Application of ginkgetin in preparation of GRP78 protein inhibitor

Abstract

The invention relates to the field of biological medicine, in particular to application of ginkgetin in preparation of a GRP78 protein inhibitor. The ginkgetin has a structure as shown in a formula (I): # imgabs0 #. A thermal displacement experiment proves that the ginkgetin interacts with an LYS-296 site of GRP78, so that the ginkgetin can be used as a GRP78 protein inhibitor to influence ATP enzyme activity and thermal stability of the GRP78 protein inhibitor; after the ginkgetin treats the tumor cells, the expression of the marker protein of the endoplasmic reticulum stress of the tumor cells is up-regulated, which indicates that the ginkgetin can induce the endoplasmic reticulum stress generation; the function antagonism of an autophagy inhibitor chloroquine and ginkgetin shows that ginkgetin can induce tumor cell autophagy.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to the use of ginkgo biloba in the preparation of GRP78 protein inhibitors. Background Art

[0002] Osteosarcoma is the most common primary bone malignancy in children and adolescents, mainly occurring in long bones. It grows rapidly, has high metastatic potential, and is locally invasive. The most common metastatic sites are the lungs and other bones, resulting in a high mortality rate. Osteosarcoma is highly malignant and has a very poor prognosis. It shows rapid proliferation and a high tendency to metastasize. It can metastasize to the lungs within a few months, which seriously threatens human health. In recent decades, the treatment and intervention measures for osteosarcoma have been continuously explored and studied. At present, the main treatment for osteosarcoma is a combination of surgery and chemotherapy. Encouraging progress has been made in treatment, including the emergence of multi-drug chemotherapy. Chemotherapy is a common treatment for osteosarcoma, and methotrexate, doxorubicin, cisplatin, and ifosfamide are the most widely used drug regimens. However, it is limited by its side effects and the development of drug resistance. So far, the pathogenesis and driver genes of osteosarcoma have not been clarified, resulting in no effective molecular targets for the treatment of osteosarcoma. Therefore, it is urgent to find targeted drugs to inhibit the growth of osteosarcoma. Natural compounds have incomparable advantages in the treatment of cancer: they have high biological activity and structural diversity, and are easier to enter cells to exert their efficacy. The raw materials are widely available and have relatively few side effects. The synergistic effect of multiple targets makes it more likely that natural compounds will be able to regulate some special difficult targets. However, natural compounds often have multi-target effects. Therefore, screening and identifying new natural compounds, exploring their targets, and applying them to the clinical treatment of osteosarcoma are of great significance for prolonging the lives of osteosarcoma patients, and are also the main direction of research and development of new anti-osteosarcoma drugs based on natural compounds. Summary of the invention

[0003] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a use of ginkgo biloba or a pharmaceutically acceptable salt thereof in the preparation of a GRP78 protein inhibitor, so as to solve the problems in the prior art.

[0004] To achieve the above-mentioned object and other related objects, the present invention provides the use of ginkgo biloba or a pharmaceutically acceptable salt thereof in the preparation of a GRP78 protein inhibitor.

[0005] Preferably, the ginkgo biloba has the structure of formula (I):

[0006]

[0007] The present invention also provides the use of ginkgo biloba or a pharmaceutically acceptable salt thereof in preparing a product for treating endoplasmic reticulum stress-related diseases, wherein the endoplasmic reticulum stress-related diseases are caused by abnormal function of the GRP78 protein.

[0008] The present invention also provides the use of ginkgo biloba or a pharmaceutically acceptable salt thereof in preparing a product for promoting cell autophagy.

[0009] As described above, the use of the ginkgo biloba or a pharmaceutically acceptable salt thereof in the preparation of a GRP78 protein inhibitor has the following beneficial effects:

[0010] The present invention confirms through a thermal shift experiment that ginkgo biloba interacts with the LYS-296 site of GRP78, so ginkgo biloba can be used as a GRP78 protein inhibitor to affect its ATPase activity and thermal stability; after the tumor cells are treated with ginkgo biloba, the expression of marker proteins of endoplasmic reticulum stress in the tumor cells is upregulated, indicating that ginkgo biloba can induce the generation of endoplasmic reticulum stress; the functions of the autophagy inhibitor chloroquine and ginkgo biloba are antagonistic, indicating that ginkgo biloba can induce autophagy in tumor cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 The expression of GRP78 in osteosarcoma in the present invention is shown. A, IHC staining in osteosarcoma clinical samples, scale bar is 100 μm. The left picture is the low, medium and high staining characteristic map of GRP78, and the right picture is the statistical results of the three.

[0012] Figure 2 The figure shows the drug ginkgo biloba, which is screened from the natural compound library targeting GRP78 in the present invention. A, a brief scheme for screening drugs targeting GRP78 from the natural compound library; B, thermal shift experiment to determine the degradation temperature of GRP78; C, thermal shift experiment to screen out compounds with certain binding ability to GRP78 protein; D, a statistical result of the grayscale analysis of Figure C. E. Thermal shift experiment to determine the degradation temperature of GRP78 after treatment with ginkgo biloba; F, a statistical result of the grayscale analysis of protein expression, **P<0.01; G, the molecular structure of ginkgo biloba.

