Application of apple C2H2 zinc finger protein transcription factor MdZAT1 gene in anthocyanin synthesis

Abstract

The invention discloses application of an apple C2H2 zinc finger protein transcription factor MdZAT1 gene in anthocyanin synthesis, and belongs to the technical field of plant genetic engineering. According to the invention, a C2H2 zinc finger protein transcription factor MdZAT1 gene is separated from apples, and experiments find that the expression quantity of the MdZAT1 gene is in negative correlation with the anthocyanin content of fruits in the development period of the apples. The MdZAT1 is over-expressed in the apple callus to inhibit the synthesis of anthocyanin; instantaneous overexpression and silence experiments in apple peel find that MdZAT1 is a negative regulator for accumulation of anthocyanin in the apple peel. Yeast single hybridization, EMSA and dual luciferase experiments verify that the MdZAT1 protein is combined with the MdMYB114, the MdCHI and the MdANS, and the MdMYB114, the MdCHI and the MdANS are negatively regulated and controlled. The MdZAT1 gene has a practical application value for regulating and controlling the anthocyanin of the apple fruits, and provides a basis for improving the appearance quality of the apple fruits.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to application of apple C2H2 zinc finger protein transcription factor MdZAT1 gene in anthocyanin synthesis. Background Art

[0002] As one of the important economic fruit trees in my country, apple ranks first in terms of planting area and output. China's apple industry has developed rapidly, but overall, the industry's competitiveness is weak and the overall quality of the fruit is poor. Fruit coloring affects the appearance quality of the fruit, which mainly depends on anthocyanins. Anthocyanins give plants different colors, which help attract insects or birds for pollination and animals to spread seeds. Anthocyanins can also protect plants from low temperatures, high light, fungi and other microorganisms. In addition to the above effects, in terms of nutritional value, anthocyanins can also be used as a natural antioxidant to clean free radicals and reactive oxygen in cells, which is of great benefit to human health. Therefore, it is of great significance to carry out research on apple anthocyanins.

[0003] The direct precursor of anthocyanin synthesis is phenylalanine. A series of enzymes are involved in the synthesis of phenylalanine into anthocyanin. The genes encoding the enzymes involved in this pathway are called structural genes, which can be divided into early structural genes and late structural genes. Among them, the early structural genes include chalcone synthase (CHS), chalcone isomerase (CHI) and flavanone 3-hydroxylase (F3H), while the late structural genes include dihydroflavonoid 4-reductase (DFR), anthocyanin synthase (ANS) and flavonoid glucosyltransferase (UFGT). The synthesis of anthocyanins is regulated by transcription factors. The regulation of anthocyanin synthesis by transcription factors mostly affects the biosynthesis of anthocyanins by regulating the expression of structural genes. At present, the MYB / bHLH / WD40 (MBW) complex is the most studied. For example, in Arabidopsis, GbMYBF2 can negatively regulate the biosynthesis of anthocyanins by downregulating the expression of structural genes CHS, F3H, ANS and FLS; in apple, homologous MYB1, MYB10 and MYBA are involved in the biosynthesis of anthocyanins and positively regulate the accumulation of anthocyanins.

[0004] Little is known about the molecular mechanism of C2H2-type zinc finger protein transcription factors and anthocyanins. C2H2-type zinc finger transcription factors are the largest zinc finger family in plants. More and more studies have shown that C2H2-type zinc finger protein transcription factors are also involved in the biosynthesis of anthocyanins. For example, in Arabidopsis, AtZAT6 positively regulates the biosynthesis of anthocyanins by activating the transcription of AtDFR, AtMYB12, and AtMYB111 to promote their expression. In pear, the C2H2-type zinc finger protein PpZAT5, as a transcriptional repressor, inhibits the accumulation of anthocyanins by regulating the expression of PpBBX18. In addition, PbZAT12 can upregulate the expression of PbDFR, PbANS, and PbUFGT genes to promote the accumulation of pear anthocyanins. In apple callus, MdZAT5 can activate the expression of anthocyanin biosynthesis-related genes and promote the biosynthesis of anthocyanins. Previous studies have found that the MYB transcription factor MdMYB114 can promote the accumulation of anthocyanins in callus tissue. Studies have shown that MdMYB114 can activate the expression of anthocyanin-related genes MdANS, MdUFGT and MdGST, not only positively regulating the biosynthesis of anthocyanins, but also regulating the transport of anthocyanins. MdMYB114 is considered to be another important apple anthocyanin regulatory factor besides MdMYB1. In order to study the upstream regulatory mechanism of MdMYB114, the inventors conducted a yeast single hybrid screening library experiment and screened a C2H2-type zinc finger protein named MdZAT1. Whether it will regulate the biosynthesis of anthocyanins through MdMYB114 needs further study.

