Virus short enhancer element for improving gene transcription level and application thereof

Abstract

The invention provides a virus short enhancer capable of realizing fixed-point activation of a plant genome, and the virus short enhancer realizes efficient activation of a gene by directionally inserting into a promoter region of the plant gene. Specifically, 15 short enhancers which come from viruses and have different activation multiples are obtained through a large number of screening, the activation effect can be achieved in different reporter genes, and universality is achieved. The virus enhancer provided by the invention can be used for efficiently and flexibly regulating and controlling transcription of complex genes of plants such as rice and the like.

Description

Technical Field

[0001] The invention relates to the technical fields of biotechnology and plant genetic engineering, and in particular to a virus short enhancer element with the effect of enhancing gene transcription level. Background Art

[0002] Gene overexpression is one of the most important and widely used technologies in plant research and breeding, which usually relies on transgenic technology. However, this method is severely limited by the size of the open reading frame (ORF) sequence inserted into the expression vector. And because it uses an exogenous strong promoter and causes T-DNA insertion, it faces many problems and limitations. In addition, it is difficult to accurately activate the expression of specific genes using this method. Genome editing technology has opened up new avenues for genetic research and plant breeding, but it is mainly used for gene knockout; recently, dCas9-based gene overexpression has also been verified and used in various plants. However, the in vivo application of dCas9-based activation has not been fully explored because the activation efficiency varies greatly between different targets. There are also studies that mainly activate target genes by widely randomly editing promoters. However, there is specific editing between different gene promoters, which limits the versatility of this technology.

[0003] Using gene editing technology, inserting specific short enhancers at the appropriate location of the gene can activate plant genes. However, there are currently few enhancers that can be applied to plants, and even fewer universal enhancers. In addition, in specific production and experiments, in order to achieve different degrees of gene activation, it is necessary to explore more enhancers with different activation multiples.

[0004] Therefore, there is an urgent need in the art to develop universal enhancers that can efficiently activate plant genes. Summary of the invention

[0005] The purpose of the present invention is to provide a universal viral enhancer that can efficiently activate plant genes, and to achieve efficient activation of the gene by site-specific insertion into a specific region of the promoter of the target gene. Specifically, the present invention provides 15 universal transcription enhancers from viruses that have different activation multiples and can achieve activation effects in different reporter genes.

[0006] In a first aspect of the present invention, a short enhancer (STE) element for enhancing gene transcription is provided. The short enhancer (STE) element is derived from a virus and is a short nucleotide sequence having a non-palindromic structure and a promoter activation function.

[0007] In another preferred embodiment, the length of the short enhancer (STE) element is 30-200 bp.

[0008] In another preferred embodiment, the length of the viral short enhancer is 40-160 bp.

[0009] In another preferred embodiment, the length of the viral short enhancer is 60-160 bp.

[0010] In another preferred embodiment, the viral short enhancer is derived from a virus selected from the following group: Wheat dwarf virus (WDV), Taro bacilliform virus (TaBV) and Cauliflower mosaic virus (CaMV).

[0011] In another preferred embodiment, the sequence of the short enhancer (STE) element is shown in any one of SEQ ID NOs: 1-15.

[0012] In another preferred embodiment, the sequence of the short enhancer (STE) is selected from the following group:

[0013] (Z1) a polynucleotide as shown in any one of SEQ ID NOs: 1-15;

[0014] (Z2) a polynucleotide having a homology of ≥95% (preferably ≥98%) with the nucleotide sequence of any one of SEQ ID NOs: 1-15 and having promoter activation function;

[0015] (Z3) A polynucleotide having a promoter activation function, wherein the 5' end and / or 3' end of the polynucleotide as shown in any one of SEQ ID NOs: 1-15 is truncated by 1-30 (preferably 1-20, more preferably 1-10) nucleotides.

[0016] In the second aspect of the present invention, a genetically engineered promoter is provided, wherein the short enhancer (STE) element of the first aspect of the present invention is inserted into the transcription enhancement effector region corresponding to the upstream of the transcription start site in the original promoter.

[0017] In the third aspect of the present invention, a recombinant expression cassette is provided, wherein the expression cassette comprises the genetically engineered promoter described in the second aspect of the present invention and a target gene operably linked to the promoter.

[0018] In another preferred embodiment, the expression cassette is a linear nucleic acid construct.

[0019] In the fourth aspect of the present invention, a vector is provided, wherein the vector contains the short enhancer (STE) element described in the first aspect of the present invention, the genetically engineered promoter described in the second aspect of the present invention, or the recombinant expression cassette described in the third aspect of the present invention.

[0020] In another preferred embodiment, the vector is an expression vector.

[0021] In another preferred embodiment, the vector comprises a plasmid.

[0022] In the fifth aspect of the present invention, a genetically engineered host cell is provided, wherein the host cell contains the vector described in the fourth aspect of the present invention;

[0023] Or the short enhancer (STE) element described in the first aspect of the present invention, the genetically engineered promoter described in the second aspect of the present invention, or the recombinant expression cassette described in the third aspect of the present invention is integrated into the genome of the host cell.