[0013] Figure 3The figure shows that ginkgo biloba binds to GRP78 and inhibits its ATPase activity. A, surface plasmon resonance experiment verifies the binding ability of ginkgo biloba to GRP78; B, docking experiment screens the key residues that may bind to GRP78: LYS-296, ARG-297 and ARG-60; C, ATPase activity experiment verifies that ginkgo biloba inhibits the ATPase activity of GRP78, N=3, ****p<0.0001; D, molecular dynamics experiment confirms that ginkgo biloba binds to GRP78 and improves its stability; E, thermal shift experiment confirms that mutation of LYS-296 site prevents ginkgo biloba from binding to GRP78; FI, statistical graphs of thermal shift results of Flag GRP78WT, ARG-60A, ARG-297A, and LYS-296A, respectively.

[0014] Figure 4 It shows that ginkgo biloba in the present invention inhibits the proliferation and migration of osteosarcoma cells and promotes their apoptosis. A, CCK8 results of various osteosarcoma cell lines after ginkgo biloba treatment; B, cloning results and statistical graphs after ginkgo biloba treatment; C, Calcein AM / PI confirms that ginkgo biloba causes the death of osteosarcoma cell lines, the scale bar is 100μm; D, transwell results and statistical graphs after ginkgo biloba treatment, proving its invasive ability, the scale bar is 100μm; E, 3D culture confirms that ginkgo biloba inhibits the cloning and invasion ability of osteosarcoma cell lines, the scale bar is 100μm, the right picture is a 3D cell viability detection statistical graph, *P<0.05, ***P<0.001, ****P<0.0001; F, Cleaved-PARP (C-PARP) is an apoptosis protein, and ginkgo biloba treatment promotes apoptosis of osteosarcoma cell lines; G, is a flow cytometry statistical graph of apoptosis induced after ginkgo biloba treatment , ***P<0.001; H, Picture of reversal of cell apoptosis after 48h treatment with ginkgo biloba (G) combined with apoptosis inhibitor Z-VAD-FMK (Z), **P<0.01, scale bar 100μm,; I, Statistical results of reversal of cell apoptosis after 48h treatment with ginkgo biloba (G) combined with apoptosis inhibitor Z-VAD-FMK (Z); J, WB results of apoptosis protein reversal of cell apoptosis after 48h treatment with ginkgo biloba (G) combined with apoptosis inhibitor Z-VAD-FMK (Z), ****P<0.0001; K WB statistical results of apoptosis protein reversal of cell apoptosis after 48h treatment with combined apoptosis inhibitor Z-VAD-FMK (Z).

[0015] Figure 5The figure shows the regulation of GRP78-induced endoplasmic reticulum stress by ginkgo in the present invention. A, volcano map of gene differences detected by RNA-seq after 36 hours of ginkgo treatment; B, heat map of gene differences detected by RNA-seq after 36 hours of ginkgo treatment; C, KEGG analysis results of RNA-seq data; D, GO analysis results of RNA-seq data; E, expression of endoplasmic reticulum stress-related proteins in various osteosarcoma cell lines treated with ginkgo at different concentrations for 24 hours.

[0016] Figure 6 It shows that ginkgo biloba induces endoplasmic reticulum response and induces autophagy in the present invention. A, WB experiment confirms that ginkgo biloba induces autophagy, and the autophagic flow is smooth; B, after ginkgo biloba pretreatment for 36 hours, combined with autophagy inhibitor chloroquine (chloroquine, CQ) for 12 hours, WB confirms that ginkgo biloba induces autophagy; C, after ginkgo biloba pretreatment of 143B cells for 36 hours, combined with autophagy inhibitor chloroquine (chloroquine, CQ) for 12 hours, the killing effect of tumor cells is weakened, ***P<0.001, scale bar 100μm, the right picture is a statistical chart of cell number; D, after ginkgo biloba and chloroquine are combined to treat HOS cells, the picture of reversing the autophagic pathway to kill tumor cells, ***P<0.001, scale bar 100μm, the right picture is a statistical chart of cell number.

[0017] Figure 7 The results show that ginkgo biloba inhibits the development of osteosarcoma in vivo. A, schematic diagram of tibial orthotopic model; B, tibial tumor weight, ***P<0.001; C, number of lung metastases in tibial orthotopic model, ***P<0.001; D, HE staining results of lung metastases in tibial orthotopic model, scale bar is 100μm; E, schematic diagram of patient xenograft model (PDX); F, schematic diagram of PDX tumor size; G, schematic diagram of PDX tumor weight, ***P<0.001; H, PDX tumor proliferation curve, **P<0.01, ***P<0.001.

[0018] Figure 8 The figure shows that ginkgo biloba in the present invention inhibits the development of other tumor cells. A, CCK8 experiment confirmed that ginkgo biloba inhibited the growth of different types of tumor cells after 48 hours of treatment; B, plate cloning experiment confirmed that ginkgo biloba inhibited the formation of different types of tumor cell clones, and the bar graph was a statistical analysis of the number of cells; C, Transwell experiment confirmed that ginkgo biloba inhibited the migration ability of different types of tumor cells, the scale bar is 100μm, and the bar graph was a statistical analysis of the number of cells. D, the results of protein imprint detection of apoptosis and autophagy markers after ginkgo biloba treated different tumor cells. DETAILED DESCRIPTION

[0019] The present invention provides use of ginkgo biloba or a pharmaceutically acceptable salt thereof in preparing a GRP78 protein inhibitor.

