expression levels of p62, Atg5, and Atg12 in each group were analyzed by protein immunoblotting.

[0420] (result)

[0421] (Can inhibit the development of myopia through X441A eye drops)

[0422] The results of Example 14 are shown in Figure 35~3 8. Fig.35 This is a graph showing the change in axial length measured before and after wearing the lens. Fig.36This is a graph showing the change in refractive index measured before and after wearing the lens. In the PBS administration group, the increase in axial length and myopia of refraction were observed by wearing the minus lens compared with the control eye, but in the X441A eye drop group, no such change was observed.

[0423] After 3 weeks of myopia induction and eye drops, the eyeballs were removed from the mice, the sclera was isolated, and the expression levels of p62, Atg5, and Atg12 in the X441A eye drops group and the PBS administration group were analyzed by Western blotting. The analysis results are shown in Fig.37 .

[0424] (X441A may promote the flow of autophagy in the sclera)

[0425] In myopic sclera, endoplasmic reticulum stress has occurred and is involved in the development of myopia (reference 47). Activation of the endoplasmic reticulum stress pathway induced by myopia (assessed by the ratio of pIRE1 / IRE to p-eIF2 / eIF2) did not occur in the X441A eye drop group. Therefore, wearing of minus lenses may enhance autophagy, while in the control group, autophagy is not completed. In addition, if Fig.37 As shown, the up-regulation of At5 / Atg12, which is associated with the formation and growth of autophagosomes, was enhanced regardless of the eye drops of X441A, while the expression of p62, which functions as a receptor for decomposing proteins, was down-regulated in the X441A eye drops group. This suggests that, in the PBS administration group, although the induction of autophagy and the formation of autophagosomes occurred due to myopia induction, the subsequent cleavage did not occur, while in the X441A eye drops group, the subsequent cleavage process was activated and the autophagic tide was enhanced, which is considered to be a mechanism for inhibiting the development of myopia.

[0426] As shown in the results of Example 14, according to the present disclosure, the development of myopia can be inhibited by X441A eye drops, and X441A may promote the flow of autophagy in the sclera.

[0427] This application claims priority based on Japanese patent application No. 2022-138149 filed on August 31, 2022, and all the disclosed contents thereof are incorporated herein.

[0428] The present disclosure can also be expressed by the following additional descriptions, for example. However, the following additional descriptions are only examples, and the present disclosure is not limited thereto.

[0429] (Additional Record 1)

[0430] A compound represented by the following chemical formula (I), its tautomer or stereoisomer, or a salt thereof,

[0431] [Chemical Formula I]

[0432]

[0433] In the chemical formula (I),

[0434] R 1 A hydrogen atom or -SO2-R 11 The substituent represented by R 11 is a hydrogen atom or any substituent,

[0435] R 2 and R 3 are respectively a hydrogen atom, a halogen atom, a nitro group, a straight-chain or branched-chain alkyl group, a straight-chain or branched-chain alkoxy group, or a cyano group, wherein one or more hydrogen atoms of the alkyl group or alkoxy group may be further substituted with a substituent or not, or, R 2 and R 3 optionally integrated to form a ring structure together with the benzene ring to which they are bonded,

[0436] X is a hydrogen atom or any substituent, each X can be the same or different,

[0437] Z is a hydrogen atom or an arbitrary substituent.

[0438] (Additional Record 2)

[0439] The compound according to Additional Record 1, its tautomer or stereoisomer, or a salt thereof, wherein in the chemical formula (I), Z is a hydrogen atom, or a substituent selected from a non-aromatic hydrocarbon group (which may be a straight chain or a branched chain, which may be saturated or unsaturated, and which may or may not contain a cyclic structure), an aromatic group (for example, an aromatic group (aryl) not containing heteroatoms, or a heteroaromatic group (heteroaryl) containing heteroatoms, and which may be a monocyclic or condensed ring), a halogen atom, an amino group, a nitro group, a sulfonyl group, or a cyano group, and at least one hydrogen atom of each substituent may be further substituted by any other substituent or may not be substituted.

[0440] (Additional Record 3)

[0441] The compound according to Additional description 1, its tautomer or stereoisomer, or a salt thereof, wherein in the chemical formula (I), X and Z are both hydrogen atoms.

[0442] (Additional Record 4)

[0443] The compound according to any one of Additional Remarks 1 to 3, its tautomer or stereoisomer, or a salt thereof, wherein in the chemical formula (I), R 2 and R 3In the above, the straight chain or branched chain alkyl group is a straight chain or branched chain alkyl group having 1 to 6 carbon atoms, and the straight chain or branched chain alkoxy group is a straight chain or branched chain alkoxy group having 1 to 6 carbon atoms.

