Sphingomonas paucimobilis recombinant engineering bacterium as well as construction method and application thereof

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to sphingomonas paucimobilis recombinant engineering bacteria as well as a construction method and application thereof. The engineering strain is obtained by knocking out a metabolic bypass gene from sphingomonas paucimobilis, and the metabolic bypass gene is composed of a crtI gene or a phaC gene. The production amount of gellan gum can be increased by the delta phaC knockout strain and reaches 8.9 g / L. In addition, overexpression of energy metabolism related genes pgi or clpB or ycaJ is carried out, and the yield of a strain with the overexpressed pgi gene is increased to the maximum and reaches 9.5 g / L. Therefore, the pgi gene is overexpressed on the basis of the delta phaC knockout strain, the yield of gellan gum is further increased to 10.0 g / L, and the production efficiency is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and specifically relates to a recombinant engineering bacterium of Sphingomonas paucimobilis and a construction method and application thereof. Background Art

[0002] Gellan gum is a microbial extracellular polysaccharide composed of four monosaccharide molecules connected by glycosidic bonds and composed of repeating sugar units. The four monosaccharides are two β-1,3-D-glucose, β-1,4-D-glucuronic acid and α-1,4-L-rhamnose, and have a parallel semi-staggered double helix high-level structure. Due to its unique structure and excellent physical properties, gellan gum is widely used in food, pharmaceutical and other industries for stabilization, emulsification, thickening and suspension.

[0003] Gellan gum can be divided into two forms in terms of structure: one is high acetyl gellan gum (natural gellan gum), and the other is low acetyl gellan gum (deacylated gellan gum). Generally speaking, high acetyl gellan gum is soft, has good adhesion and elasticity, while low acetyl gellan gum is firm and brittle. + It is unstable under certain conditions and is easily hydrolyzed, so most of the industry uses the more stable low-acyl gellan gum. Its production method is that Sphingomonas paucimobilis uses natural carbohydrates to ferment inside the cell and then secrete them outside the cell. The yield of natural microbial production and fermentation is low, which is difficult to meet people's demand for new microbial polysaccharides.

[0004] With the in-depth understanding of the physiology of Sphingomonas paucimobilis and the biosynthetic pathway of gellan gum, it is currently an effective way to increase the production of gellan gum through genetic engineering and metabolic engineering. However, Sphingomonas paucimobilis is a non-model strain, and conventional gene editing tools have problems such as low efficiency and long cycle. How to find a more efficient gene editing method is the key to increasing the production of gellan gum. Summary of the invention

[0005] The present invention achieves the knockout of crtI and phaC genes by constructing a CRISPR-cpf1 knockout system, optimizes the promoter of the expression vector, and overexpresses energy metabolism-related genes pgi, clpB, ycaJ, etc., to construct a recombinant Sphingomonas bacterium, thereby achieving an increase in the yield of gellan gum.

[0006] In order to achieve the above object, the present invention can adopt the following technical solutions:

[0007] On one hand, the present invention provides a recombinant engineered bacterium of Sphingomonas paucimobilis, which is obtained by knocking out a metabolic bypass gene from Sphingomonas paucimobilis, wherein the metabolic bypass gene is a crtI gene and / or a phaC gene.

[0008] Preferably, the above-mentioned Sphingomonas paucimobilis recombinant engineered bacteria further comprises a plasmid for overexpressing energy metabolism related genes, and the energy metabolism related genes are pgi or clpB or ycaJ genes.

[0009] Preferably, the deposit number of the above-mentioned Sphingomonas paucimobilis is ATCC 31461.

[0010] Another aspect of the present invention provides a method for constructing a recombinant engineered bacterium of Sphingomonas paucimobilis of the present invention, comprising: knocking out a metabolic bypass gene of Sphingomonas paucimobilis, wherein the knockout method comprises: (1) designing a gRNA of the crtI or phaC gene, and using a primer pair crtI-gRNA-F / R or phaC-gRNA-F / R to anneal the gRNA to form a single-stranded dsDNA;

[0011] (2) The pcrEG plasmid is digested at the Eco31I site, and then the gRNA replaces the crRNA in pcrEG through T4 ligation to obtain a pcrEG plasmid containing the crtI or phaC gene gRNA; (3) The pcrEG-gRNA plasmid is linearized using the primer pair pcrEG-gRNA-F / R, and the upstream and downstream homologous arms of the crtI or phaC gene are amplified using the primer pair, and the two fragments of the upper and lower homologous arms are connected to obtain a recombinant plasmid; (4) The recombinant plasmid is transferred into Sphingomonas paucimobilis to obtain a crtI or phaC gene knockout strain, namely, a recombinant engineered strain of Sphingomonas paucimobilis.