[0024] In another preferred embodiment, the host cell includes a plant cell.

[0025] In another preferred embodiment, the host cell is a somatic cell.

[0026] In another preferred embodiment, the host cell includes a prokaryotic organism or a eukaryotic cell.

[0027] In another preferred embodiment, the host cell includes Agrobacterium.

[0028] In a sixth aspect of the present invention, there is provided a method for preparing a transgenic plant, comprising the steps of:

[0029] (a) providing a transgenic plant cell or plant callus, wherein the plant cell or the cell in the plant callus contains the vector according to the fourth aspect of the present invention; or the short enhancer (STE) element according to the first aspect of the present invention, the genetically engineered promoter according to the second aspect of the present invention, or the recombinant expression cassette according to the third aspect of the present invention is integrated into the genome of the cell; and

[0030] (b) regenerating the plant cell or plant callus into a plant.

[0031] In a seventh aspect of the present invention, a kit is provided, wherein the kit comprises the following reagents:

[0032] (a) the short enhancer (STE) element described in the first aspect of the present invention, the genetically engineered promoter described in the second aspect of the present invention, the recombinant expression cassette described in the third aspect of the present invention, the vector described in the fourth aspect of the present invention; or Agrobacterium containing the vector; and

[0033] (b) A gene editing reagent for performing gene editing at a predetermined position in a promoter corresponding to a transcription enhancing effector region upstream of a transcription start site.

[0034] In another preferred embodiment, the gene editing reagent includes (1) Cas enzyme; and / or (2) gRNA or its coding sequence corresponding to the predetermined position.

[0035] In an eighth aspect of the present invention, a method for increasing the transcription level of a target gene is provided, the method comprising:

[0036] (i) for a target gene whose expression is to be increased, determining a promoter operably linked to the target gene and a transcription start site of the target gene; and

[0037] (ii) inserting the short enhancer (STE) element as described in the first aspect of the present invention into the transcription enhancement effector region of the target gene, thereby increasing the transcription level of the target gene in a predetermined cell or plant;

[0038] The transcription enhancement effector region is a region from -5 to -1500 bp upstream of the transcription start site of the target gene.

[0039] In another preferred example, the insertion position of the short enhancer (STE) element is the region from -10 to -800 bp upstream of the transcription start site of the target gene.

[0040] In another preferred example, the insertion position of the short enhancer (STE) element is the region -20 to -500 bp upstream of the transcription start site of the target gene.

[0041] In another preferred embodiment, the insertion of short enhancer (STE) elements is performed by gene editing.

[0042] In another preferred embodiment, the gene editing uses Cas enzyme.

[0043] In another preferred embodiment, in step (ii), the insertion of the short enhancer (STE) element is performed by gene editing of plant cells in vitro, or gene editing of plant lines.

[0044] In another preferred embodiment, the inserted short enhancer (STE) element is used to perform gene editing on the plant during the flowering period.

[0045] In another preferred embodiment, the method comprises the steps of:

[0046] (a) providing a short enhancer (STE) element as described in the first aspect of the present invention;

[0047] (b) selecting an insertion site in the transcription enhancement effector region of the target gene, and performing site-directed cutting of the insertion site using a site-directed cutting nuclease;

[0048] (c) inserting the short enhancer (STE) element of step (a) into the insertion site after cutting in step (b) in a recipient plant cell.

[0049] In another preferred embodiment, the site-specific cleavage is carried out by transforming a DNA fragment encoding a site-specific cleavage nuclease into a plant receptor, causing the receptor cell to express the nuclease, thereby site-specifically cleaving the insertion site.

[0050] In another preferred embodiment, the DNA fragment encoding the site-directed cutting nuclease is a DNA fragment expressing the CRISPR / Cas9 element.

[0051] In another preferred embodiment, the DNA fragment encoding the site-directed cutting nuclease is introduced into the recipient plant by gene gun or by Agrobacterium transformation, thereby performing site-directed cutting.

[0052] In another preferred embodiment, the short enhancer (STE) element can be inserted into the insertion site in a forward or reverse direction.

[0053] In another preferred example, the short enhancer (STE) element is introduced into the recipient plant by gene gun or by Agrobacterium transformation and integrated into the insertion site.

[0054] In another preferred embodiment, the short enhancer (STE) element is integrated into the insertion site via a non-terminal ligation mechanism.

[0055] In another preferred example, when a higher multiple of transcriptional activation effect is required, the insertion position of the short enhancer (STE) element is the region -1 to -100 bp upstream of the transcription start site of the target gene; when a lower multiple of transcriptional activation effect is required, the insertion position of the short enhancer (STE) element is the region -500 to -1500 bp upstream of the transcription start site of the target gene.

