Tomato SlMET1L gene and application thereof in fruit ripening and fresh-keeping quality regulation and control

Abstract

The invention discloses a tomato SlMET1L gene and application thereof in tomato fruit maturation and fresh-keeping quality regulation and control, and belongs to the technical field of agricultural biological genetic engineering. The Slmet1L mutant tomato fruit is obtained, and it is found for the first time that the SlMET1L gene can positively regulate the tomato fruit ripening speed and quality formation, including color accumulation, soluble solids and hardness. The expression quantity of the SlMET1L is increased, so that the maturation and quality formation of tomato fruits can be promoted; the reduction of the expression quantity of the SlMET1L can slow down the maturation of tomato fruits and the formation of fresh-keeping quality. Therefore, by reasonably utilizing the gene, the maturity and quality characters of tomato fruits can be adjusted, and quality-related tomato breeding can also be guided. Theoretical basis and technical support are provided for regulating and controlling tomato fruit ripening and fresh-keeping quality characters by utilizing a genetic engineering technology, and the gene has important application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of agricultural biological gene engineering, and specifically relates to a tomato SlMET1L gene and an application thereof in regulating tomato fruit ripening and fresh-keeping quality. Background Art

[0002] Tomato (Solanum lycopersicum L.) is one of the most important economic crops in the world. Its fruit ripening process directly affects the quality, nutritional value and market competitiveness of the fruit. Fruit ripening involves complex physiological processes, including color changes, sugar accumulation, fruit softening, etc. The gene network and molecular mechanism that regulate this process are still under exploration. In recent years, DNA methylation, as an important mechanism of epigenetics, has gradually been identified as a key factor in regulating plant development, stress resistance and fruit ripening, especially playing an important role in regulating the ripening of plant fruits.

[0003] The SlMET1L gene is a core gene in the tomato DNA methylation maintenance pathway, and the protein it encodes plays a key role in the DNA methylation maintenance pathway. The present invention finds that the gene not only regulates the epigenetic state of the plant genome, but also participates in regulating fruit ripening, thereby affecting the quality formation of tomato fruit. Based on this, the present invention proposes its application in fruit ripening regulation.

[0004] The SlMET1L gene has great application potential, especially in genetic engineering breeding and tomato variety improvement. By regulating the expression of the SlMET1L gene, the fruit ripening process can be precisely controlled in the transgenic improvement of tomatoes, thereby providing a theoretical basis and technical support for the cultivation of high-quality, storage-resistant tomato varieties and the control of post-harvest preservation quality of tomatoes. In addition, the key role of the SlMET1L gene in the regulation of tomato ripening has significant breeding value and can provide agricultural breeders with new targets to develop new tomato varieties that adapt to different climatic conditions and market demands. Summary of the invention

[0005] In view of the problems existing in the prior art, the object of the present invention is to design and provide a technical solution for a tomato SlMET1L gene and its application in regulating the ripening and fresh-keeping quality of tomato fruits.

[0006] The present invention is specifically implemented by the following technical solutions:

[0007] The first aspect of the present invention provides a tomato S1MET1L gene, wherein the tomato S1MET1L gene comprises the nucleotide sequence (A1), (A2), (A3) or (A4):

[0008] (A1) the nucleotide sequence shown in SEQ ID NO.1;

[0009] (A2) a nucleotide sequence as shown in SEQ ID NO.1, wherein one or more bases are substituted and / or deleted and / or added, but the nucleotide sequence has the same function;

[0010] (A3) a nucleotide sequence that is 70% or more identical to the nucleotide sequence shown in SEQ ID NO.1 and has the same function;

[0011] (A4) A nucleotide sequence obtained by ligating a tag encoding sequence to the 5' segment and / or 3' end of any of the defined sequences (A1) to (A3).