[0012] Preferably, the primer pair crtI-gRNA-F / R, the primer pair phaC-gRNA-F / R and the primer pair pcrEG-gRNA-F / R are respectively as follows;

[0013] Primer pair crtI-gRNA-F / R:

[0014] F: agatTCGCTCTATCTCCACCACCCCAG,

[0015] R: aattCTGGGGTGGTGGAGATAGAGCGA;

[0016] Primer pair phaC-gRNA-F / R:

[0017] F: agatGTCATCGCCGACCACATGCTCAA,

[0018] R: aattTTGAGCATGTGGTCGGCGATGAC;

[0019] Primer pair PCREG-gRNA-F / R:

[0020] F: ATTACCCTGTTATCCCTACTCG,

[0021] R: GTTAATAAGGCCAAGCTAACTAAG;

[0022] The primer pairs for amplifying the upstream and downstream homology arms of the crtI or phaC gene were crtI-UF / R, crtI-DF / R or phaC-UF / R, phaC-DF / R;

[0023] Primer pair crtI-UF / R:

[0024] F: gttagcttggccttattaacCCTGCGGATCCTCGACGA,

[0025] R:acaccaccgtAGCTGATGCTGGGCGAGTT;

[0026] crtI-DF / R:

[0027] F: agcatcagctACGGTGGTGTCGACCCCC,

[0028] R: agtagggataacagggtaatCTGGTCGTTCTTCGCCGA;

[0029] phaC-UF / R:

[0030] F: gttagcttggccttattaacGCGCCGCCGTTCACGTTC,

[0031] R: cTGGGAGCCGCTTGCGCAC;

[0032] phaC-DF / R:

[0033] F: agtgcgcaagcggctcccaGCGGCGAGGCCCGCCAGC,

[0034] R: agtagggataacagggtaatCAAGAAGGGCGGCACGCT.

[0035] More preferably, in step (4), the Sphingomonas paucimobilis contains a pEcCpf1-N-pBBR plasmid, and the method for constructing the Sphingomonas paucimobilis containing a pEcCpf1-N-pBBR plasmid comprises: (i) using pEcCpf1 as a starting plasmid, performing Sphingomonas codon optimization on the cpf1 protein, linearizing the plasmid using a primer pair pEcCpf1-1F / R, and linearizing the optimized cpf1-N protein using a primer pair cpf1-NF / R. (ii) linearizing plasmid 1 using primer pair pEcCpf1-N-2F / R, replacing the replicon of plasmid 1 with pBBR replicon using primer pair pBBR-F / R to obtain knockout plasmid pEcCpf1-N-pBBR, and transferring the plasmid pEcCpf1-N-pBBR into Sphingomonas paucimobilis to obtain Sphingomonas paucimobilis containing the pEcCpf1-N-pBBR plasmid.

[0036] Preferably, the above-mentioned construction method also includes: transferring the plasmid overexpressing the energy metabolism-related gene into Sphingomonas paucimobilis, and the construction method of the plasmid overexpressing the energy metabolism-related gene includes: (a) based on the pBBR1MCS-2 plasmid, using the primer pair pBBRMCS-2-tac-1F / R and pBBRMCS-2-tac-2F / R to replace the lac promoter and its terminator with the tac promoter and rrnT1 terminator to obtain the reconstructed pBBR1MCS-2-N plasmid; using the whole genome DNA of Sphingomonas paucimobilis as a template, using the primer pair pgi-F / R or clpB-F / R or ycaJ-F / R to amplify the gene pgi or clpB or ycaJ to obtain the amplified gene fragment; (b) using the restriction enzymes BamHI and SalI to double-digest the plasmid pBBR1MCS-2-N, assembling the double-digested plasmid with the amplified gene fragment to obtain a plasmid overexpressing the energy metabolism-related gene.

[0037] In another aspect, the present invention provides a method for preparing gellan gum, characterized in that it comprises: preparing the gellan gum by fermentation with the recombinant engineered bacteria of Sphingomonas paucimobilis of the present invention.