[0020] In some embodiments, the ginkgolide has the structure of formula (I):

[0021]

[0022] In some specific embodiments, the amino acid sequence of the GRP78 protein is as shown in SEQ ID No.1.

[0023] The "pharmaceutically acceptable salt" refers to an acid addition salt or a base addition salt. All compounds of the present invention that exist in the form of free base or free acid can be converted into their pharmaceutically acceptable salts by treatment with appropriate inorganic or organic bases or acids according to methods known to those skilled in the art. Salts of compounds of the present invention can be converted into their free bases or acids by standard techniques.

[0024] In the present invention, pharmaceutically acceptable salts of ginkgo biloba include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are salts with amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods such as ion exchange used in the art. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, citrate, dodecylsulfate, ethanesulfonate, formate, fumarate, gluconate heptanoate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. Salts derived from suitable bases include alkali metal salts, alkaline earth metal salts, ammonium salts. Representative alkali metal salts or alkaline earth metal salts include sodium salts, lithium salts, potassium salts, calcium salts, magnesium salts, etc. Where appropriate, other pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, sulfonates and aryl sulfonates. Other pharmaceutically acceptable salts include salts formed by quaternization of amines, which are carried out using suitable electrophilic reagents (e.g., alkyl halides) to form quaternized alkylated amino salts.

[0025] In the present invention, the GRP78 protein inhibitor necessarily contains ginkgo biloba or a pharmaceutically acceptable salt thereof, and ginkgo biloba or a pharmaceutically acceptable salt thereof is used as an effective ingredient for inhibiting the activity of the GRP78 protein.

[0026] In the present invention, the effective ingredient in the GRP78 protein inhibitor that inhibits the activity of GRP78 protein may be only ginkgo biloba, or may contain other chemicals that can play a similar role.

[0027] In the present invention, the GRP78 protein inhibitor may be a single-component substance or a multi-component substance.

[0028] In the present invention, the GRP78 protein inhibitor is a substance that inhibits the ATPase activity of the GRP78 protein.

[0029] The present invention also provides the use of ginkgo biloba or a pharmaceutically acceptable salt thereof in preparing a product for treating endoplasmic reticulum stress-related diseases, wherein the endoplasmic reticulum stress-related diseases are caused by abnormal function of the GRP78 protein.

[0030] In some specific embodiments, the endoplasmic reticulum stress-related diseases include tumors, inflammatory diseases, metabolic diseases, osteoporosis, neurodegenerative diseases, respiratory system, cardiovascular diseases, and brain damage.

[0031] Furthermore, the tumor is selected from one or more of osteosarcoma, liver cancer, pancreatic cancer, gastric cancer, intestinal cancer or cervical cancer. Preferably, the tumor is osteosarcoma.

[0032] In some specific embodiments, the product for treating endoplasmic reticulum stress-related diseases further contains a pharmaceutically acceptable carrier or excipient.

[0033] "Pharmaceutically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic or other untoward reactions when appropriately administered to an animal or a human.

[0034] "Pharmaceutically acceptable carriers or excipients" should be compatible with the active ingredient, that is, they can be mixed with it without significantly reducing the effect of the drug under normal circumstances. Specific examples of some substances that can be used as pharmaceutically acceptable carriers or excipients are sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium methylcellulose, ethyl cellulose and methyl cellulose; tragacanth powder; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyols, such as propylene glycol, glycerol, sorbitol, mannitol and polyethylene glycol; alginic acid; emulsifiers, such as Tween; wetting agents, such as sodium lauryl sulfate; colorants; flavorings; tablets, stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic saline solution; and phosphate buffer, etc. These materials are used as needed to aid in the stability of the formulation or to help increase the activity or its bioavailability or to produce an acceptable taste or flavor in the case of oral administration.

[0035] The composition may be a pharmaceutical composition.

[0036] When the composition is used to prevent or treat osteosarcoma in a subject, an effective dose of the composition needs to be administered to the subject. Using this method, the growth, proliferation, recurrence and / or metastasis of the osteosarcoma is inhibited. Further, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% of the growth, proliferation, recurrence and / or metastasis of the osteosarcoma is inhibited.

[0037] The form of the composition is not particularly limited, and can be in various forms such as solid, liquid, gel, semi-fluid, aerosol, etc.

[0038] The composition is mainly targeted at mammals. The mammals are preferably rodents, even-toed ungulates, perissodactyls, lagomorphs, primates, etc. The primates are preferably monkeys, apes or humans.

[0039] The present invention also provides the use of ginkgo biloba or a pharmaceutically acceptable salt thereof in preparing a product for promoting cell autophagy.

[0040] In some embodiments, the cell is an animal cell. Preferably, the animal cell is a tumor cell. More preferably, the tumor cell is selected from one or more of 143B cells, HOS cells, HCT8 cells, HepG2 cells, Hela cells, SW1990 cells or SGC7901 cells.

[0041] In the present invention, the term "autophagy" is an intracellular degradation mechanism that forms a double-membrane structure of autophagosomes to encapsulate damaged organelles, protein aggregates or excess cellular components in the cell and transport them to lysosomes for degradation and recycling.