[0056] In the ninth aspect of the present invention, a plant cell is provided. The plant cell is a plant cell treated by the method described in the eighth aspect of the present invention, and the expression level of a specific target gene is upregulated.

[0057] In another preferred embodiment, the plant is selected from the following group: rice, soybean, tomato, corn, tobacco, wheat, sorghum, salvia miltiorrhiza, and alfalfa.

[0058] In another preferred embodiment, the plant is rice.

[0059] In another preferred embodiment, the target gene is an endogenous gene of a plant.

[0060] In another preferred embodiment, the target gene is a single gene or multiple genes.

[0061] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 Shown is a reporter system established in rice using luciferase as a reporter gene, in which nLUC driven by the 35S promoter serves as an internal control and firefly luciferase (fLuc) serves as a dualLUC reporter gene.

[0063] Figure 2 The results show the activation effects of 15 viral STEs of the present invention on transcription when each of them is inserted into three different promoters.

[0064] Figure 3 Schematic diagram of the short transcription enhancers STEvs0004, STEvs0010, and STEvs0014 inserted into the rice EUI gene locus at position -113 upstream of the transcription start site. Yellow indicates the inserted STE; the red numbers mark the distance of the STE insertion site relative to the TSS.

[0065] Figure 4 The activation effects of STEvs0004, STEvs0010 and STEvs0014 on the rice EUI gene are shown. The upper figure shows the activation effect on the rice EUI gene at the transcriptional level; the lower figure shows the phenotype of the activation effect on the rice EUI gene.

[0066] Figure 5 The activation effect of STEvs0004 on rice LASPO and QS genes at the transcriptional level and their heritability were shown. Figure 5 A shows the activation levels of STEvs0004 on the rice LASPO gene in T1 and T2 generations; Figure 5 B shows the activation levels of STEvs0004 on rice QS genes in T1 and T2 generations.

[0067] Figure 6 The activation of multiple target genes by STEvs0004 was shown. Figure 6 A shows the NMN content of the offspring plants after STEvs0004 was inserted into QS and QPRT at the same time; Figure 6 B shows the NMN content of the offspring plants after STEvs0004 was simultaneously inserted into QS, QPRT, and NADppase; Figure 6 C shows the NMN content of the offspring plants after STEvs0004 was simultaneously inserted into QPRT, NaMNAT, NADS and NADppase. DETAILED DESCRIPTION

[0068] After extensive and in-depth research and a large number of screenings, the inventors screened for the first time a highly versatile enhancer-like element (abbreviated as STE or STE element) in viruses that can efficiently enhance plant gene expression. Specifically, the inventors targeted the insertion of the selected viral short enhancer (STE) element into a specific range of the promoter of the gene (i.e., a predetermined position upstream of the TSS), thereby achieving efficient activation of the gene, and significantly enhancing its expression level (usually up to about several dozen times to about a thousand times). The present invention was completed on this basis.

[0069] The experimental results show that the viral STE of the present invention can universally and efficiently activate gene transcription. In addition, the inventors unexpectedly discovered that the transcription enhancement effect of the viral STE of the present invention is adjustable. Since the gene activation effect of the viral STE element of the present invention is correlated with the position of STE insertion, the transcription activation effect corresponding to the predetermined enhancement multiple can be obtained by adjusting the introduction site of the viral STE element of the present invention. On this basis, the inventors have also developed a universal in vivo overexpression technology, called in situ gene activation technology, which can be used to efficiently and flexibly regulate the transcription of complex genes in plants such as rice.

[0070] Viral short enhancer (STE) elements of the present invention

[0071] As used herein, the terms "viral short transcription enhancer of the present invention", "viral short enhancer of the present invention", "viral STE of the present invention", "non-palindromic STE of the present invention", "viral short enhancer element of the present invention", "viral STE element of the present invention" and are used interchangeably, all referring to enhancer elements of the present invention that are derived from viruses and can efficiently enhance plant gene expression. When the STE element of the present invention is inserted into the promoter region, it can significantly increase or up-regulate the expression of the target gene operably linked to the promoter. The STE of the present invention is shorter than the length of conventional enhancers, so it is referred to as a short enhancer. Since the STE of the present invention does not need to rely on a palindromic structure, it belongs to a non-palindromic STE.

[0072] Typically, the lower limit of the length of the viral short enhancer element of the invention (L min ) is at least 30 bp, such as ≥40 bp, ≥50 bp, ≥60 bp, ≥80 bp, ≥100 bp. In addition, the upper limit of the fragment length of the viral short enhancer of the present invention (L max ) is at most 200 bp, such as ≤180 bp, ≤160 bp, ≤150 bp, ≤130 bp, ≤120 bp, ≤100 bp. Preferably, the length of the STE of the present invention can be any of the above lower limits (L min ) and upper limit (L max) is reasonably determined, for example, 30-200 bp, preferably 40-150 bp, more preferably 60-130 bp.