[0038] Preferably, the above fermentation includes: picking a single bacterium of Sphingomonas paucimobilis from a solid plate to a seed culture medium for cultivation, and then inoculating the seed liquid into a fermentation culture medium for cultivation, wherein the fermentation culture medium includes 30 g of glucose, 3 g of yeast extract, 2 g of peptone, 1 g of K2HPO4, 3 g of KH2PO4, 1 g of MgSO4, 1 g of K2SO4, 1 M NaOH to adjust the pH to 7, and dilute to 1 L with deionized water.

[0039] Preferably, the solid plate comprises 20 g of glucose, 1 g of yeast extract, 2 g of beef extract, 2 g of peptone, 15 g of agar powder, 1 M NaOH to adjust the pH to 7, and deionized water to 1 L; and / or the seed culture medium comprises 30 g of glucose, 1 g of yeast extract, 2 g of beef extract, 2 g of peptone, 1 M NaOH to adjust the pH to 7, and deionized water to 1 L; and / or the inoculation amount of the recombinant engineered bacteria seed solution of Sphingomonas paucimobilis is 5%-10% (v / v), the seed solution is cultured at 28° C., 200 rpm for 20 h to the end of the logarithmic phase, and the fermentation broth is fermented at 28° C., 200 rpm for 72 h.

[0040] It should be noted that in the present invention, Cpf1 is a new class II CRISPR-Cas RNA-encodable endonuclease family, also known as Cas 12a, with unique functions, and has become a very attractive alternative or supplement to Cas9 genome engineering. Cpf1 protein is slightly smaller than Cas9 protein, and both are endonucleases guided by single-stranded RNA, but Cpf1 has RNA endonuclease activity in addition to DNA endonuclease activity, so the primary transcription product pre-crRNA of CRISPR-Cpf1 is processed by Cpf1 itself, and does not require the participation of tracrRNA, which is conducive to simplifying the experimental steps; in addition, due to the incompatibility of common plasmids in Sphingomonas, the replicons of common plasmids cannot be replicated in Sphingomonas paucimobilis, so a wide host expression plasmid pBBR1MCS-2 is selected; the promoter is the binding site of RNA polymerase on DNA, the start site of transcription, and plays an important regulatory role in the expression of genes. Therefore, selecting a suitable promoter is the key to genetic manipulation of Sphingomonas paucimobilis.

[0041] The beneficial effects of the present invention include:

[0042] (1) The ΔcrtI / phaC knockout strain was obtained using the pEcCpf1 / pcrEG knockout system. The yield of the ΔcrtI knockout strain was 7.3 g / L, which was lower than the yield of 8.3 g / L of the 31461UA strain. However, this strain did not produce yellow pigment, which reduced the amount of ethanol or isopropanol used in gellan gum extraction and thus reduced the production cost of gellan gum. The yield of the ΔphaC knockout strain was 8.9 g / L, which was slightly higher than the yield of 8.3 g / L of the 31461UA strain.

[0043] (2) The pBBR1MCS-2-N expression system was used to overexpress the energy metabolism-related genes pgi, clpB, and ycaJ. The strains overexpressing the pgi, clpB, and ycaJ genes increased the yield of gellan gum by 9.5 g / L, 9.0 g / L, and 8.9 g / L, respectively, compared with the 31461UA strain (yield 8.3 g / L) and the strain containing the empty vector pBBRMCS-2-N (yield 7.5 g / L). In addition, overexpression of the pgi gene on the basis of the ΔphaC knockout strain also significantly increased the yield of gellan gum, from 8.9 g / L to 10.0 g / L, improving production efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Schematic diagram for the construction of crtI and / or phaC knockout strains;

[0045] Figure 2 Electrophoresis diagram of PCR identification of crtI or phaC gene knockout strains; A. Lane 1: 31461UA control group; Lane 2: Marker; Lanes 3-8: 31461UA-crtI gene knockout experimental group; B. Lanes 1, 16: Marker; Lanes 2-8: 31461UA control group; Lanes 9-15: 31461UA-phaC gene knockout experimental group;

[0046] Figure 3 is the amount of gellan gum synthesized by the crtI or phaC gene knockout strain;

[0047] Figure 4 Schematic diagram for constructing strains overexpressing pgi or clpB or ycaJ genes;

[0048] Figure 5 Electrophoresis diagram of PCR identification of strains overexpressing pgi, clpB or ycaJ genes; Lane 1: Marker; Lanes 2-7: 31461UA gene overexpression experimental group;

[0049] Figure 6 is the amount of gellan gum produced by strains overexpressing pgi, clpB or ycaJ genes. DETAILED DESCRIPTION

[0050] The examples are provided to better illustrate the present invention, but the present invention is not limited to the examples. Therefore, those skilled in the art may make non-essential improvements and adjustments to the implementation scheme according to the above invention content, which still fall within the protection scope of the present invention.