[0042] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0043] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0044] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0045] SEQ ID No.1

[0046] mklslvaaml lllsaaraee edkkedvgtv vgidlgttys cvgvfkngrv eiiandqgnritpsyvaftp egerligdaa knqltsnpen tvfdakrlig rtwndpsvqq dikflpfkvv ekktkpyiqvdigggqtktf apeeisamvl tkmketaeay lgkkvthavv tvpayfndaq rqatkdagti aglnvmriineptaaaiayg ldkregekni lvfdlgggtf dvslltidng vfevvatngd thlggedfdq rvmehfiklykkktgkdvrk dnravqklrr evekakalss qhqarieies fyegedfset ltrakfeeln mdlfrstmkpvqkvledsdl kksdideivl vggstripki qqlvkeffng kepsrginpd eavaygaavq agvlsgdqdtgdlvllhvcp ltlgietvgg vmtklipsnt vvptknsqif stasdnqptv tikvyegerp ltkdnhllgtfdltgippap rgvpqievtf eidvngilrv taedkgtgnk nkititndqn rltpeeierm vndaekfaeedkklkeridt rnelesyays lknqigdkek lggklssedk etmekaveek iewleshqda diedfkakkkeleeivqpii sklygsagpp ptgeedtaek del

[0047] Example 1: GRP78 is highly expressed in osteosarcoma tissues.

[0048] Using existing tissue microarrays, the expression of GRP78 in osteosarcoma tissues was evaluated by immunohistochemical staining and GraphPad Prism 10.1.2 software, and the results were photographed using a Leica microscope. First, the tissue microarray was baked at 60°C for 30 minutes. After dewaxing and rehydration, the antigen was repaired with sodium citrate at 100°C for 40 minutes. After cooling to room temperature, the sections were blocked with hydrogen peroxide to remove peroxidase, and then blocked with blocking solution. The sections were incubated with anti-GRP78 antibodies at 4°C overnight and with the secondary antibody for 1 hour. After DAB treatment, the sections were counterstained with hematoxylin, and finally dehydrated, fixed, and photographed.

[0049] Experimental results:

[0050] IHC staining revealed that GRP78 is generally highly expressed in osteosarcoma clinical samples ( Figure 1 A), therefore, it can be considered that GRP78 can be used as an important marker protein for the development of osteosarcoma.

[0051] Example 2: Screening out the drug ginkgo biloba targeting GRP78 from a natural compound library.

[0052] Experimental methods:

[0053] 1. Cell proliferation assay (CCK8) Osteosarcoma cell lines were seeded into 96-well plates (3×10 3 ), and drug treatment was added 24 hours later. After 48 hours, 100 μL of CCK8 was added to each well, incubated in a 37°C incubator for 1 hour, and the absorbance was measured at 450 nm.

[0054] 2. Thermal shift assay (CETSA) Cells were treated with a certain concentration of drugs for 4 h, washed with PBS, and suspended in 1 mL PBS (containing a mixture of protease and phosphatase inhibitors) and then divided into five PCR tubes. Heat at the indicated temperature for 3 minutes and then immediately cool on ice. Cells were lysed by three cycles of freezing (in liquid nitrogen)-thawing (in a 25°C water bath). Cell lysates were centrifuged at 12,000 rpm for 20 minutes, 4°C. Soluble supernatants were analyzed by gel electrophoresis Western blotting.

[0055] The above experimental results are as follows:

[0056] Natural compounds have incomparable advantages in treating cancer. In this example, a drug with a strong killing effect on osteosarcoma was found from a library of 167 natural compounds. First, 33 compounds that can inhibit the proliferation of osteosarcoma were found through CCK8 ( Figure 2A, Table 1). GRP78 plays an important role in various aspects of tumor development and is highly expressed in osteosarcoma. Among the above compounds that have a certain inhibitory effect on osteosarcoma, drugs that can directly bind to GRP78 ( Figure 2 A). Thermal shift experiments are used to detect the targeting of drugs in cells. As the temperature increases, the thermal stability can be characterized by monitoring the soluble protein content after heating and analyzing its melting curve, while the binding of drug molecules to target proteins will change its thermal stability. The optimal degradation temperature of GRP78 was determined to be 55°C ( Figure 2 B). The 33 compounds were screened at 55°C ( Figure 2 C), through thermal displacement experiment and grayscale analysis statistics ( Figure 2 D), suggesting that ginkgo biloba has a certain binding ability with GRP78 protein ( Figure 2 E and 2F), Figure 2 F is the grayscale statistical result graph of 2E. Figure 2 G is the molecular structure formula of the compound ginkgolide. Therefore, in this example, the drug ginkgolide targeting GRP78 was screened from the natural compound library.

[0057] Table 1

[0058]

[0059]

[0060] Example 3: Ginkgo biloba binds to GRP78 and inhibits its ATPase activity.

[0061] Experimental methods:

[0062] 1. Surface Plasmon Resonance Surface Plasmon Resonance is a protein-molecule interaction technique that fixes the ligand protein on the surface of a chip containing a gold film, and then passes different concentrations of analytes on the chip surface. It detects the real-time change in the refractive index near the gold film caused by the binding / dissociation of molecules to identify whether the analyte binds to the ligand and the strength of the binding force. It can directly prove the binding of small molecules and proteins. SPR has now become a powerful tool for drug screening and is used in new drug discovery. It can quickly determine the affinity between molecules.