[0005] In view of the above-mentioned defects, the present invention is obtained through long-term research and practice of the creators. Summary of the invention

[0006] The purpose of the present invention is to provide an application of the apple C2H2 zinc finger protein transcription factor MdZAT1 gene in anthocyanin synthesis to solve the problems existing in the above-mentioned prior art. The MdZAT1 gene is negatively correlated with anthocyanin synthesis in apple fruit, which provides a theoretical basis for improving and enhancing the appearance quality of apple fruit.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides an application of an apple C2H2 zinc finger protein transcription factor MdZAT1 gene in any of the following:

[0009] (1) Application in regulating anthocyanin synthesis in apple fruit;

[0010] (2) Application in regulating the appearance quality of apple fruit;

[0011] (3) Application in apple variety improvement;

[0012] Wherein, the nucleotide sequence of the MdZAT1 gene is the sequence shown in SEQ ID NO.1 or a fragment thereof.

[0013] The present invention also provides the use of the protein encoding the MdZAT1 gene in any of the following:

[0014] (1) Application in regulating anthocyanin synthesis in apple fruit;

[0015] (2) Application in regulating the appearance quality of apple fruit;

[0016] (3) Application in apple variety improvement.

[0017] The present invention also provides use of a vector comprising the MdZAT1 gene in any of the following:

[0018] (1) Application in regulating anthocyanin synthesis in apple fruit;

[0019] (2) Application in regulating the appearance quality of apple fruit;

[0020] (3) Application in apple variety improvement.

[0021] The present invention also provides the use of a recombinant bacterium comprising the vector in any of the following:

[0022] (1) Application in regulating anthocyanin synthesis in apple fruit;

[0023] (2) Application in regulating the appearance quality of apple fruit;

[0024] (3) Application in apple variety improvement.

[0025] Optionally, the MdZAT1 gene negatively regulates anthocyanin synthesis in apple fruit. Preferably, the negative regulation includes: overexpressing the MdZAT1 gene to reduce the amount of anthocyanin synthesis in apple fruit; and silencing the MdZAT1 gene to increase the amount of anthocyanin synthesis in apple fruit.

[0026] The present invention also provides a method for inhibiting anthocyanin synthesis in apple fruit, comprising the steps of constructing the recombinant bacteria, and transferring the recombinant bacteria into apples to overexpress the MdZAT1 gene, wherein the nucleotide sequence of the MdZAT1 gene is the sequence shown in SEQ ID NO.1 or a fragment thereof.

[0027] Optionally, the fragment includes a fragment having a nucleotide sequence as shown in SEQ ID NO.2.

[0028] The present invention also provides a method for improving anthocyanin synthesis in apple fruit, comprising the steps of constructing the recombinant bacteria, and transferring the recombinant bacteria into apples to inhibit the expression of the MdZAT1 gene, wherein the nucleotide sequence of the MdZAT1 gene is the sequence shown in SEQ ID NO.1 or a fragment thereof.

[0029] Optionally, the fragment includes a fragment having a nucleotide sequence as shown in SEQ ID NO.2.

[0030] The present invention discloses the following technical effects:

[0031] (1) The present invention is conducive to clarifying the mechanism of action of the MdZAT1 gene in regulating the synthesis of anthocyanins in apple peel from a molecular mechanism, providing a theoretical basis and genetic resources for molecular breeding of anthocyanin accumulation in apple peel, and providing new genetic resources for the implementation of green agriculture. The development and utilization of this genetic resource is conducive to reducing agricultural costs and achieving environmental friendliness.