[0012] The second aspect of the present invention provides a protein encoded by a tomato SlMET1L gene, the protein comprising the amino acid sequence (B1), (B2), (B3) or (B4):

[0013] (B1) the amino acid sequence shown in SEQ ID NO.2;

[0014] (B2) a protein having the same function as the amino acid sequence shown in SEQ ID NO. 2, wherein one or more amino acid residues are substituted and / or deleted and / or added;

[0015] (B3) an amino acid sequence that is 70% or more identical to the amino acid sequence shown in SEQ ID NO. 2 and has the same function;

[0016] (B4) The amino acid sequence obtained by connecting a protein tag to the N-terminus and / or C-terminus of any of the proteins defined in (B1) to (B3).

[0017] The third aspect of the present invention provides the use of the tomato SlMET1L gene in regulating the ripening and fresh-keeping quality of tomato fruits.

[0018] Furthermore, the regulation of tomato fruit ripening and preservation quality in the application specifically includes at least one of the following:

[0019] (1) Regulate the DNA methylation level of tomato fruit genome;

[0020] (2) Regulate the ripening process of tomato fruit;

[0021] (3) Regulate the accumulation of tomato fruit color;

[0022] (4) Regulate tomato fruit firmness;

[0023] (5) Regulate the soluble solids content of tomato fruit.

[0024] A fourth aspect of the present invention provides the use of the tomato S1MET1L gene as a target in the breeding process related to tomato fruit ripening and fresh-keeping quality.

[0025] A fifth aspect of the present invention provides a method for promoting tomato fruit ripening or increasing tomato fruit color accumulation or increasing tomato fruit soluble solid content, comprising:

[0026] Increase the expression level of the SlMET1L gene in tomatoes; or

[0027] Increasing the activity of the protein encoded by the SlMET1L gene in tomatoes; or

[0028] Increase the content of protein encoded by the SlMET1L gene in tomatoes.

[0029] A sixth aspect of the present invention provides a method for delaying the ripening of tomato fruits or reducing the color accumulation of tomato fruits or reducing the soluble solid content of tomato fruits, comprising:

[0030] Knockout of the SlMET1L gene in tomato; or

[0031] Silencing the SlMET1L gene in tomato; or

[0032] Reducing the activity of the protein encoded by the SlMET1L gene in tomatoes; or

[0033] Reduce the content of protein encoded by the SlMET1L gene in tomatoes.

[0034] Beneficial effects of the present invention:

[0035] The present invention discovered for the first time that SlMET1L can positively regulate the ripening speed of tomato fruits, including quality characteristics such as color accumulation, hardness, and soluble solid content. Inhibiting SlMET1L expression can inhibit the ripening process of tomatoes; promoting SlMET1L expression can accelerate the ripening process of tomatoes. By rationally utilizing this gene, the ripening process of tomato fruits and the formation of fresh-keeping quality can be regulated, which provides an important theoretical basis and technical means for tomato quality regulation and molecular breeding, and has great application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Agarose gel electrophoresis of the PCR amplification product of SlMET1L gene CDS;

[0037] Figure 2 The results of SlMET1L subcellular localization are shown;

[0038] Figure 3 Schematic diagram of sgRNA design for SlMET1L CRISPR / Cas9-based knockout mutant;

[0039] Figure 4 Phenotypic photos of SlMET1L knockout mutants (a); SlMET1L expression levels of SlMET1L knockout mutants (b); DNA methylation levels of SlMET1L knockout mutants (c);

[0040] Figure 5 Soluble solid content of SlMET1L knockout mutant (a); hardness of SlMET1L knockout mutant (b);

[0041] Figure 6 The SlMET1L expression level of SlMET1L overexpressing fruits (a); the soluble solids content of SlMET1L overexpressing fruits (b); and the firmness of SlMET1L overexpressing fruits (c). DETAILED DESCRIPTION

[0042] The present invention is further described below in conjunction with the examples, but is not intended to limit the scope of the present invention. Unless otherwise specified, the reagents, consumables, etc. used in the examples can be obtained from commercial sources, and the examples are all carried out according to conventional experimental methods or according to the manufacturer's instructions. The quantitative tests in the following examples are all set to three repeated experiments, and the results are averaged.