[0063] 2. Molecular docking First, the three-dimensional structures of GRP78 and ginkgo biloba were calculated by simulation, and then the small molecule was "docked" to the appropriate position of the protein, and the interaction energy between them was calculated. The small molecule was used as the "ligand" and the protein was used as the "receptor". The interaction force field between them was calculated to optimize their relative position and conformation, so as to find the optimal ligand-receptor binding mode, and several residues of GRP78 were screened out that may have a certain binding ability with ginkgo biloba.

[0064] 3. ATPase activity experiment uses ADP-GloTM Kinase Assay kit (Promega, V6930). Prepare the reagent mixture according to the kit instructions and add it to a 96-well white plate. Add 2μg purified His-GRP78 recombinant protein (full length) to the reagent. Incubate the reactants with ginkgo biloba at 37°C for 30 minutes, then add 2μM ATP and incubate for another 2 hours. Finally, read the luminescence value.

[0065] 4. Molecular dynamics simulations Molecular dynamics (MD) simulations were performed using Gromacs version 2023.2. The Ginkgetin–GRP78 complex was used as the initial conformation, derived from the molecular docking results, for MD simulations. All titratable residues of GRP78 were kept in their primary state at pH 7.4. The complex was dissolved in explicit TIP3P water molecules containing 0.15 M NaCl, ensuring that the minimum distance between protein atoms and the edge of the solvent box was Proteins and salt ions were simulated using the ff14SB force field. The parameters of Ginkgetin were generated using Sobtop 1.0 (dev5) based on the generalized AMBER force field (GAFF). The partial charges of Ginkgetin were obtained using the restricted electrostatic potential (RESP) method and calculated in Multiwfn 3.8 (dev) based on a gas-phase energy-minimized structure optimized at the B97-3c level in ORCA 6.0.1.

[0066] The system was first relaxed using the conjugate gradient energy minimization method without constraints, and then the system was slowly heated to 300 K with constraints applied. The constraints were gradually reduced over 5 ns. Finally, an unconstrained productive simulation run was performed with a time step of 2 fs in the NPT cluster, with the temperature at 300 K and the pressure at 1 bar, controlled using the v-rescale9 thermostat and the c-rescale pressure regulator, respectively. The van der Waals and short-range Coulomb interactions were The long-range Coulomb interaction is calculated using the particle mesh Ewald (PME) method with a real-space cutoff distance of All bonds involving hydrogen atoms were constrained using the LINCS algorithm, and the internal degrees of freedom of water molecules were constrained using the SETTLE algorithm. The same simulation procedure was also used for the MD simulations of apo GRP78.

[0067] 5. Thermal shift experiment The key residues LYS-296, ARG-297 and ARG-60 of the Docking simulation screening ginkgo biloba that may bind to GRP78 were mutated into alanine. After the mutant plasmid was transferred into the cells, the amino acid site where ginkgo biloba binds to GRP78 was identified using the above-mentioned thermal shift method.

[0068] LYS-296A primer sequence, forward: 5'GGTAGAAAAGGCCGCACGGGCCCTGTC 3'; reverse: 5'GACAGGGCCCGTGCGGCCTTTTCTACC 3'

[0069] Primer sequence for ARG-297A, forward: 5'GTAGAAAAGGCCAAAGCGGCCCTGTCTTCTC 3'; reverse: 5'GAGAAGACAGGGCCGCTTTGGCCTTTTCTAC 3'

[0070] ARG-60A primer sequences,

[0071] Forward: 5′CAACGATCAGGGCAACGCCATCACGCCGTCCTATG 3′;

[0072] Reverse: 5'CATAGGACGGCGTGATGGCGTTGCCCTGATCGTTG 3'

[0073] The above experimental results are as follows:

[0074] In order to further verify the binding of ginkgo biloba to GRP78 protein, this example conducted a surface plasmon resonance experiment. In this example, the GRP78 protein was fixed on the chip, and then ginkgo biloba with a concentration gradient was passed through it. It was found that the change in the detection signal value was caused in a concentration gradient-dependent manner, thus proving that ginkgo biloba can directly bind to GRP78, and the affinity constant KD can reach 2.47e -7 M( Figure 3 A). In addition, in this example, molecular docking software is used to quickly evaluate the binding affinity of candidate molecules with target sites through computational simulation, which is used for early stage virtual screening of drugs and to find potential active molecules in large-scale molecular libraries. Ginkgo biloba and GRP78 were docked and calculated, and several key residues LYS-296, ARG-297 and ARG-60 ( Figure 3 B), these residues are all near the ATP pocket. At the same time, this example is more concerned with the effect of the combination of the two on the function of the GRP78 protein. The ATPase domain has a very important influence on its catalytic activity. Through ATPase activity detection, it was found that ginkgo biloba can inhibit the ATPase activity of GRP78 in a concentration-dependent manner ( Figure 3 C). In order to verify the stability of the ginkgo biloba-binding complex, a 100 nanosecond molecular dynamics (MD) simulation was performed in this example. The root mean square deviation (RMSD) analysis of the protein backbone showed that ( Figure 3 D), compared with the apo GRP78 system, the RMSD value of the ginkgetin-GRP78 complex is significantly lower and more stable, indicating that the binding of ginkgetin to GRP78 stabilizes the conformation of the protein. In addition, in order to further determine the key residues for the interaction between ginkgetin and GRP78, the three key residues predicted by Docking above were mutated to alanine in this example. The thermal shift experiment confirmed that the mutation of the LYS-296 site can eliminate the interaction between ginkgetin and GRP78, indicating that ginkgetin interacts with the LYS-296 residue of GRP78 ( Figure 3 E-3I). In summary, ginkgo biloba interacts with the LYS-296 site of GRP78, thereby affecting its ATPase activity and its thermal stability.