[0032] (2) The apple transient injection experiment, physiological data measurement and gene expression analysis showed that overexpression of MdZAT1 could significantly inhibit fruit coloring, and the content of anthocyanins and the relative expression of biosynthesis-related genes were significantly downregulated. However, silencing MdZAT1 could promote the accumulation of anthocyanins in fruits. The content of anthocyanins was significantly higher than that of the control, and the relative expression of anthocyanin biosynthesis-related genes was significantly upregulated, indicating that MdZAT1 has a significant effect in inhibiting anthocyanin synthesis.

[0033] (3) The present invention overexpressed MdZAT1 in apple callus to verify its function of inhibiting anthocyanin biosynthesis. Compared with the wild type, the transgenic callus was lighter in color and had a lower content of anthocyanins. The biological function verification showed that the MdZAT1 cloned in the present invention interacted with the MdCHI, MdANS and MdMYB114 genes to inhibit the biosynthesis of anthocyanins in pear peel.

[0034] (4) Genetic engineering techniques can be used to introduce the MdZAT1 gene of the present invention into apple varieties with low anthocyanin content to improve apple varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0036] Figure 1The results of the cloned sequence analysis of MdZAT1; wherein: (A) electrophoresis of the cloned MdZAT1 gene, (B) phylogenetic tree of C2H2-type zinc finger protein sequences of different species, (C) schematic diagram of the C2H2-type zinc finger domain contained in MdZAT1 between the 183rd and 205th amino acids, (D) multiple alignment results of homologous C2H2-type zinc finger protein amino acid sequences;

[0037] Figure 2 The subcellular localization of MdZAT1 fusion protein in tobacco leaves;

[0038] Figure 3 Verification of the interaction between MdZAT1 and MdMYB114 promoter; (A) Yeast one-hybrid assay verified the interaction between MdZAT1 and MdMYB114 promoter, (B) EMSA assay verified that MdZAT1 bound to MdMYB114 promoter, (C) Dual luciferase reporter assay in tobacco leaves verified that MdZAT1 regulated the activity of MdMYB114 promoter;

[0039] Figure 4 Analysis of anthocyanin content and related gene expression; (A) Phenotypes of fruits at 0 days (0DFBR), 6 days (6DFBR), 12 days (12DFBR) and 18 days (18DFBR) after bagging; (B) Anthocyanin content in peel; (C) Relative expression of MdZAT1; (D) Relative expression of MdMYB114; (E)-(F) Expression patterns of structural genes MdCHS, MdCHI, MdF3H, MdDFR, MdANS, MdUFGT, MdMYB1, MdbHLH3, MdbHLH33 and MdGST during the accumulation of anthocyanins in apple; Different letters represent significant differences between different stages; (G) Correlation analysis between MdZAT1 expression and anthocyanin content;

[0040] Figure 5 Effects of MdZAT1 on the accumulation of anthocyanins in apple callus; wherein: (A) phenotypes of wild-type and transgenic apple callus overexpressing MdZAT1 (MdZAT1-OE), (B) verification of gene expression in MdZAT1-OE transgenic apple callus at the DNA level, (C) verification of relative gene expression in MdZAT1-OE transgenic apple callus at the RNA level, (D) anthocyanin content in apple callus, (E) relative expression levels of anthocyanin-related genes in MdZAT1-OE callus and wild-type callus;

[0041] Figure 6MdZAT1 overexpression inhibits anthocyanin biosynthesis in apple peel; wherein: (A) phenotype of apple fruit overexpressing MdZAT1, (B) anthocyanin content in apple peel after transient overexpression of MdZAT1, (C) expression of anthocyanin biosynthesis-related genes in MdZAT1 overexpressed and control apple peels;

[0042] Figure 7 MdZAT1 silencing promotes the biosynthesis of anthocyanins in apple peel; wherein: (A) phenotype after silencing MdZAT1 in apple peel, (B) anthocyanin content after silencing MdZAT1 in apple peel, (C) expression of anthocyanin-related genes in MdZAT1-silenced and control apples;