[0043] Example 1: Cloning of S1MET1L gene CDS

[0044] Total RNA was extracted from tomato fruit (Solanum lycopersicum cv M82), and the RNA solution that passed the quality inspection was reverse transcribed into cDNA in one step, and the genomic gDNA was further removed and the first-strand cDNA was synthesized. The full-length CDS of SlMET1L was cloned according to the primers (upstream primer 5'-3'ATGTCGAGCAAACGGAAAGCTT; downstream primer 5'-3'TTAAACCTTATCTAGAGATTCGTCATTGG), and high-fidelity PCR amplification was performed using this as a template. The amplified product was subjected to agarose gel electrophoresis. The results are as follows: Figure 1 The length of the band is about 2000-3000 bp, and the band is clear and bright without any other bands. After sequencing, the nucleotide sequence of the SlMET1L gene is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0045] Example 2: S1MET1L subcellular localization experiment

[0046] To verify the function of SlMET1L, SlMET1L subcellular localization experiments were performed.

[0047] Vector construction: The pAEnTopo vector connected with SlMET1L-CDS was replaced with the pNC-Cam1304-SubC-eGFP vector (incubated at 50°C for 1 h) to obtain the pNC-Cam1304-SlMET1L-eGFP recombinant plasmid, which was transformed into DH5α Escherichia coli competent cells. Monoclonal colonies were picked in the resistant solid LB medium containing 50 mg / mL kanamycin for colony PCR screening and positive clones were sequenced for verification (colony PCR and sequencing primers: upstream primer 5'-3'ggagcacgacacacttgtctact; downstream primer 5'-3'gcaagaccggcaacaggattca). After successful alignment, the recombinant plasmid was extracted.

[0048] Recombinant plasmid transformation: The successfully connected pNC-Cam1304-SlMET1L-eGFP plasmid (with the pNC-Cam1304-SlMET1L plasmid without fluorescent protein) was transformed into GV3101 Agrobacterium competent cells. The transformed bacterial solution was spread on LB solid medium containing 50μg / mL kanamycin and 25μg / mL rifampicin antibiotics, and inverted in a 28℃ incubator for 2-3 days. Single colonies were picked and positive clones were screened by colony PCR (colony PCR and sequencing primers: upstream primer 5'-3'ggagcacgacacacttgtctact; downstream primer 5'-3'gcaagaccggcaacaggattca) for sequencing verification. After successful sequencing, part of the corresponding bacterial solution was added with 50% glycerol at a ratio of 1:1 and stored in a -80℃ refrigerator.

[0049] Infect tobacco leaves: Resuspend the recombinant plasmid Agrobacterium cultured in a 28°C shaker (220 rpm) for 2 days in a pre-prepared infection solution (1% sucrose, 10 mM MES, 10 mM MgCl2, 150 μM acetosyringone, pH = 5.6) to an OD of 600 = 0.8 to 1.0. After standing at room temperature for 2 hours, the infection solution (recombinant plasmid and empty vector) was injected into 3-4 week-old Nicotiana benthamiana leaves using a 1 mL sterile syringe without a needle until the infection solution infiltrated the entire leaf, and cultured at 25°C in a culture room with a 16 h light / 8 h dark cycle for 2 days.

[0050] Laser scanning confocal microscopy observation: tobacco leaf slices were placed on a glass slide and observed and recorded using a laser scanning confocal upright microscope. Under an excitation wavelength of 488 nm, the green fluorescence signal can be observed at a collection wavelength of 490 to 530 nm, and the chloroplast autofluorescence signal can be observed at a collection wavelength of 650 to 750 nm.

[0051] The results are as follows Figure 2The eGFP green fluorescence signal displayed by the expression of SlMET1L-eGFP fusion protein in tobacco cells is in the nucleus, which proves the subcellular nuclear localization of strawberry SlMET1L, which is consistent with its function in maintaining DNA methylation in the nucleus.