[0051] The terms used herein are only used to describe specific embodiments and are not intended to limit the present disclosure. Unless the context has a significantly different meaning, expressions in the singular include expressions in the plural. As used herein, it should be understood that terms such as "include", "have", "include" are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials or combinations. The terms of the present invention are disclosed in the specification, and are not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials or combinations thereof may exist or may be added. As used herein, " / " may be interpreted as "and" or "or", depending on the circumstances.

[0052] In order to better understand the present invention, the content of the present invention is further explained below in conjunction with specific examples, but the content of the present invention is not limited to the following examples.

[0053] In the following examples, the nucleotide information involved is shown in Table 1.

[0054] Table 1 Nucleotide information involved

[0055] Nucleotides sequence Cpf1 codon-optimized sequence SEQ NO:1 Tac promoter nucleotide sequence SEQ NO:2 rrnT1 terminator nucleotide sequence SEQ NO:3 pgi gene nucleotide sequence SEQ NO:4 Nucleotide sequence of clpB gene SEQ NO:5 ycaJ gene nucleotide sequence SEQ NO:6

[0056] In the following examples, the sequence information of the primer pairs used is shown in Table 2 below.

[0057] Table 2 Sequence information of primer pairs used

[0058]

[0059]

[0060] Example 1 Construction of CRISPR-cpf1 system and gene knockout

[0061] A CRISPR-cpf1 system suitable for Sphingomonas paucimobilis was constructed to knock out the crtI and phaC genes, and a strain with successful gene knockout was obtained. The schematic diagram of the construction is shown in the figure. Figure 1 shown.

[0062] The Sphingomonas paucimobilis 31461UA strain (purchased from ATCC, USA) was used as the experimental object to develop the CRISPR-Cpf1 gene editing technology of the strain. Based on the plasmid pEcCpf1 / pcrEG, the pEcCpf1 plasmid was optimized for cpf1 codons and handed over to General Bio for base synthesis, and the plasmid was linearized by the primer pair pEcCpf1-1F / R, and the fragment Cpf1-N expression cassette was amplified using the primer pair Cpf1-NF / R. The fragments were connected by the seamless cloning kit, and the connection solution was transferred into DH5α cells. Finally, the correct pEcCpf1-N plasmid was obtained by plasmid PCR verification and sequencing verification. Based on the above results, the plasmid was linearized by primer pair pEcCpf1-N-2F / R, and the replicon of the plasmid was replaced with the pBBR replicon of a wide host using primer pair pBBR-F / R to obtain the knockout plasmid pEcCpf1-N-pBBR, and the plasmid pEcCpf1-N-pBBR was electroporated into Sphingomonas paucimobilis ATCC 31461UA strain.

[0063] The designed target gRNA was annealed to form single-stranded dsDNA using primer pair crtI / phaC-gRNA-F / R, the pcrEG plasmid was digested at the Eco31I site, and the single-stranded dsDNA was connected to the linearized pcrEG plasmid through T4 to obtain the pcrEG-gRNA-crtI / phaC plasmid. Annealing program: 98°C, 2min; gradient cooling to 16°C at a rate of 0.1°C / s. Then, the upstream and downstream homologous arms of the target were amplified using primer pair crtI / phaC-F / R, and the recombinant plasmid was constructed by seamless cloning with the pcrEG-gRNA-crtI / phaC plasmid linearized by reverse PCR. Among them, the T4 connection system and the seamless cloning reaction system are shown in Tables 3 and 4 below, respectively.

[0064] Table 3T4 connection system

[0065] Components Reaction system dsDNA 1 T4DNALigase 1 T4DNALigaseBuffer 2 Linearized PCR 1 ddH2O to10μL

[0066] Table 4 Seamless cloning reaction system

[0067] Components Reaction system Linearized vector X Insert Y 5×CEMultiSBuffer 4 ExnaseMultiS 2 ddH2O to20μL

[0068] Take 10 μL of the recombinant product and add it to 100 μL of DH5α competent cells. After overnight culture, pick several clones on the recombination reaction transformation plate for colony PCR identification. For colonies identified as positive by colony PCR, the remaining bacterial liquid can be inoculated into liquid LB medium containing appropriate antibiotics and cultured overnight, and the plasmid can be extracted for first-generation sequencing verification.