[0073] Preferably, the non-palindromic STE of the present invention does not contain any palindromic structure in its structure, and more preferably, does not contain any palindromic structure with a length of 6-20 bp or longer. The inventors' research shows that the presence of a palindromic structure will result in the inability to effectively enhance plant gene expression.

[0074] As used herein, the term "palindrome" refers to two sequences in double-stranded DNA that are identical in structure and opposite in orientation, and each single strand is consistent with the sequence of the other strand when read in the opposite direction when read in either direction. Typically, in a palindrome, the length of the sequences that are identical in structure and opposite in orientation is at least 6 bp or at least 8 bp.

[0075] In the present invention, the source virus of the short enhancer is not particularly limited, and representative viruses include (but are not limited to) Cestrum yellow leaf curling virus (CmYLCV), Wheat dwarf virus (WDV), Cauliflowermosaic virus (CaMV), and Taro bacilliform virus (TaBV).

[0076] The names, source species, lengths and sequences of the preferred viral short enhancers of the present invention are shown in the table below.

[0077]

[0078]

[0079] When the STE element of the present invention is introduced or inserted at different positions upstream of the TSS of different promoters, the driving efficiency of the original promoter can be effectively improved, thereby significantly enhancing the transcription and expression of the target gene. In addition, when the introduction site or insertion site of the STE element of the present invention is approximately close to the TSS, the degree (or multiple) of transcriptional activation is higher.

[0080] STE transcription enhancing effector region of the present invention

[0081] The inventors unexpectedly discovered in a large number of experiments that inserting a short enhancer into a suitable region of a gene promoter can significantly increase the expression level of the gene, and the suitable region is named STE transcription enhancement effect region. Inserting the STE element of the present invention into the STE transcription enhancement effect region can efficiently activate the expression of the target gene.

[0082] Experiments show that when the STE element of the present invention is introduced or inserted at different positions upstream of the TSS of different promoters, it can universally and efficiently improve the driving efficiency of the original promoter, thereby significantly enhancing the transcription and expression of the target gene. In addition, the position of the insertion site (or introduction site) has an effect on the activation efficiency. The activation level of STE on the gene is greatly correlated with the distance of the insertion site from the transcription start site (TSS), and the insertion site close to the transcription start site (TSS) shows a higher activation level.

[0083] For a certain promoter, the transcription enhancing effect region suitable for inserting into the STE element of the present invention is not particularly limited, as long as it is upstream of the TSS. Generally, the 3' end of the transcription enhancing effect region can be located at positions upstream of the TSS, such as -1, -5, -10, -20, -40, -50, -100, -200, -300, etc. The 5' end of the transcription enhancing effect region can be located at positions upstream of the TSS, such as -50, -100, -200, -400, -500, -800, -1000, -1500, etc. Preferably, the transcription enhancing effect region of the present invention can be reasonably determined by the above-mentioned 3' end position and 5' end position, such as -1 to -1500, -5 to -100, etc.

[0084] Preferably, in the present invention, the transcription enhancing effector region is a region 5-1000 bp upstream of the transcription start site (TSS), a region 10-800 bp upstream, and more preferably a region 20-500 bp upstream. When TSS is taken as the origin, the suitable introduction site of the STE of the present invention is -5 to -1000 nt, preferably -10 to -800 nt, and more preferably -20 to -500 nt.

[0085] In addition, the closer the introduction site or insertion site of the STE element of the present invention is to the TSS, the higher the degree (or multiple) of transcriptional activation is. This unexpected characteristic is unique to the STE element of the present invention, so the transcriptional enhancement effect of the STE of the present invention is adjustable, that is, the transcriptional activation effect corresponding to the predetermined enhancement multiple can be obtained by adjusting the introduction site of the STE element of the present invention. When a higher multiple of transcriptional activation effect is required, the STE element of the present invention can be inserted immediately upstream of the TSS, such as -1 to -100, or -5 to -80, or -10 to -60. When a higher multiple of transcriptional activation effect is required, the STE element of the present invention can be inserted before the -100 position upstream of the TSS, such as -100 to -500, or -120 to -400, or -150 to -300. When a lower fold transcriptional activation effect is desired, the STE element of the present invention can be inserted before the -500 position upstream of the TSS, for example, between -500 and -1500, or between -600 and -1200, or between -700 and -1000.

[0086] It should be understood that when the STE element of the present invention is inserted into the STE transcription enhancement effector region of a promoter (such as a plant promoter), a certain number of original nucleotides (such as 1-50 nt of the original sequence) may be deleted on one side or both sides of the insertion site, or the original nucleotide sequence may not be deleted. The research of the present invention shows that the deletion of a small amount of nucleotides at the insertion site will not affect the enhancement function of the STE element of the present invention.

[0087] In the present invention, one or more STE elements of the present invention, such as 1 to 3, preferably 1 to 2, can be inserted into the STE transcription enhancement effector region of a promoter (such as a plant promoter). When two or more STE elements of the present invention are inserted, these STE elements can be adjacent or spaced a certain distance apart.