[0075] Example 4: Ginkgo biloba inhibits the proliferation and invasion of osteosarcoma cells and promotes their apoptosis.

[0076] Experimental methods:

[0077] 1. Cell proliferation assay (CCK8) Osteosarcoma cell lines were seeded into 96-well plates (3×10 3 ), and drug treatment was added 24 hours later. After 48 hours, 100 μL of CCK8 was added to each well, incubated in a 37°C incubator for 1 hour, and the absorbance was measured at 450 nm.

[0078] 2. Colony formation Cells seeded in 6-well plates were treated with indicated concentrations of ginkgo biloba and then cultured in DMEM containing 10% FBS. After 7 days, the cell colonies were stained with crystal violet for 10 minutes and quantified.

[0079] 3. Calcein AM / PI staining experiment Osteosarcoma cell lines were inoculated in 24-well plates, and different concentrations of ginkgo were added overnight. After treatment for 48 hours, the cells were stained using the Calcein AM / PI kit and photographed under an inverted microscope (Olympus).

[0080] 4. Invasion assay Transwell membranes were coated with Matrigel and placed in a 37°C incubator for 40 minutes. Cells (5×104 cells / well) were resuspended in culture medium with a specified concentration of ginkgo biloba and added to the Transwell insert. DMEM containing 10% FBS was added to the bottom compartment. 12 h after inoculation, cells invading the membrane were fixed with paraformaldehyde and stained with crystal violet for 10 minutes. After drying, the stained cells were counted under an inverted microscope (Olympus).

[0081] 5.3D Experiment Matrigel was coated in a 48-well plate and placed in a 37°C incubator for 30 minutes. Cells (18,000 cells / well / 200 μL) were added to the wells and incubated at 37°C for 1 hour. After 1 hour, the liquid was aspirated, and 10% Matrigel / well / 300 μL containing different concentrations of ginkgo biloba was prepared and added to the wells, placed in a 37°C incubator for 72 hours, and finally photographed under an inverted microscope (Olympus). The cell viability was detected by 3D cell viability assay (Promega, G9683) kit.

[0082] 6. Western blots The cells collected after drug treatment were lysed in protein lysis buffer for 30 minutes, and then the protein concentration in the lysate was quantified. SDS-PAGE loading buffer was added, and 10% SDS-PAGE gel was used to separate the proteins in the lysate and electrophoretically transferred to a PVDF membrane. The PVDF membrane was blocked with 5% milk at room temperature for 1h, incubated with the indicated primary antibody overnight at 4°C, and then washed three times with PBST. Then, the membrane was incubated with the corresponding secondary antibody. Protein bands were displayed using a Western blot detection system.

[0083] 7. Flow cytometry apoptosis assay Annexin V apoptosis detection kit FITC was used to determine cell apoptosis. The cells were digested with trypsin, centrifuged, and washed with PBS. Next, the cells were resuspended in 1× binding buffer and then incubated with annexin V and propidium iodide (PI) for 30 minutes, after which the number of apoptotic cells was determined by flow cytometry.

[0084] The above experimental results are as follows:

[0085] In order to further explore the inhibitory effect of ginkgo on osteosarcoma, this example conducted a functional experiment to verify the effect of ginkgo on osteosarcoma, and found that ginkgo can inhibit the proliferation of various osteosarcoma cells ( Figure 4 A), while inhibiting the clonal formation of osteosarcoma cells ( Figure 4 B) Inducing cell death ( Figure 4 C) and inhibit its invasive ability ( Figure 4D). 3D experiments further demonstrated that ginkgo biloba inhibited the cloning and invasion ability of osteosarcoma cell lines ( Figure 4 E). In addition, this example found that ginkgo biloba can promote apoptosis of osteosarcoma cell lines ( Figure 4 F-4K). These results indicate that ginkgo biloba can indeed inhibit the proliferation and invasion of osteosarcoma cells and promote their apoptosis.

[0086] Example 5: Ginkgo biloba regulates GRP78 to induce endoplasmic reticulum stress.