[0043] Figure 8 MdZAT1 binds to the promoters of MdCHI and MdANS to inhibit their expression; wherein: (A) yeast one-hybrid assay verifies the interaction between MdZAT1 and the MdCHI and MdANS promoters, (B) EMSA assay verifies the analysis of MdZAT1 binding to the MdANS and MdCHI promoters, (C) dual luciferase reporter assay in tobacco leaves verifies that MdZAT1 regulates the activity of the MdCHI and MdANS promoters. DETAILED DESCRIPTION

[0044] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0045] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0046] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0047] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0048] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0049] MdMYB114 is considered to be another important apple anthocyanin regulatory factor besides MdMYB1. In order to study the upstream regulatory mechanism of MdMYB114, the present invention screened a C2H2-type zinc finger protein named MdZAT1 (nucleotide sequence as shown in SEQ ID NO: 1) through yeast single hybrid screening library experiment, and found through experiments that MdZAT1 gene expression is negatively correlated with anthocyanin synthesis.

[0050] Example 1 Cloning of MdZAT1

[0051] (I) RNA extraction and reverse transcription from ‘Fuli’ apple fruit

[0052] 1. Plant Total RNA Extraction

[0053] Use the polysaccharide and polyphenol plant total RNA extraction kit from Tiangen Biochemical Technology (Beijing) Co., Ltd. Follow the instructions and the specific steps are as follows:

[0054] 1) Add about 100 mg of tissue sample into a mortar filled with liquid nitrogen and grind thoroughly.

[0055] 2) Add 500 μL SL lysis buffer to the centrifuge tube, quickly add tissue sample powder, and immediately vortex to mix.

[0056] 3) Centrifuge at 12000 rpm for 2 min.

[0057] 4) Add the supernatant to the filter column CS placed in the collection tube and centrifuge at 12000 rpm for 2 minutes.

[0058] 5) Slowly add the supernatant in the collection tube into a centrifuge tube containing 0.4 times the volume of the supernatant, and mix by inverting.

[0059] 6) Add all the contents in the centrifuge tube in the previous step to the adsorption column CR3, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid.

[0060] 7) Add 350 μL of deproteinized solution RW1 to the adsorption column CR3, centrifuge at 12000 rpm for half a minute, and discard the waste liquid.

[0061] 8) Add 80 μL of DNase I working solution (10 μL DNase I + 70 μL RDD buffer) and let stand at room temperature for 15 min.

[0062] 9) Add 350 μL of deproteinized solution RW1, centrifuge at 12000 rpm for 15 s, and discard the waste liquid.

[0063] 10) Add 500 μL of rinse solution RW to the adsorption column CR3, centrifuge at 12000 rpm for 15 s, and discard the waste liquid.

[0064] 11) Repeat 10).

[0065] 12) Centrifuge at 12000 rpm for 2 min.

[0066] 13) Place the adsorption column in a new centrifuge tube and add 35 μL RNase-Free ddH 2 O, let stand for 2 min, centrifuge at 12000 rpm for 1 min, discard the adsorption column to obtain RNA solution.

[0067] 2. Reverse transcription of RNA into cDNA

[0068] Using PrimeScript from Bio-Tech (Beijing) Co., Ltd. TM RT reagent Kit (PerfectReal Time) reverse transcription kit. The specific steps are:

[0069] 1) Prepare RT reaction solution on ice throughout the process.

[0070] The reverse transcription reaction system is shown in Table 1.

[0071] Table 1 Reverse transcription reaction system

[0072]

[0073] 2) After the reaction solution is mixed, it is reacted in a PCR instrument. First, the reaction is carried out at 37°C for 15 minutes, which is the reverse transcription reaction; then the reverse transcriptase is inactivated at 85°C for 5 seconds; finally, the cDNA solution is obtained at 4°C and stored at -20°C.