[0069] Example 2 Preparation and verification of electroporation competence of Sphingomonas paucimobilis

[0070] Prepare electrocompetent cells of Sphingomonas paucimobilis: pick a single colony from the plate and inoculate it into 50 mL of seed culture medium, and culture at 30°C and 200 rpm until OD 600 =0.60; centrifuge the bacterial solution at 8000r / min for 5min and discard the supernatant; add 20mL of pre-cooled electroporation competent buffer to wash three times, add the buffer to the cells, pipette gently, mix thoroughly and place on ice, and package to obtain electroporation competent cells (prepared and used immediately).

[0071] Take 90 μL of Sphingomonas paucimobilis competent cells and 200 ng of pEcCpf1-N-pBBR plasmid, mix gently, add to a pre-cooled 0.1 mm electroporation cup, place on ice for 10 min, and then electroporate. Immediately after the electroporation, add 1 mL of seed culture medium (30 g of glucose, 1 g of yeast extract, 2 g of beef extract, 2 g of peptone, 1 M NaOH to adjust the pH to 7, and dilute to 1 L with deionized water) to the electroporation cup, gently blow and transfer to a centrifuge tube, culture at 30°C, 200 r / min for 3 h to revive the cells; spread on a solid culture medium containing 50 mg / L of kanamycin (including 20 g of glucose, 1 g of yeast extract, 2 g of beef extract, 2 g of peptone, 15 g of agar powder, 1 M NaOH to adjust the pH to 7, and dilute to 1 L with deionized water), and culture at 30°C for 2 days.

[0072] Prepare electrocompetent cells of Sphingomonas paucimobilis containing pEcCpf1-N-pBBR plasmid: Pick a single colony containing pEcCpf1-N plasmid from the Kan resistance plate, inoculate it into 50 mL seed culture medium, and culture at 30°C, 200 rpm until OD 600 =0.20, add arabinose inducer, and induce culture to OD 600 =0.60; centrifuge the bacterial solution at 8000r / min for 5min and discard the supernatant; add 20mL of pre-cooled electroporation competent buffer to wash three times, add the buffer to the cells, pipette gently, mix thoroughly and place on ice, and package to obtain electroporation competent cells (prepared and used immediately).

[0073] Take 90 μL of Sphingomonas paucimobilis competent cells and 200 ng of pcrEG-gRNA-crtI plasmid, mix gently, add them to the pre-cooled 0.1 mm electroporation cup, place on ice for 10 min, and then electroporate. After the electroporation, immediately add 1 mL of seed culture medium (including 30 g of glucose, 1 g of yeast extract, 2 g of beef extract, 2 g of peptone, 1 M NaOH to adjust the pH to 7, and deionized water to 1 L) to the electroporation cup, gently blow and transfer to a centrifuge tube, culture at 30 ° C, 200 r / min for 3 h, and revive the cells; spread on a solid culture medium containing 50 mg / L of kanamycin, and culture at 30 ° C for 2 days; pick several clones on the transformation plate for colony PCR identification; the PCR reaction system is shown in Table 5, and the PCR reaction conditions are shown in Table 6; at the same time, 200 ng of pcrEG-gRNA-phaC plasmid is also used according to the above method.

[0074] Table 5 PCR reaction system

[0075] Components Reaction system Template DNA 1 Primer-F 2 Primer-R 2 2×RapidTaqMasterMix 10 <![CDATA[ddH2O]]> to20μL

[0076] Table 6 PCR reaction conditions

[0077]

[0078] The identification results are as follows Figure 2 As shown, for crtI gene knockout, the PCR band size of the 31461UA non-knockout strain is about 3600 bp, and the PCR band size of the crtI gene knockout strain is about 2100 bp; for phaC gene knockout, the PCR band size of the 31461UA non-knockout strain is about 3800 bp, and the PCR band size of the phaC gene knockout strain is about 2000 bp.

[0079] Example 3 Gellan Gum Fermentation of Gene Knockout Strains

[0080] Pick the correct transformants identified by colony PCR (PCR is performed according to the reaction system and reaction procedure in Tables 5 and 6 above) for seed and fermentation culture, and take the fermentation broth for yield determination. Weigh 10g of fermentation broth, place in a 90℃ water bath for 20min, and cool to room temperature; centrifuge at 3000r / min for 30min until the substances are completely separated, add three times the volume of ice ethanol to the cell-free supernatant, seal at 4℃ overnight, and precipitate gellan gum. Then filter the alcohol solution from which gellan gum is precipitated, filter until nearly dry, carefully remove the filter paper and glue, dry at 60℃ to constant weight, and weigh; calculate according to the following formula: glue yield (g / L) = crude glue weight (g) / fermentation broth volume (L).