[0444] (Additional Record 5)

[0445] The compound according to any one of Additional Statements 1 to 4, its tautomer or stereoisomer, or a salt thereof, wherein in the chemical formula (I),

[0446] In R 1 In, R 11 It is a hydrogen atom, a linear or branched alkyl group or an amino group, and one or more hydrogen atoms of the amino group may be substituted or unsubstituted by a substituent.

[0447] (Additional Record 6)

[0448] The compound according to Additional description 5, its tautomer or stereoisomer, or a salt thereof, wherein the substituent of the amino group is an aminoiminomethyl group.

[0449] (Additional Record 7)

[0450] The compound according to Additional description 1, its tautomer or stereoisomer, or a salt thereof, wherein in the chemical formula (I),

[0451] X and Z are all hydrogen atoms,

[0452] R 1 is a sulfonamide group,

[0453] R 2 It is a hydrogen atom, a fluorine atom, an alkyl group having 1 to 6 carbon atoms, or an alkoxy group having 1 to 6 carbon atoms.

[0454] (Additional Record 8)

[0455] The compound according to Additional description 1, its tautomer or stereoisomer, or a salt thereof, wherein the compound represented by the chemical formula (I) is a compound represented by any one of the following chemical formulas 1 to 6 and XD8 to 28.

[0456] [Chemical formula 1 to 6]

[0457]

[0458] [Chemical formula XD8~13]

[0459]

[0460] [Chemical formula XD14~18]

[0461]

[0462] [Chemical formula XD19~24]

[0463]

[0464] [Chemical formula XD25~28]

[0465]

[0466] (Additional Record 9)

[0467] The compound according to Additional description 8, its tautomer or stereoisomer, or a salt thereof, wherein the compound represented by the chemical formula (I) is a compound represented by the chemical formula 1, 4, 5 or 6.

[0468] (Additional Record 10)

[0469] The compound according to Additional description 8, its tautomer or stereoisomer, or a salt thereof, wherein the compound represented by the chemical formula (I) is the compound represented by the chemical formula 6.

[0470] (Additional Record 11)

[0471] An endoplasmic reticulum stress inhibitor, characterized by comprising the compound according to any one of Additional Descriptions 1 to 10, its tautomer or stereoisomer, or a salt thereof.

[0472] (Additional Record 12)

[0473] A medicament comprising the compound according to any one of Additional Descriptions 1 to 10, its tautomer or stereoisomer, or a salt thereof.

[0474] (Additional Record 13)

[0475] The medicament according to Additional description 12, which is used for corneal endothelial dystrophy.

[0476] (Additional Record 14)

[0477] An ophthalmic drug comprising the compound according to any one of Supplementary Notes 1 to 10, its tautomer or stereoisomer, or a salt thereof.

[0478] (Additional Record 15)

[0479] An eye drop comprising the compound according to any one of Supplementary Descriptions 1 to 10, its tautomer or stereoisomer, or a salt thereof.

[0480] (Additional Record 16)

[0481] A composition for preventing or treating eye symptoms, damage or diseases, comprising the compound according to any one of Supplementary Notes 1 to 10, its tautomer or stereoisomer, or a salt thereof.

[0482] (Additional Record 17)

[0483] The composition according to Additional description 16, wherein the eye symptom, damage or disease is a symptom, damage or disease of the corneal endothelium.

[0484] (Additional Record 18)

[0485] The composition according to Additional description 16 or 17, wherein the eye symptom, damage or disease is a symptom, damage or disease of the corneal endothelium caused by transforming growth factor-β (TGF-β).

[0486] (Additional Record 19)

[0487] A composition according to Additional Record 17 or 18, wherein the symptom, damage or disease of the corneal endothelium is at least one selected from the group consisting of Fuchs corneal endothelial dystrophy, damage after corneal transplantation, corneal endotheliitis, trauma, ophthalmic surgery, damage after ophthalmic laser surgery, aging, posterior polymorphic corneal dystrophy (PPD), congenital hereditary corneal endothelial dystrophy (CHED), primary corneal endothelial damage and cytomegalovirus corneal endotheliitis.

[0488] (Additional Record 20)

[0489] The composition according to any one of Additional Statements 17 to 19, wherein the symptom, damage or disease of the corneal endothelium is a symptom, damage or disease of the corneal endothelium caused by overexpression of an extracellular matrix (ECM).