[0088] application

[0089] The viral STE element of the present invention can be used for in-situ activations, i.e., a general method for up-regulating the expression of a target gene by targeting the transcription enhancement effector region of a target gene with the viral short enhancer (STE) element of the present invention. This method can efficiently and universally enhance the driving efficiency of an endogenous promoter of a plant, thereby enhancing the expression of the corresponding endogenous gene of the plant.

[0090] In addition, the promoter, construct or expression cassette containing the STE element of the present invention can also be used to express foreign genes in plants, thereby improving the agronomic traits of plants (such as the quality of edible parts, leaf shape, leaf color, flower shape, flower color, etc.), or enhancing the resistance of plants to adverse environments (such as freezing, high temperature, drought, viruses, pathogens, insect pests or artificial herbicides). The present invention can also be used to produce specific protein products (such as antigenic proteins and biological agents) in plants, or to study the specific functions of foreign genes in plant parts (such as leaves and flower organs) (such as the effect on the development of mesophyll cells, or the effect on the formation of flower organs, etc.).

[0091] The in situ activation technology of the present invention has high efficacy, wide applicability and stable heritability, and can be used as a potential alternative to traditional transgenic overexpression in plant research and breeding.

[0092] The main advantages of the present invention include:

[0093] (1) The present invention has obtained a plurality of viral short enhancers that can efficiently activate plant genes through a large number of screenings, and can activate target genes to different degrees, with the enhancement effect ranging from 2 times to 2000 times. Different viral short enhancers of the present invention can be selected as needed to achieve controllable activation of genes.

[0094] (2) The viral short enhancer of the present invention can activate different types of genes, including genes that are not suitable for ectopic expression, such as genes with long ORFs and genes that are difficult to amplify, and has universality.

[0095] (3) The viral short enhancer of the present invention has stable heritability after being inserted into the gene, and its activation effect can be stably passed on to the offspring.

[0096] (4) The viral short enhancer of the present invention can not only realize the efficient activation of a single gene, but also realize the activation of multiple genes.

[0097] (5) The viral short enhancer of the present invention has a high tolerance for the position of introduction. The STE element of the present invention can be inserted into a large region upstream of the promoter and exert its function. Moreover, even if the insertion site is slightly deviated, the enhancement effect can still be exerted.

[0098] (6) The viral short enhancer of the present invention has wide applicability in different plants and has broad application prospects in plant research and breeding.

[0099] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0100] General Methods and Materials

[0101] (1) STE mining and data analysis

[0102] The JASPAR database (https: / / jaspar.genereg.net) was used to mine potential transcription factor (TF) binding sites in different locations of the genome and comprehensively collect transcription factor binding motifs of different genes. TFs with relative scores higher than 90% were selected to ensure high specificity. The sequences of the promoter regions of different genes were obtained from the rice genome (MSU 7.0), and the 1Kb upstream region of the transcription start site was used for screening. ggplot2 was used to further visualize the density of TF binding sites and identify segments with high activity enhancement effects.

[0103] (2) Vector construction

[0104] CRISPR-P2.0 was used to select the best performing targets and the corresponding oligonucleotide aptamers were designed. The target plasmid pCBSG032 and the oligonucleotide aptamer were assembled and connected by Golden Gate Assembly. First, a 25ul reaction system was established, which contained 50ng of pCBSG032 vector and 0.05pmol of oligonucleotide aptamer, and the following thermal cycling conditions were performed: 37℃ for 5 minutes, then 16℃ for 5 minutes, repeated 30 cycles, and then incubated at 60℃ for 5 minutes. The assembled plasmid was directly transformed into Escherichia coli (Novozyme Biotech Co., Ltd.) to generate CRISPR-Cas9 plasmids. For the reporter vectors p35Smini-dualLUC, pEUI-dualLUC, and pRFT1-dualLUC, the pCambia1300-LUC vector was used as the backbone. The upstream 2K sequences of EU (LOC_05g40384) and RFT1 (LOC_06g06300) were amplified and cloned into the target plasmid by Gibson assembly. The vector containing the candidate STE was amplified and cloned into the target region using the same method.

[0105] (3) Plant materials and culture conditions

[0106] The CRISPR-Cas9-edited line rice (Oryza sativa L.) ssp. japonica Xiushui134 (XS134) was grown in experimental fields in Shanghai, China (31.13°N, 121.28°E) from May to October and in Hainan, China (18.25°N, 109.50°E) from January to April.

[0107] (4) Isolation and transformation of protoplasts

[0108] 100 hulled rice seeds were inverted in 75% ethanol for about 1 minute and then rinsed with sterile water; the seeds were inverted in 50% sodium hypochlorite solution for 20 minutes and then rinsed 4 times with sterile water. Sterile seeds were germinated on 1 / 2MS medium and grown in a dark environment at 26-28℃ for 8-12 days. The transformation of rice protoplasts was carried out by conventional methods. The average transformation efficiency was 70-80%, and 20μg sgRNA plasmid was used for transformation. Rice protoplasts were transformed as described above. An average of 105 protoplasts were transformed per vector, and 10μg of transiently verified plasmid was used for each transformation, with an average transformation efficiency of 70-80%.