[0081] The test results are as follows Figure 3As shown, the results showed that ΔcrtI and ΔphaC knockout strains were obtained using the pEcCpf1 / pcrEG knockout system, among which the yield of the ΔcrtI knockout strain was 7.3 g / L, which was lower than the yield of 8.3 g / L of the 31461UA strain, but the strain did not produce yellow pigment, which reduced the amount of ethanol or isopropanol used in gellan gum extraction and thus reduced the production cost of gellan gum; the yield of the ΔphaC knockout strain was 8.9 g / L, which was slightly higher than the yield of 8.3 g / L of the 31461UA strain.

[0082] Example 4 Construction of expression plasmid pBBR1MCS-2-N and gene overexpression

[0083] The expression plasmid was reconstructed based on the pBBR1MCS-2 plasmid, and its promoter, terminator and other elements were optimized. The lac promoter and its terminator were replaced with tac promoter and rrnT1 terminator using primer pairs pBBRMCS-2-tac-1F / R and pBBRMCS-2-tac-2F / R to obtain the reconstructed pBBR1MCS-2-N plasmid, making it suitable for Sphingomonas paucimobilis. The construction diagram is shown in the figure. Figure 4 shown.

[0084] Construction of overexpression recombinant plasmid, the gellan gum production strain was extracted using a bacterial genomic DNA extraction kit. The whole genomic DNA of Sphingomonas paucimobilis was used as a template to amplify the genes pgi, clpB, and ycaJ from pgi-F / R, clpB-F / R, and ycaJ-F / R. PCR reaction conditions: 95℃, 3min; 95℃, 15s, 64℃, 15s, 72℃, 30s, cycle number 32; 72℃, 5min. The vector pBBR1MCS-2-N was linearized by double restriction digestion with BamHI and SalI. Subsequently, the target fragment was recovered and purified using an agarose gel recovery kit; the differential genes were assembled into the pBBR1MCS-2-N plasmid by seamless connection to construct a recombinant plasmid; the seamless cloning connection system is shown in Table 2, the reaction temperature is 37℃, and the reaction time is 30min.

[0085] Take 10 μL of the recombinant product and add it to 100 μL of DH5α competent cells. After overnight culture, pick several clones of the recombinant reaction for colony PCR identification. For colonies identified as positive by colony PCR, the remaining bacterial liquid can be inoculated into liquid LB medium containing appropriate antibiotics and cultured overnight, and the plasmid can be extracted for first-generation sequencing verification.

[0086] Example 5 Preparation of electroporation competent cells of Sphingomonas paucimobilis and verification

[0087] Prepare electrocompetent cells of Sphingomonas paucimobilis: pick a single colony from the plate and inoculate it into 50 mL of seed culture medium, and culture at 30°C and 200 rpm until OD 600 =0.55; centrifuge the bacterial solution at 8000r / min for 5min and discard the supernatant; add 20mL of pre-cooled electroporation competent buffer to wash three times, add the buffer to the cells, pipette gently, mix thoroughly and place on ice, and package to obtain electroporation competent cells (prepared and used immediately).

[0088] The verified overexpression recombinant plasmid was electrotransformed into the competent cells of Sphingomonas paucimobilis. Take 90 μL of competent cells of Sphingomonas paucimobilis, 200 ng of recombinant plasmid pBBR1MCS-2-N-clpB or pBBR1MCS-2-N-pgi or pBBR1MCS-2-N-ycaJ, mix gently, add to the pre-cooled 0.1 mm electrotransfer cup, place on ice for 10 minutes, and then electrotransfer. After the electrotransfer, add 1 mL of seed culture medium to the electrotransfer cup immediately, gently blow and transfer to a centrifuge tube, culture at 30°C, 200 r / min for 3 hours, and revive the cells. Spread on a solid culture medium containing 50 mg / L of kanamycin and culture at 30°C for 2 days. Pick several clones on the recombination reaction transformation plate for colony PCR identification.

[0089] The identification results are as follows Figure 5 As shown, the size of the correctly recombined and connected pBBR1MCS-2-N-clpB band is about 2600 bp, the size of the correctly recombined and connected pBBR1MCS-2-N-pgi band is about 1500 bp, and the size of the correctly recombined and connected pBBR1MCS-2-N-ycaJ band is about 1300 bp.