[0052] Example 3: Obtaining Slmet11 knockout mutants and verifying their effects

[0053] 1. Preparation of Slmet1l knockout mutant

[0054] The mutants were constructed using the CRISPR / Cas9 system. Using pICH86966:AtU6p:sgRNA_PDS as a template, a pair of sgRNAs targeting SlMET1L were designed and amplified ( Figure 3 ). The PCR products containing each sgRNA and pICSL01009:AtU6p providing the Arabidopsis U6 promoter were cloned into the primary constructs pICH47751 and pICH47761 using BsaI and T4 DNA ligase. Together with the other primary sgRNA constructs (pICH47732:NOSp:NPTII, pICH47742:35S:Cas9) and the connector pICH41766, the primary sgRNA constructs were assembled into the secondary vector pAGM4723 using BpiI and T4 DNA ligase. Tomato was transformed using the Agrobacterium AGL1 strain containing the CRISPR / Cas9 construct. Regenerated plants with shoots and roots were transferred to soil for genotyping and identification. The primers and sequences of the positive plants are as follows:

[0055] CRISPR vector construction ( Figure 3 ):

[0056] MET1La_sg1

[0057] TGTGGTCTCAATTGATGTTGATGTTGTATGCGGGTTTTAGAGCTAGAAA TAGCAAG

[0058] MET1La_sg2

[0059] TGTGGTCTCAATTGATGAACTACCAAGCACGGAGTTTTAGAGCTAGAA ATAGCAAG.

[0060] Mutant genotyping and identification:

[0061] MET1La_WT_F

[0062] TAGGGTGATGTTGATGTTGTATG

[0063] MET1La_MU_F

[0064] TAGGGTGATGTTGATGCGGT

[0065] MET1La_R

[0066] ATCGCCCAAGGAAACCATTG.

[0067] 2. Real-time fluorescence quantitative PCR (qRT-PCR) detection of SLMET1L expression level

[0068] Total RNA was extracted from wild-type and mutant fruits, and the RNA solution that passed the quality inspection was reverse transcribed and synthesized into cDNA in one step, and the genomic gDNA was further removed and the first-strand cDNA was synthesized. According to the experimental design and calculation, a 15 μL reaction system was prepared in a 200 μL 96-well PCR plate, including SYBR qPCR Master Mix, ultrapure water, cDNA obtained in the previous step, and upstream and downstream primer pairs. The qRT-PCR machine experiment was performed using the conventional three-step ROX dye qRT-PCR mode. SlMET1L primers: upstream primer 5'-3'CATCAATGTCGAGCAAACGGAA; downstream primer 5'-3'AAACTCATCGTCGTCCCGAAA. Internal reference SlActin primers: upstream primer 5'-3'TGTCCCTATTTACGAGGGTTATGC; downstream primer 5'-3'CAGTTAAATCACGACCAGCAAGAT.

[0069] 3. Detection of DNA methylation levels in fruits of SlMET1L knockout mutants

[0070] Frozen tomatoes were crushed in liquid nitrogen, and the final precipitate was used to extract genomic DNA after pre-cleaning. DNA extraction was performed using the DNA silica membrane centrifugal column method. The genomic DNA that passed the quality inspection was appropriately diluted and the methylation level was measured using the MethylFlash methylated DNA quantification method. The genomic methylation level was finally measured by OD 450 The readings in nm were calculated.

[0071] Figure 4 aThe results showed that the ripening speed of tomato fruit was greatly slowed down after SlMET1L was knocked out. The wild-type fruit was completely red 30 days after flowering, but the mutant fruit was still completely green, indicating that SlMET1L can regulate the accumulation of tomato fruit color. Figure 4 b The results showed that the knockout effect of SlMET1L was significant in the fruit of the Slmet1l mutant, and the expression level was less than 20% of that of the wild type. Figure 4c The results showed that the DNA methylation level of tomato fruit was significantly reduced after SlMET1L knockout, which further coincided with the function of SlMET1L in maintaining and regulating DNA methylation levels.

[0072] Example 4: Detection of changes in fruit quality indicators of Slmet11 knockout mutants

[0073] The hardness was tested using a TA-XT2i texture analyzer with a flat probe of 5 mm in diameter. Each fruit was tested four times around the central area at a test speed of 0.5 mm / s and a test distance of 6 mm, and the maximum force was recorded. The soluble solids content was determined using a PAL-BX portable sugar meter according to its instructions.