[0109] (5) Dual luciferase gene reporter system

[0110] The schematic diagram of the construction of the dual luciferase gene reporter system is shown in Figure 1As shown. Firefly luciferase (nLuc) was used as the internal reference. Luciferase (fLuc) was used as a reporter gene, and the ratio of fLuc / nLuc was used to evaluate the activation effect of the enhancer.

[0111] use Discover System (Promega) measures the fluorescence of the dual luciferase reporter assay system. Specifically, different reporter gene plasmids were transfected into 100ul (106ml-1) of rice protoplasts. PEG4000 was used for transfection. After incubation for 12-16 hours, 100ul (1×) lysis buffer (Promega) was added to the protoplasts after centrifugation and washing. After incubation for 15 minutes, an equal volume of 80ul ONE-GloTMEX reagent (Promega) was added to the 96-well plate. After incubation for about 3 minutes for firefly luciferase activity detection, an equal volume of NanoDLRTMStop& Reagent (Promega) and mix well. Add NanoDLRTMStop& Reagent (Promega) and mix well to detect NanoLuc luciferase activity.

[0112] (6) Stable transformation of rice

[0113] CRISPR-Cas9 plasmids with target sites were extracted using the midipreps Volume Kit (Tiangen) and diluted to 1 μg / μl. Plasmids and donor DNA were mixed (1 ug plasmid + 2 pmol donor for a single STE insertion, and each STE contained 1 μg plasmid + 1 pmol donor for multiple different STE-KI strains), and then 50 μl of Gold-Micro solution (60 mg / ml) was added and bombarded. Biotransformation was performed using a PDS1000 / He particle bombardment system (Bio-Rad) with a target distance of 6.0 cm from the stop plate and a helium pressure of 7.5 MPa. One-month-old rice XS134 callus tissue was used for transformation. Hygromycin B (50 mg / L; YEASEN) was used to select hygromycin-resistant calli. Plantlets were regenerated from hygromycin-resistant calli using conventional rice transformation methods.

[0114] (7) Mutant identification method

[0115] Genomic DNA was extracted from leaves using the CTAB method. The mutant products were purified and amplified using touchdown PCR. The PCR products were then tested using Hi-TOM to confirm the mutation. Plantlets with Hi-TOM results above 1% mosaicism were identified as valid insertion plants. Results The different mutations were compared with the WT and predicted full-length insertion results.

[0116] (8) RNA extraction and RT-qPCR

[0117] Total RNA was extracted from leaves of transgenic seedlings using RNA Isolator Total RNA Extraction Reagent (Novogene Biotech Co., Ltd.) RNA Isolator extraction reagent and reverse transcribed using oligo (dT) primers and M-MLV reverse transcriptase (TransGenBiotech), followed by quantitative PCR (qPCR) experiments using designed primers. Each reverse transcription-quantitative PCR (RT-qPCR) experiment was repeated three times with at least three independent RNA preparations. The rice ACT1 gene was used as an internal control.

[0118] (9) NMN detection method

[0119] Nicotinamide mononucleotide (NMN) is a key precursor for NAD+ biosynthesis. NMN can be synthesized from aspartic acid by six key enzymes: LASPO, QS, QPRT, NaMNAT, NADS and NADppase. The regulation of STE on NMN by the present invention is tested to test the ability of STE to activate multiple target genes. The detection method of NMN is as follows:

[0120] Homozygous and knock-in T2 and / or T3 generation materials germinated, and when the seedlings grew to 14 days, 1g of leaves were collected, quickly cooled with liquid nitrogen, and then fully crushed. 1 gram of leaves was mixed with 100ul 0.1M KOH to stabilize the pH value. The NMN standard curve was drawn with a dilution gradient of 0, 0.1, 0.25, 0.5, 1, 2, and 4mg / 100g using NMN standard samples and 0.01M KOH, with a correlation coefficient of 0.99. The samples were transferred to a 96ELIAS plate (400ul, black, high adsorption, BBI), with a final volume of 250μL per well, including 69μL sample, 27.7μL 20% acetophenone in dimethyl sulfoxide, and 27.7μL 2M KOH. After incubation on ice for 2 minutes, 125μL 88% formic acid was added to each well, and then incubated at 37°C for 10 minutes. UV emission at 445 nm was measured on a Varioskan LUX microplate reader (Thermo Fisher) with an excitation wavelength of 382 nm. Rice seedling leaves were stored in 0.1 M KOH solution at a ratio of 1 gram to 100 ul. The NMN content was measured using the SD curve X = (Y-9.136) / 9167078*100, where X represents the NMN content (mg / g) and Y represents the fluorescence amount (au).