[0490] (Additional Record 21)

[0491] A composition according to Additional Record 20, wherein the symptom, damage or disease of the corneal endothelium is at least one selected from the group consisting of Fuchs corneal endothelial dystrophy, formation of guttate cornea, hypertrophy of Desmedt's membrane, hypertrophy of corneal thickness, opacity, scar, corneal stromal opacity, corneal epithelial edema, corneal epithelial damage, corneal clouding, corneal leukoplakia, photophobia and blurred vision.

[0492] (Additional Record 22)

[0493] The composition according to any one of Additional Statements 16 to 21, wherein the symptom, injury or disease includes Fuchs' corneal endothelial dystrophy.

[0494] (Additional Record 23)

[0495] The composition according to any one of Additional Statements 16 to 22, wherein the ocular symptom, damage or disease is an ocular symptom, damage or disease caused by overexpression of an extracellular matrix (ECM).

[0496] (Additional Record 24)

[0497] The composition according to any one of Additional Descriptions 16 to 23, wherein the compound according to any one of Additional Descriptions 1 to 9, its tautomer or stereoisomer, or a salt thereof has endoplasmic reticulum stress suppressive activity.

[0498] (Additional Record 25)

[0499] A method for preparing the compound according to any one of additional descriptions 1 to 10, its tautomer or stereoisomer, or a salt thereof, characterized by comprising the following steps:

[0500] a hydrolysis step of hydrolyzing the compound represented by the following chemical formula (II), its tautomer or stereoisomer, or a salt thereof; and

[0501] A cyclization step of cyclizing the product of the hydrolysis step,

[0502] [Chemical Formula II]

[0503]

[0504] In the chemical formula (II),

[0505] R 1 , R 2 , R 3 , X and Z and R in the chemical formula (I) 1 , R 2 , R 3 , X and Z are the same,

[0506] Hal is a halogen atom.

[0507] (Additional Record 26)

[0508] The medicine according to Additional Record 12, which is used for myopia.

[0509] (Additional Record 27)

[0510] The composition according to Additional description 16, wherein the symptom, damage or disease of the eye is a symptom, damage or disease of myopia.

[0511] Industrial Applicability

[0512] In summary, according to the present disclosure, a novel compound, endoplasmic reticulum stress inhibitor, drug, ophthalmic drug, eye drop, composition, and preparation method of the compound having self-assembly activity can be provided. The compounds disclosed in the present disclosure can be used as lead compounds for drugs for neurodegenerative diseases, metabolic diseases, and ophthalmic diseases, for example. In addition, as shown in the aforementioned embodiments, the compounds disclosed in the present disclosure can be used, for example, as self-assembling substances that co-assemble with denatured proteins to reduce protein toxicity and endoplasmic reticulum (ER) stress. Therefore, the compounds disclosed in the present disclosure provide a valuable research approach for studying the homeostasis of proteins and the etiology of endoplasmic reticulum stress and protein toxicity. In addition, the compounds disclosed in the present disclosure can be used for all purposes related to endoplasmic reticulum stress inhibition. As the purposes related to endoplasmic reticulum stress inhibition, there is no particular limitation, for example, the various purposes mentioned above can be listed. Further, the uses of the compounds disclosed in the present disclosure are not limited to the uses related to endoplasmic reticulum stress inhibition, but can be arbitrary and can be used for any purposes.

Claims

1. A compound represented by the following chemical formula (I), its tautomer or stereoisomer, or a salt thereof, [Chemical Formula I] In the chemical formula (I), R 1 A hydrogen atom or -SO2-R 11 The substituent represented by R 11 is a hydrogen atom or any substituent, R 2 and R 3 are respectively a hydrogen atom, a halogen atom, a nitro group, a straight-chain or branched-chain alkyl group, a straight-chain or branched-chain alkoxy group, or a cyano group, wherein one or more hydrogen atoms of the alkyl group or alkoxy group may be further substituted with a substituent or not, or, R 2 and R 3 optionally integrated to form a ring structure together with the benzene ring to which they are bonded, X is a hydrogen atom or any substituent, each X can be the same or different, Z is a hydrogen atom or an arbitrary substituent.

2. The compound according to claim 1, its tautomer or stereoisomer, or a salt thereof, wherein: In the chemical formula (I), X and Z are all hydrogen atoms.

3. The compound according to claim 1 or 2, its tautomer or stereoisomer, or a salt thereof, wherein: In the chemical formula (I), R 2 and R 3 In the above, the straight chain or branched chain alkyl group is a straight chain or branched chain alkyl group having 1 to 6 carbon atoms, and the straight chain or branched chain alkoxy group is a straight chain or branched chain alkoxy group having 1 to 6 carbon atoms.