[0087] Experimental methods:

[0088] 1. RNA-seq (1) Total RNA was extracted using TRIzol reagent according to the instructions. The purity and concentration of RNA were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA), and the integrity of RNA was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). The transcriptome library was constructed using the VAHTS Universal V6 RNA-seq Library Prep Kit according to the instructions. Transcriptome sequencing and data analysis were performed by Shanghai Ouyi Biotechnology Co., Ltd. (Shanghai, China). (2) RNA sequencing and differentially expressed gene analysis The library was sequenced using the Illumina NovaSeq 6000 platform to generate 150 bp paired-end reads, with approximately 40 raw reads obtained for each sample. First, the raw reads in FASTQ format were quality controlled using fastp software to remove low-quality reads and obtain clean reads for subsequent analysis. Next, the clean reads were aligned to the reference genome using HISAT2 software, and the expression of each gene (FPKM) was calculated. Meanwhile, the read counts of each gene were obtained by HTSeq-count. The gene count data were subjected to principal component analysis (PCA) and visualization using R (version 3.2.0) to evaluate the biological repeatability of the samples. Differentially expressed genes (DEGs) analysis was performed using DESeq2 software, and genes with q values ​​< 0.05 and fold changes > 1.5 or < 0.5 were defined as significantly differentially expressed genes. Hierarchical clustering analysis was performed on the differentially expressed genes to show the gene expression patterns in different groups and samples. The radar charts of the top 30 up- and down-regulated genes were drawn using the R package ggradar to intuitively display their expression changes. Finally, GO and KEGG pathway enrichment analysis was performed on the differentially expressed genes using an algorithm based on hypergeometric distribution to screen out significantly enriched functional entries.

[0089] 2. Western blots The cells collected after 24h of drug treatment were lysed in protein lysis buffer for 30 minutes, and then the protein concentration in the lysate was quantified. SDS-PAGE loading buffer was added, and 10% SDS-PAGE gel was used to separate the proteins in the lysate and electrophoretically transferred to a PVDF membrane. The PVDF membrane was blocked with 5% milk for 1h at room temperature, incubated with the indicated primary antibody overnight at 4°C, and then washed three times with PBST. Then, the membrane was incubated with the corresponding secondary antibody. Protein bands were displayed using a Western blot detection system.

[0090] The above experimental results are as follows:

[0091] In order to reveal the molecular mechanism of ginkgo biloba, RNA-seq was performed in this example, and it was found that many genes changed after the osteosarcoma cell line was treated with ginkgo biloba ( Figure 5 A and 5B). ER stress is closely related to the occurrence and development of osteosarcoma, and targeting GRP78 can induce ER stress. The data in the above examples prove that ginkgo biloba can directly target GRP78, so this example explores the ER stress in osteosarcoma cell lines after ginkgo biloba treatment. In order to find the pathways that are significantly enriched after ginkgo biloba treatment, KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis was performed, and it was found that the ER protein processing, apoptosis and autophagy pathways were significantly enriched ( Figure 5 C). GO (Gene Ontology) analysis of RNA-seq data revealed that after ginkgo biloba treatment, cell activities were closely related to biological functions such as protein folding, endoplasmic reticulum unfolded protein response, and endoplasmic reticulum stress ( Figure 5 D). To further confirm that ginkgo biloba induces ER stress, Western blotting was used to find that the expression of marker proteins of ER stress was upregulated after ginkgo biloba treatment ( Figure 5 E) These results suggest that ginkgo biloba can induce ER stress.

[0092] Example 6: Ginkgo biloba induces autophagy.

[0093] Experimental methods:

[0094] 1.Western blots The cells collected after drug treatment were lysed in protein lysis buffer for 30 minutes, and then the protein concentration in the lysate was quantified. SDS-PAGE loading buffer was added, and 10% SDS-PAGE gel was used to separate the proteins in the lysate and electrophoretically transferred to a PVDF membrane. The PVDF membrane was blocked with 5% milk for 1h at room temperature, incubated with the indicated primary antibody overnight at 4°C, and then washed three times with PBST. Then, the membrane was incubated with the corresponding secondary antibody. Protein bands were displayed using a Western blot detection system.

[0095] 2. After the cells were treated with ginkgo biloba for 36 hours, they were treated with chloroquine (CQ) for 12 hours, washed twice with PBS, fixed with 4% paraformaldehyde, and photographed with a confocal microscope.

[0096] Experimental results:

[0097] RNA-seq results revealed that ginkgo biloba activates the autophagy pathway ( Figure 5 C), to further verify that the autophagy pathway was activated, autophagy markers were detected by Western blotting, and it was found that LC3B-II was upregulated and promoted the degradation of P62 ( Figure 6 A), indicating that autophagy occurred and the autophagic flow was smooth. After the autophagy inhibitor chloroquine was combined with ginkgo biloba, P62 expression was restored ( Figure 6 B). In addition, the autophagy inhibitor chloroquine can reverse the tumor-killing effect of ginkgo biloba-induced autophagy ( Figure 6 C and 6D). Taken together, these results indicate that ginkgo biloba induces autophagy.

[0098] Example 7: Ginkgo biloba inhibits the development of osteosarcoma in vivo.

[0099] Experimental methods:

[0100] 1. Tibia in situ model: 4-week-old female nude mice were injected with 1×10 6 143B osteosarcoma cells. One week later, different concentrations of ginkgo biloba were intraperitoneally injected every two days. After 29 days, the mice were killed and the tumors and lungs were removed. The tumor tissues were weighed and the lung tissues were stained with HE to detect lung metastasis.

[0101] 2. HE staining: Fresh tissues were fixed in formalin overnight, dehydrated in graded alcohol and xylene, fixed in paraffin and cut into 4-micron slices, dewaxed in xylene, and hydrated in graded alcohol. Placed in Hematoxylin dye solution, stained for about 5-10 minutes, differentiated in differentiation solution for 3 seconds, rinsed in running water for about 30 minutes, placed in 1% Eosin solution, stained for 3-5 minutes, rinsed in running water to make the slices pink, dehydrated in graded alcohol and xylene, sealed with neutral resin, and finally photographed under a microscope.