[0074] (II) Cloning of the full-length MdZAT1 gene

[0075] The cDNA prepared above was used as a template and 2×PhantaMax Master Mix (Dye Plus) from Nanjing Novozyme Biotechnology Co., Ltd. was used for the operation on ice. The primers for the upstream and downstream genes of MdZAT1 are as follows:

[0076] MdZAT1-F: 5'-ATGCCTAAGGATAGGAGGGG-3';

[0077] MdZAT1-R: 5'-TCACGGCTGGTTGTTGTC-3'.

[0078] The gene cloning reaction system is shown in Table 2.

[0079] Table 2 Gene cloning reaction system

[0080]

[0081] Add the system to a sterile centrifuge tube, flick to mix, centrifuge briefly, and place in a PCR instrument.

[0082] PCR reaction program: 95°C for 3 min; 95°C for 30 s, 55°C for 15 s, 72°C for 2 min, 35 cycles; 72°C for 5 min; and storage at 4°C.

[0083] After the PCR reaction, the PCR product was recovered, connected to the intermediate vector pLB, transformed into Escherichia coli DH5α, and spread on LB solid culture medium supplemented with 50 mg / L ampicillin. It was cultured at 37°C overnight until a single colony grew. The 2×Accurate Taq premix of Hunan Aikerui Biotechnology Co., Ltd. was used for bacterial liquid PCR verification, and Sangon Biotechnology (Shanghai) Co., Ltd. was commissioned to carry out sequence determination.

[0084] (III) Cloning of the MdZAT1 gene-specific fragment

[0085] The cDNA prepared above was used as a template and amplified using 2×PhantaMax Master Mix (Dye Plus) from Nanjing Novozyme Biotechnology Co., Ltd. The primers for the upstream and downstream genes of the MdZAT1 specific fragment are as follows:

[0086] MdZAT1-pTRV2-F: 5'-CTGATCCGAAGCTAGTGTGC-3';

[0087] MdZAT1-pTRV2-R: 5'-TACCAGACCAGCTGCTGCT-3';

[0088] The amplification step and PCR reaction procedure are the same as step (ii) of Example 1.

[0089] After the PCR reaction, the PCR product was recovered, connected to the cloning vector pLB, transformed into Escherichia coli DH5α, spread on LB solid medium supplemented with 50 mg / L ampicillin, and cultured at 37°C overnight until a single colony grew. The 2×Accurate Taq premix of Hunan Aikerui Biotechnology Co., Ltd. was used for bacterial liquid PCR verification, and Sangon Biotechnology (Shanghai) Co., Ltd. was commissioned to determine the sequence.

[0090] The results are as follows Figure 1 As shown, the present invention successfully cloned the MdZAT1 gene (see Figure 1 The C2H2 zinc finger protein sequences of different species were analyzed and a phylogenetic tree was constructed (see Figure 1 (B) Analysis of the amino acid sequence of MdZAT1 revealed that MdZAT1 contains a predicted C2H2-type zinc finger domain between amino acids 183 and 205. Multiple alignments of amino acid sequences of homologous C2H2-type zinc finger proteins, C2H2 conserved domains are shown in Figure 1 Middle D (highlighted by a box);

[0091] Example 2 Construction of MdZAT1 gene-related vector

[0092] The full-length cDNA sequence of the MdZAT1 gene obtained in Example 1 was amplified using primer sequences of MdZAT1-pCAMBIA2300-F: 5'-AGAACACGGGGGACTCTAGAATGCCTAAGGATAGGAGGGG-3' and MdZAT1-pCAMBIA2300-R: 5'CCCTTGCTCACCATCCCGGGTCACGGCTGGTTGTTGTCCG-3' with XbaⅠ and SmaⅠ restriction sites, respectively, and connected to the cloning vector pCAMBIA2300-EGFP with reference to the gene cloning method in Example 1 to obtain the fusion plasmid MdZAT1-pCAMBIA2300 (XbaⅠ, SmaⅠ) to produce the MdZAT1 green fluorescent protein (GFP) fusion protein construct. The construct was transformed into Escherichia coli DH5α, and the recombinant plasmid MdZAT1-pCAMBIA2300 was extracted from the single colonies with correct sequencing.