[0121] Example 1: Screening of viral STE

[0122] In-depth mining of short-length STEs was performed in regions predicted to have enhancers in viruses. Candidate enhancers were constructed into a total of 27 reporter vectors with three different reporter promoters and verified by in vitro transformation using rice protoplasts.

[0123] A reporter system was established in rice using luciferase as a reporter gene, in which nLUC driven by the 35S promoter was used as a control and firefly luciferase (fLuc) was used as a dualLUC reporter gene. The schematic diagram is shown in Figure 1 Three different promoters, miniCMV promoter, rice EUI promoter and rice RFT1 promoter, were used to compare the activation potential and stability of different STEs. For the candidate STEs with activation effects verified, their key motifs were analyzed to derive shorter STEs with effective activation levels.

[0124] Finally, 15 STEs with activation effects were screened from three viruses, namely Wheat dwarf virus (WDV), Cauliflower mosaic virus (CaMV), and Tarobacilliform virus (TaBV), and were named STEvs0001~0015.

[0125] Example 2: Activation effect of viral STE in three different reporter vectors

[0126] The reporter system described in Example 1 was used to compare the activation effect of the viral STE of the present invention on the reporter gene, wherein nLUC driven by the 35S promoter was used as a control and firefly luciferase (fLuc) was used as a dualLUC reporter gene. Three different promoters, miniCMV promoter (SEQ ID NO: 16), rice EUI promoter (SEQ ID NO: 17) and rice RFT1 promoter (SEQ ID NO: 18), were used to compare the activation potential of different STEs.

[0127] The results are as follows Figure 2 The results show that the STE of the present invention exhibits different levels of gene activation effects on the reporter gene, with the highest being more than 2000 times.

[0128] Table 1 Activation effects of different viral STEs in three reporter vectors

[0129]

[0130] Example 3: Correlation between viral STE insertion position and transcriptional activation

[0131] STEvs0004 with high activation level was transfected into 7 promoters containing different reporter genes constructed by exogenous means to explore the most suitable STE insertion position in the promoter. The results are shown in Table 2. The position close to the transcription start site (TSS) showed the highest activation level. The results showed that the activation level of STE was highly correlated with the distance between the inserted transcription start site.

[0132] When the STE element of the present invention is introduced or inserted at different positions upstream of the TSS of different promoters, the driving efficiency of the original promoter can be effectively improved, thereby significantly enhancing the transcription and expression of the target gene. In addition, when the introduction site or insertion site of the STE element of the present invention is approximately close to the TSS, the degree (or multiple) of transcriptional activation is higher (see Table 2 for details).

[0133] Table 2 Correlation between promoter insertion position and transcriptional activation

[0134]

[0135] Example 4: Different STEs can produce different multiples of activation in rice

[0136] The three STEs STEvs0004, STEvs0010 and STEvs0014 were knocked into the -133 position before the transcription start site of the rice EUI gene, as shown in the schematic diagram Figure 3EUI encodes a cytochrome P450 monooxygenase that is involved in GA metabolism and the control of internode elongation. The transcription level and plant height of the EUI gene were measured in the plants with successful knock-in.

[0137] The results are as follows Figure 4 As shown. Three STE insertion plants, STEvs0004, STEvs0010 and STEvs0014, were successfully obtained at the designated positions of EUI, and several homozygous plants were found. These T0 plants were significantly upregulated in EUI. Plants #1 and #19 inserted with STEvs0014 showed an activation level of about 10 times; plants #3, #12, and #15 inserted with STEvs0010 showed an activation level of about 45 times; plants #96, #65, and #114 inserted with STEv0004 showed an activation level of about 160 times.

[0138] The results showed that the above three STEs successfully produced an activation effect in rice and produced very obvious performance, indicating that the STE of the present invention can be used to directly regulate cellular processes in vivo; in addition, the three different STEs produced different multiples of activation effects, indicating that different STE elements of the present invention can be flexibly selected according to needs in the application to achieve different activation multiples.

[0139] Example 5: Insertion of the viral STE of the present invention causes activation of rice genes and is heritable

[0140] In order to determine whether the plants activated by the viral STE of the present invention are heritable, two genes, LASPO and QS, were selected to test the feasibility and progeny of using STE to induce transcriptional activation in stable plants. LASPO and QS are two key enzymes in the NMN synthesis pathway that regulate intracellular NMN synthesis, where NMN serves as an NAD+ substrate in rice.

[0141] STEvs0004 was inserted 211bp and 150bp upstream of the TSS of rice LASPO and QS, and 96 and 94 T0 generation materials with STEvs0004 insertion were successfully obtained, respectively. Several homozygous lines were generated in the T1 and T2 generations. The transcriptional activation levels of the T1 and T2 homozygous lines were analyzed.

[0142] The results showed that the target genes were significantly activated in all plants analyzed; in the T1 and T2 generations, the activation levels of LASPO#14 and LASPO#40 reached about 40 times ( Figure 5 A), while the activation levels of QS#45 and QS#57 reached about 15 times ( Figure 5 B). The above results demonstrate the potential of using STE in situ activation for efficient gene overexpression in rice plants and the generation of stable progeny.