[0074] Figure 5 a The results showed that compared with wild-type fruits, the soluble solids content of Slmet1l knockout mutant fruits was significantly reduced; Figure 5 b The results showed that the firmness of the Slmet1l knockout mutant fruit was significantly higher than that of the wild-type fruit. These results further indicated that the significant decrease in expression caused by SlMET1L knockout significantly slowed down the ripening process of tomato fruit.

[0075] Example 5: Construction of S1MET1L overexpressing fruit and detection of changes in quality indicators

[0076] 1. Construction of SlMET1L overexpression tomato fruit model

[0077] Vector construction: The pAEnTopo vector connected with SlMET1L-CDS was replaced with the pCambia-35S vector with kanamycin resistance (incubated at 50°C for 1 h) to obtain the pCambia-35S-SlMET1L recombinant plasmid, which was transformed into DH5α Escherichia coli competent cells. Single clones were picked in the resistant solid LB medium containing 50 mg / mL kanamycin for colony PCR screening and positive clones were sequenced for verification (colony PCR and sequencing primers: upstream primer 5'-3'acagtctcagaagaccaaaggg; downstream primer 5'-3'gcaagaccggcaacaggattca). After successful alignment, the recombinant plasmid was extracted.

[0078] Recombinant plasmid transformation: The successfully connected pCambia-35S-SlMET1L plasmid (and the pCambia-35S empty vector without SlMET1L-CDS) was transformed into GV3101 Agrobacterium competent cells. The transformed bacterial solution was spread on LB solid medium containing 50μg / mL kanamycin and 25μg / mL rifampicin antibiotics, and inverted in a 28℃ incubator for 2-3 days. Single colonies were picked and positive clones were screened by colony PCR (colony PCR and sequencing primers: upstream primer 5'-3'acagtctcagaagaccaaaggg; downstream primer 5'-3'gcaagaccggcaacaggattca) for sequencing verification. After successful sequencing, part of the corresponding bacterial solution was added with 50% glycerol at a ratio of 1:1 and stored in a -80℃ refrigerator.

[0079] Infection of strawberry fruit: Resuspend the recombinant plasmid Agrobacterium cultured in a 28°C shaker (220 rpm) for 2 days in a pre-prepared infection solution (1% sucrose, 10 mM MES, 10 mM MgCl2, 150 μM acetosyringone, pH = 5.6) to an OD of 600 = 0.8-1.0, then let stand at room temperature for 2 hours. Use a 1mL sterile syringe with a needle to inject the infection solution (recombinant plasmid and empty vector) into the tomato fruit or the stem segment above the fruit, and take samples after 3 days.

[0080] 2. The qRT-PCR detection part is the same as in Example 3. The soluble solids and hardness detection part is the same as in Example 4.

[0081] In the SlMET1L overexpression experiment, Figure 6 a shows that the expression level of SlMET1L in SlMET1L overexpressing fruits is more than 10 times that of wild-type fruits in the empty vector group, and the effect is significant. Figure 6 b The results showed that the soluble solid content of SlMET1L overexpressing fruits was significantly increased compared with that of wild-type fruits; Figure 6 c The results showed that the firmness of SlMET1L overexpressing fruits was significantly reduced compared with wild-type fruits. These results further indicated that SlMET1L overexpression significantly accelerated the ripening process of tomato fruits. In summary, SlMET1L can be applied to tomato fruit ripening and quality regulation and related breeding work.

[0082] S1MET1L CDS sequence (shown in SEQ ID NO.1)

[0083]

[0084] SlMET1L amino acid sequence (shown in SEQ ID NO.2)