4. The compound according to any one of claims 1 to 3, its tautomer or stereoisomer, or a salt thereof, wherein: In the chemical formula (I), In R 1 In, R 11 It is a hydrogen atom, a linear or branched alkyl group or an amino group, and one or more hydrogen atoms of the amino group may be substituted or unsubstituted by a substituent.

5. The compound according to claim 4, its tautomer or stereoisomer, or a salt thereof, wherein: The substituent of the amino group is aminoiminomethyl.

6. The compound according to claim 1, its tautomer or stereoisomer, or a salt thereof, wherein: In the chemical formula (I), X and Z are all hydrogen atoms, R 1 is a sulfonamide group, R 2 It is a hydrogen atom, a fluorine atom, an alkyl group having 1 to 6 carbon atoms, or an alkoxy group having 1 to 6 carbon atoms.

7. The compound according to claim 1, its tautomer or stereoisomer, or a salt thereof, wherein: The compound represented by the chemical formula (I) is a compound represented by any one of the following chemical formulas 1 to 6 and XD8 to 28, [Chemical formula 1 to 6] [Chemical formula XD8~13] [Chemical formula XD14~18] [Chemical formula XD19~24] [Chemical formula XD25~28] 8. The compound according to claim 7, its tautomer or stereoisomer, or a salt thereof, wherein: The compound represented by the chemical formula (I) is a compound represented by the chemical formula 1, 4, 5 or 6.

9. The compound according to claim 7, its tautomer or stereoisomer, or a salt thereof, wherein: The compound represented by the chemical formula (I) is the compound represented by the chemical formula 6.

10. An endoplasmic reticulum stress inhibitor, characterized in that The compound according to any one of claims 1 to 9, its tautomer or stereoisomer, or a salt thereof.

11. A drug, characterized in that The compound according to any one of claims 1 to 9, its tautomer or stereoisomer, or a salt thereof.

12. The medicament according to claim 11, which is used for corneal endothelial dystrophy.

13. The medicine according to claim 11, which is used for myopia.

14. An ophthalmic medicine or eye drops, characterized in that: The compound according to any one of claims 1 to 9, its tautomer or stereoisomer, or a salt thereof.

15. A composition for preventing or treating ocular symptoms, injuries or diseases, characterized in that: The compound according to any one of claims 1 to 9, its tautomer or stereoisomer, or a salt thereof.

16. The composition according to claim 15, wherein The ocular symptom, injury or disease is a symptom, injury or disease of the corneal endothelium.

17. The composition according to claim 15 or 16, wherein The ocular symptom, injury or disease is a symptom, injury or disease of the corneal endothelium caused by transforming growth factor-β (TGF-β), or a symptom, injury or disease of the corneal endothelium caused by overexpression of extracellular matrix (ECM).

18. The composition according to any one of claims 15 to 17, wherein The symptom, injury or disease of the eye is at least one selected from the group consisting of Fuchs corneal endothelial dystrophy, injury after corneal transplantation, corneal endotheliitis, trauma, ophthalmic surgery, injury after ophthalmic laser surgery, aging, posterior polymorphic corneal dystrophy (PPD), congenital hereditary corneal endothelial dystrophy (CHED), primary corneal endothelial injury and cytomegalovirus corneal endotheliitis caused by transforming growth factor-β (TGF-β), or at least one selected from the group consisting of Fuchs corneal endothelial dystrophy, formation of guttate cornea, hypertrophy of Desmeer's membrane, hypertrophy of corneal thickness, opacity, scar, corneal stromal opacity, corneal epithelial edema, corneal epithelial injury, corneal clouding, corneal leukoma, photophobia and blurred vision caused by overexpression of extracellular matrix (ECM).

19. The composition according to any one of claims 15 to 18, wherein The condition, injury or disease includes Fuchs endothelial corneal dystrophy.

20. The composition according to claim 15, wherein The ocular symptom, injury or disease is a symptom, injury or disease of myopia.

21. The composition according to claim 15 or 20, wherein The eye symptoms, injuries or diseases are eye symptoms, injuries or diseases caused by refractive error, axial length increase, choroidal thinning, and decreased choroidal blood flow.

22. A method for preparing the compound according to any one of claims 1 to 9, its tautomer or stereoisomer, or a salt thereof, characterized in that: Including the following processes: A hydrolysis step of hydrolyzing the compound represented by the following chemical formula (II), its tautomer or stereoisomer, or a salt thereof; and A cyclization step of cyclizing the product of the hydrolysis step, [Chemical Formula II] In the chemical formula (II), R 1 , R 2 , R 3 , X and Z and R in the chemical formula (I) 1 , R 2 , R 3 , X and Z are the same, and Hal is a halogen atom.

Images