[0090] Example 6 Gellan Gum Fermentation of Recombinant Strain

[0091] Pick the transformants identified as positive by colony PCR for seed and fermentation culture. After inducing expression by the recombinant plasmid, take the fermentation broth for yield determination. Weigh 10g of fermentation broth, place in a 90℃ water bath for 20min, and cool to room temperature. Centrifuge at 3000r / min for 30min until the material is completely separated, add three times the volume of ice ethanol to the cell-free supernatant, seal at 4℃ overnight, and precipitate gellan gum. Then filter the alcohol solution that precipitates gellan gum, filter it until it is almost dry, carefully remove the filter paper and glue, dry it at 60℃ to constant weight, and weigh it; calculate according to the following formula: glue production (g / L) = crude glue weight (g) / fermentation broth volume (L).

[0092] Test results such as Figure 6As shown, the pBBR1MCS-2-N expression system was used to overexpress the energy metabolism-related genes pgi, clpB and ycaJ. The strains overexpressing pgi, clpB and ycaJ genes increased the yield of gellan gum compared with the 31461UA strain (yield 8.3 g / L) and the strain containing the empty vector pBBRMCS-2-N (yield 7.5 g / L), with the yields of 9.5 g / L (pBBR1MCS-2-N-pgi), 9.0 g / L (pBBR1MCS-2-N-clpB) and 8.9 g / L (pBBR1MCS-2-N-ycaJ), respectively. In addition, overexpressing the pgi gene (ΔphaC-pBBR1MCS-2-N-pgi) based on the ΔphaC knockout strain also significantly increased the yield of gellan gum, from 8.9 g / L to 10.0 g / L, improving production efficiency.

[0093] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution of the present invention, which should be covered by the scope of the claims of the present invention.

Claims

1. A recombinant engineered bacterium of Sphingomonas paucimobilis, characterized in that: It is obtained by knocking out the metabolic bypass gene of Sphingomonas paucimobilis, and the metabolic bypass gene is the crtI gene or the phaC gene.

2. The recombinant engineered bacterium of Sphingomonas paucimobilis according to claim 1, characterized in that: The recombinant engineered bacteria of Sphingomonas paucimobilis also include a plasmid for overexpressing energy metabolism related genes, and the energy metabolism related genes are pgi or clpB or ycaJ genes.

3. The recombinant engineered bacterium of Sphingomonas paucimobilis according to claim 1 or 2, characterized in that: The deposit number of Sphingomonas paucimobilis is ATCC 31461.

4. The method for constructing the recombinant engineered bacterium of Sphingomonas paucimobilis according to any one of claims 1 to 3, characterized in that: include: The metabolic bypass gene of Sphingomonas paucimobilis is knocked out, and the knockout method includes: (1) Design gRNA for crtI or phaC gene, using primer pairs crtI-gRNA-F / R or phaC-gRNA-F / R Annealing the gRNA to form single-stranded dsDNA; (2) The pcrEG plasmid was digested at the Eco31I site, and then the gRNA was replaced with the crRNA in the pcrEG by T4 ligation to obtain a pcrEG plasmid containing the crtI or phaC gene gRNA; (3) Linearizing the pcrEG-gRNA plasmid using the primer pair pcrEG-gRNA-F / R, and amplifying the upstream and downstream homologous arms of the crtI or phaC gene using the primer pair, connecting the upper and lower homologous arm fragments to obtain a recombinant plasmid; (4) The recombinant plasmid is transferred into Sphingomonas paucimobilis to obtain a crtI or phaC gene knockout strain, namely, a recombinant engineered strain of Sphingomonas paucimobilis.