[0085] MSSKRKASPADSSSDSSKRHALEVVKTVDIASDEVAEGFRDDDEFVEDRDIVCDSSIGESSGQKEVRRVAVRANEEQEGEFYGEIVLDSEARKKWPHRYILKDNVNINSASMSLNCQHDSDELIQAKCHFAQALVDNVIYKLGDDAYVKAAEDEDDYICKIVEFFQGVDDMKYFTAQWFYRAKDTVIKAHDQFIDKKRVFLSDIKDHNPLDCLVKKIKIVPISSNVSLQFKESLRLECDYYYDMKYLVPFSSFISLPSDVLSPDSESNSTISSDGDVVEVKEQKQEKKLLDLYSGCGGMSTGLCLGADVCDVKLVTKPSNTPTHPLLKVGDANVEDDDEGADDDDGGSGDEDEGEIFEVEEILEVCYGDPKEIKKPGLYFKVRWKGYGPDEDTWEPIEGLDGCQNKIKDFVTDGFKRSVLPLPGQVDVVCGGPPCQGISGFNRFRNSANPLQDPKNKQLEVFMSIVEFLKPRFVLMENVVDLLRFAHGYLGRYALSRLVGMNYQARMGMMVAGAYGLPQFRMRVFMWGALPSEKLPQYPLPTHNVIVRGGIPTEFELNAVDFEEGLKVKLKRELLLEDALSDLPPVENNEPRDEMPYIDEPKSVFQRFIRSRRDGTLGTVLYDHRPLQLNEDDYQRVTQIPKQKGANFRDLPGVRVRADNVVEWDPDMERVKLPSGKPLVPDYAMTFVRGTSQKPFGRLWWDEIVSTVVTRAEPHNQAILHPVQDRVLTIRENARLQGFPDYYKLTGPIKERYIQVGNAVAVPVARALGYSLALALKGLSRDQPLLTLPPNFPCLEELVSNDESLDKV*。

[0086] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made to the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A tomato S1MET1L gene, characterized in that: The tomato S1MET1L gene contains the nucleotide sequence described in (A1), (A2), (A3) or (A4): (A1) the nucleotide sequence shown in SEQ ID NO.1; (A2) a nucleotide sequence as shown in SEQ ID NO.1, wherein one or more bases are substituted and / or deleted and / or added, but the nucleotide sequence has the same function; (A3) a nucleotide sequence that is 70% or more identical to the nucleotide sequence shown in SEQ ID NO.1 and has the same function; (A4) A nucleotide sequence obtained by ligating a tag encoding sequence to the 5' segment and / or 3' end of any of the defined sequences (A1) to (A3).

2. The protein encoded by the tomato S1MET1L gene according to claim 1, characterized in that: The protein contains the amino acid sequence described in (B1), (B2), (B3) or (B4): (B1) the amino acid sequence shown in SEQ ID NO.2; (B2) a protein having the same function as the amino acid sequence shown in SEQ ID NO. 2, wherein one or more amino acid residues are substituted and / or deleted and / or added; (B3) an amino acid sequence that is 70% or more identical to the amino acid sequence shown in SEQ ID NO. 2 and has the same function; (B4) The amino acid sequence obtained by connecting a protein tag to the N-terminus and / or C-terminus of any of the proteins defined in (B1) to (B3).

3. Use of the tomato SlMET1L gene as claimed in claim 1 in regulating the ripening and preservation quality of tomato fruits.

4. The use according to claim 3, characterized in that The method of regulating tomato fruit ripening and fresh-keeping quality specifically includes at least one of the following: (1) Regulate the DNA methylation level of tomato fruit genome; (2) Regulate the ripening process of tomato fruit; (3) Regulate the accumulation of tomato fruit color; (4) Regulate tomato fruit firmness; (5) Regulate the soluble solids content of tomato fruit.

5. Use of the tomato S1MET1L gene as claimed in claim 1 as a target in tomato fruit ripening and fresh-keeping quality related breeding processes.

6. A method for promoting tomato fruit ripening or increasing tomato fruit color accumulation or increasing tomato fruit soluble solid content, characterized in that: include: Increase the expression level of the SlMET1L gene in tomatoes; or Increasing the activity of the protein encoded by the SlMET1L gene in tomatoes; or Increase the content of protein encoded by the SlMET1L gene in tomatoes.

7. A method for delaying the ripening of tomato fruits or reducing the color accumulation of tomato fruits or reducing the soluble solid content of tomato fruits, characterized in that: include: Knockout of the SlMET1L gene in tomato; or Silencing the SlMET1L gene in tomato; or Reducing the activity of the protein encoded by the SlMET1L gene in tomatoes; or Reduce the content of protein encoded by the SlMET1L gene in tomatoes.

Images