[0102] 3. Patient-derived xenograft model (PDX) 4-week-old female nude mice were taken, and the patient-derived osteosarcoma tissue was minced and inoculated subcutaneously into the nude mice. After one week, the PDX began to grow, and the ginkgo compound was injected intraperitoneally once every two days, and the tumor volume was measured with a vernier caliper. After 29 days, the mice were killed and the tumor tissue was taken. The tumor tissue was weighed, immunohistochemically and WB were used to detect the corresponding indicators.

[0103] The above experimental results are as follows:

[0104] In order to confirm that ginkgo biloba inhibits the development of osteosarcoma in mice, this example established an orthotopic tibial model and intraperitoneally administered ginkgo biloba for one month ( Figure 7 A) found that osteosarcoma tissue growth and lung metastasis ability were significantly inhibited ( Figure 7 In order to further simulate the clinical treatment effect, this example also constructed a PDX model and intraperitoneally administered ginkgo biloba for one month ( Figure 7 E), and found that the therapeutic effect was similar to the results of the tibia in situ, and the growth ability of tumor tissue was significantly inhibited ( Figure 7 F-7H). In summary, these results indicate that ginkgo biloba inhibits the development of osteosarcoma tissue, which is consistent with the in vitro results.

[0105] Example 8: Ginkgo biloba inhibits the development of other tumors.

[0106] 1. Cell proliferation assay (CCK8) Inoculate other tumor cell lines into 96-well plates (3×10 3 ), and drug treatment was added 24 hours later. After 48 hours, 100 μL of CCK8 was added to each well, incubated in a 37°C incubator for 1 hour, and the absorbance was measured at 450 nm.

[0107] 2. Colony formation Other tumor cells seeded in 6-well plates were treated with indicated concentrations of ginkgo biloba and then cultured in DMEM containing 10% FBS. After 7 days, the cell colonies were stained with crystal violet for 10 minutes and quantified.

[0108] 3. Migration experiment: other tumor cells (5×10 4Cells / well) were resuspended in serum-free medium with a specified concentration of ginkgo biloba and added to the top of the Transwell chamber. DMEM containing 10% FBS was added to the bottom compartment. 12 h after inoculation, cells that invaded the membrane were fixed with paraformaldehyde and stained with crystal violet for 10 minutes. After drying, the stained cells were counted under an inverted microscope (Olympus).

[0109] 4. Western blot experiment: Different tumor cells were treated with ginkgo biloba, and the samples were subjected to BCA quantification, electrophoresis, electrotransfer, incubation with corresponding primary antibodies, secondary antibodies and development.

[0110] The above experimental results are as follows:

[0111] In order to explore the inhibitory effect of ginkgo on the proliferation of other tumor cells, we selected ileocecal cancer (HCT8), cervical cancer (Hela), gastric cancer (SGC7901), pancreatic cancer (SW1990) and liver cancer (HepG2) cell lines for ginkgo treatment and found that ginkgo significantly inhibited the proliferation of these tumor cell lines ( Figure 8 A). In addition, ginkgo biloba significantly inhibited the colony formation of these tumor cells ( Figure 8 B) and migration ability ( Figure 8 C). Western blotting technology further confirmed that ginkgo biloba can also induce apoptosis and autophagy in different cancer cells ( Figure 8 D) These results suggest that ginkgo biloba may inhibit the development of other tumors in the same manner.

[0112] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and the variations of the methods in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of the present invention.

Claims

1. Use of ginkgo biloba or a pharmaceutically acceptable salt thereof in the preparation of a GRP78 protein inhibitor.

2. The use according to claim 1, characterized in that The ginkgo biloba has a structure of formula (I):

3. The use according to claim 1, characterized in that The amino acid sequence of the GRP78 protein is shown in SEQ ID No.

1.

4. The use according to claim 1, characterized in that The GRP78 protein inhibitor is a substance that inhibits the ATPase activity of the GRP78 protein.

5. Use of ginkgo biloba or a pharmaceutically acceptable salt thereof in the preparation of a product for treating endoplasmic reticulum stress-related diseases, wherein the endoplasmic reticulum stress-related diseases are caused by abnormal function of the GRP78 protein.

6. The use according to claim 5, characterized in that The endoplasmic reticulum stress-related diseases include tumors, inflammatory diseases, metabolic diseases, osteoporosis, neurodegenerative diseases, respiratory system, cardiovascular diseases, and brain damage.

7. The use according to claim 6, characterized in that The tumor is selected from one or more of osteosarcoma, liver cancer, pancreatic cancer, gastric cancer, intestinal cancer or cervical cancer; preferably, the tumor is osteosarcoma.

8. The use according to claim 5, characterized in that The endoplasmic reticulum stress-related disease treatment product further contains a pharmaceutically acceptable carrier or excipient.

9. Use of ginkgo biloba or a pharmaceutically acceptable salt thereof in the preparation of a product for promoting cell autophagy.

10. The use according to claim 9, characterized in that The cells are animal cells; preferably, the animal cells are tumor cells; more preferably, the tumor cells are selected from one or more of 143B cells, HOS cells, HCT8 cells, HepG2 cells, Hela cells, SW1990 cells or SGC7901 cells.

Images