[0143] Example 6: Activation of rice metabolic pathways regulated by multiple genes

[0144] Nicotinamide mononucleotide (NMN) was used as an example to verify whether the viral STE of the present invention can activate multiple target genes. NMN can be synthesized from aspartic acid by six key enzymes: LASPO, QS, QPRT, NaMNAT, NADS and NADppase.

[0145] By single transformation with gene gun, STEvs0004 was inserted into the combination of the above target genes, such as inserting STEvs0004 into QS and QPRT at the same time; inserting STEvs0004 into QS, QPRT and NADppase at the same time; inserting STEvs0004 into QPRT, NaMNAT, NADS and NADppase at the same time. The NMN content of these different insertion combinations was detected.

[0146] The results showed that the NMN content in the three insertion combinations increased significantly, which were 0.146mg / 100g, 0.168mg / 100g and 0.277mg / 100g, with an increase of about 1.3 times, about 1.7 times and about 2.2 times ( Figure 6 ). The results show that the STE of the present invention has an activation effect on multiple target genes.

[0147] discuss

[0148] Many quantitative trait variations are associated with different levels of gene expression. Using a single level of gene activation is usually not enough to produce different levels of phenotypes. Therefore, gene activation based on STEs of different strengths can provide a better solution for crop improvement to a certain extent. After a large number of screenings, 15 STEs were obtained in the virus, and their activation range was 2 to 2000 times relative to different target genes. By mixing and inserting STEs with different activation strengths, different levels of gene activation were achieved, which can greatly expand the selection range of candidate materials. It was further confirmed by experiments that STE insertion at different positions of rice protoplasts can have a great impact on the activation effect; when the STE insertion position is closer to the TSS, the activation effect is more obvious. The viral STE of the present invention can be used for in situ gene activation, allowing the target gene with different multiple activations to be customized directly according to the experimental purpose.

[0149] sequence

[0150] miniCMV promoter (SEQ ID NO: 16):

[0151] ATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATAAGGAAGTTCATTTCA TTTGGAGAGA

[0152] Rice EUI promoter (SEQ ID NO: 17):

[0153]

[0154] Rice RFT1 promoter (SEQ ID NO: 18):

[0155]

[0156] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A short enhancer (STE) element for enhancing gene transcription, characterized in that The short enhancer (STE) element is derived from a virus and is a short nucleotide sequence with a non-palindromic structure and a promoter activation function.

2. The short enhancer (STE) element according to claim 1, characterized in that The sequence of the short enhancer (STE) element is shown in any one of SEQ ID NOs: 1-15.

3. A genetically engineered promoter, characterized in that: The promoter is a promoter in which the short enhancer (STE) element according to claim 1 is inserted into the transcription enhancement effect region corresponding to the upstream of the transcription start site in the original promoter.

4. A recombinant expression cassette, characterized in that: The expression cassette comprises the genetically engineered promoter according to claim 3 and a target gene operably linked to the promoter.

5. A carrier, characterized in that The vector contains the short enhancer (STE) element of claim 1, the genetically engineered promoter of claim 3, or the recombinant expression cassette of claim 4.

6. A genetically engineered host cell, characterized in that: The host cell contains the vector according to claim 5; Or the short enhancer (STE) element of claim 1, the genetically engineered promoter of claim 3, or the recombinant expression cassette of claim 4 is integrated into the genome of the host cell.

7. A method for preparing a transgenic plant, characterized in that: Includes steps: (a) providing a transgenic plant cell or plant callus, wherein the plant cell or the cell in the plant callus contains the vector of claim 5; or the short enhancer (STE) element of claim 1, the genetically engineered promoter of claim 3, or the recombinant expression cassette of claim 4 is integrated into the genome of the cell; and (b) regenerating the plant cell or plant callus into a plant.

8. A kit, characterized in that: The kit contains the following reagents: (a) the short enhancer (STE) element of claim 1, the genetically engineered promoter of claim 3, the recombinant expression cassette of claim 4, the vector of claim 5, or Agrobacterium containing the vector; and (b) A gene editing reagent for performing gene editing at a predetermined position in a promoter corresponding to a transcription enhancing effector region upstream of a transcription start site.

9. A method for increasing the transcription level of a target gene, characterized in that: The method comprises: (i) for a target gene whose expression is to be increased, determining a promoter operably linked to the target gene and a transcription start site of the target gene; and (ii) inserting the short enhancer (STE) element as claimed in claim 1 into the transcription enhancing effector region of the target gene, thereby increasing the transcription level of the target gene in a predetermined cell or plant; The transcription enhancement effector region is a region from -5 to -1500 bp upstream of the transcription start site of the target gene.

10. A plant cell, characterized in that The plant cell is a plant cell treated by the method according to claim 9, and the expression level of the specific target gene is upregulated.

Images