5. The construction method according to claim 4, characterized in that: Primer pair crtI-gRNA-F / R, primer pair phaC-gRNA-F / R, and primer pair pcrEG-gRNA-F / R are as follows; Primer pair crtI-gRNA-F / R: F: agatTCGCTCTATCTCCACCACCCCAG, R: aattCTGGGGTGGTGGAGATAGAGCGA; Primer pair phaC-gRNA-F / R: F: agatGTCATCGCCGACCACATGCTCAA, R: aattTTGAGCATGTGGTCGGCGATGAC; Primer pair PCREG-gRNA-F / R: F: ATTACCCTGTTATCCCTACTCG, R: GTTAATAAGGCCAAGCTAACTAAG; The primer pairs for amplifying the upstream and downstream homology arms of the crtI and / or phaC genes are crtI-UF / R, crtI-DF / R or phaC-UF / R, phaC-DF / R; Primer pair crtI-UF / R: F: gttagcttggccttattaacCCTGCGGATCCTCGACGA, R:acaccaccgtAGCTGATGCTGGGCGAGTT; crtI-DF / R: F: agcatcagctACGGTGGTGTCGACCCCC, R: agtagggataacagggtaatCTGGTCGTTCTTCGCCGA; phaC-UF / R: F: gttagcttggccttattaacGCGCCGCCGTTCACGTTC, R:cTGGGAGCCGCTTGCGCAC phaC-DF / R: F: agtgcgcaagcggctcccaGCGGCGAGGCCCGCCAGC, R: agtagggataacagggtaatCAAGAAGGGCGGCACGCT.

6. The construction method according to claim 4 or 5, characterized in that: In step (4), the Sphingomonas paucimobilis contains a pEcCpf1-N-pBBR plasmid, and the method for constructing the Sphingomonas paucimobilis containing a pEcCpf1-N-pBBR plasmid comprises: (i) Using pEcCpf1 as the starting plasmid, the cpf1 protein was codon optimized for Sphingomonas, the plasmid was linearized using the primer pair pEcCpf1-1F / R, and the optimized cpf1-N protein was amplified using the primer pair cpf1-NF / R and replaced the original cpf1 to obtain plasmid 1; (ii) Plasmid 1 was linearized using primer pair pEcCpf1-N-2F / R, and the replicon of plasmid 1 was replaced with pBBR replicon using primer pair pBBR-F / R to obtain knockout plasmid pEcCpf1-N-pBBR, and the plasmid pEcCpf1-N-pBBR was transformed into Sphingomonas paucimobilis to obtain Sphingomonas paucimobilis containing the pEcCpf1-N-pBBR plasmid.

7. The construction method according to claim 4 or 5, characterized in that: The construction method also includes: transferring the plasmid overexpressing the energy metabolism-related gene into Sphingomonas paucimobilis. The construction method of the plasmid overexpressing the energy metabolism-related gene includes: (a) Based on the pBBR1MCS-2 plasmid, primers pBBRMCS-2-tac-1F / R, pBBRMCS-2-tac-2F / R replaced the lac promoter and its terminator with tac promoter and rrnT1 terminator to obtain the reconstructed pBBR1MCS-2-N plasmid; the whole genome DNA of Sphingomonas paucimobilis was used as a template and primers were used to pgi-F / R and / or clpB-F / R and / or ycaJ-F / R amplify genes pgi and / or clpB and / or ycaJ to obtain amplified gene fragments; (b) The plasmid pBBR1MCS-2-N was double-digested with restriction enzymes BamHI and SalI, and the double-digested plasmid was assembled with the amplified gene fragment to obtain a plasmid that overexpressed energy metabolism-related genes.

8. A method for preparing gellan gum, characterized in that: include: It is prepared by fermentation of the recombinant engineered bacteria of Sphingomonas paucimobilis as described in any one of claims 1 to 3.

9. The preparation method according to claim 8, characterized in that: Fermentation involves: The recombinant engineered bacteria of Sphingomonas paucimobilis were selected from a solid plate and cultured in a seed culture medium, and then the seed liquid was inoculated into a fermentation culture medium for culture. The fermentation culture medium included 30 g of glucose, 3 g of yeast extract, 2 g of peptone, 1 g of K2HPO4, 3 g of KH2PO4, 1 g of MgSO4, and 1 g of K2SO4. The pH was adjusted to 7 with 1M NaOH, and the volume was fixed to 1 L with deionized water.

10. The preparation method according to claim 9, characterized in that: The solid plate comprises 20g of glucose, 1g of yeast extract, 2g of beef extract, 2g of peptone, 15g of agar powder, 1M NaOH for adjusting pH to 7, and deionized water for adjusting volume to 1L; and / or the seed culture medium comprises 30g of glucose, 1g of yeast extract, 2g of beef extract, 2g of peptone, 1M NaOH for adjusting pH to 7, and deionized water for adjusting volume to 1L; and / or the inoculation amount of the seed solution of the recombinant engineered bacteria of Sphingomonas paucimobilis is 5%-10% (v / v), the seed solution is cultured at 28°C and 200rpm for 20h to the end of the logarithmic phase, and the fermentation solution is fermented at 28°C and 200rpm for 72h.

Images