[0093] Example 3 Subcellular localization of MdZAT1 gene

[0094] The recombinant plasmid MdZAT1-pCAMBIA2300 prepared in Example 2 was transferred into GV3101 Agrobacterium by freeze-thaw method, and infected fresh tobacco leaves, which were observed using a fully automatic intelligent living cell fluorescence microscopy imaging system. The specific steps are as follows:

[0095] 1) Activate MdZAT1-pCAMBIA2300 and pCAMBIA2300 Agrobacterium strains. Take about 20 μL of bacterial solution in 10 mL centrifuge tubes, add 2 mL of LB liquid culture medium containing kanamycin and rifampicin, and culture at 28°C in a shaking incubator for 12 h to activate the strains.

[0096] 2) Take 1 mL of activated bacterial solution and place it in a 100 mL conical flask, add 30 mL of LB liquid medium containing kanamycin and rifampicin, and continue to culture in a shaking incubator at 28°C until OD 600nm =0.6-0.8.

[0097] 3) Transfer all bacterial suspensions to 50 mL centrifuge tubes, centrifuge at 5000 rpm at 28°C for 10 min, and discard the supernatant.

[0098] 4) Add 30 mL of ultrapure water to each centrifuge tube, pipette and mix. Centrifuge at 28°C, 5000 rpm for 10 min, and discard the supernatant.

[0099] 5) Add 8 mL of tobacco resuspension to each centrifuge tube and mix well by pipetting. The formula of tobacco resuspension (100 mL) is shown in Table 3 below.

[0100] Table 3 Tobacco resuspension formula

[0101]

[0102] 6) The resuspended solution was injected into the third, fourth and fifth leaves of three tobacco plants respectively (back side).

[0103] 7) Place the tobacco in a dark place for 12 hours, and then culture under normal light for 2-3 days.

[0104] 8) The injected leaves were picked and observed using a fully automatic intelligent living cell fluorescence microscopy system.

[0105] The results showed that MdZAT1-GFP was localized in the cell nucleus. Figure 2 , scale bar is 50 μm.

[0106] Example 4 Verification of the interaction between MdZAT1 and MdMYB114 promoters.

[0107] In order to verify the interaction between MdZAT1 and MdMYB114, the primer sequences of MdZAT1-pGADT7-F: 5'-GGATCCATGCCTAAGGATAGGAGGGG-3' and MdZAT1-pGADT7-R: 5'-GAGCTCTCACGGCTGGTTGTTGTC-3' with NdeI and BamHI restriction sites were used for amplification, and the gene was ligated to the cloning vector pGADT7 with reference to the gene cloning method in Example 1 to obtain the fusion plasmid MdZAT1-pGADT7 (NdeI, BamHI). Amplification was performed using primer sequences MdMYB114-pHIS2-F: 5'-ACTCACTATAGGGCGAATTCCCGATATTATCGATATTTTGGTCCATGG3' and MdMYB114-pHIS2-R: 5'-ATTCGCGAACGCGTGAGCTCTCTCTTATCTGCCTGCTAGCCAC-3' with EcoRI and SacI restriction sites, respectively. Referring to the gene cloning method in Example 1, the gene was ligated to the cloning vector pHIS2. The MdZAT1-pGADT7 and MdMYB114-p-pHIS2 vector plasmids were co-transformed into the yeast strain Y187. The control was the pGADT7 and MdMYB114-p-pHIS2 vector plasmids co-transformed into the yeast strain Y187. The bacterial solution was spread on a solid culture medium (yeast defective culture medium: SD / -Trp-His-Leu). It was observed that the yeast plaques containing MdZAT1-pGADT7 and MdMYB114-pHIS2 grew on SD / -Trp / -His / -Leu with a concentration of 100 mM 3-amino-1,2,4-triazole (3-AT). The results showed that there was an interaction between the promoters of MdZAT1 and MdMYB114, see Figure 3 A in.

[0108] EMSA was used to verify the interaction between MdZAT1 and the MdMYB114 promoter. MdZAT1 was cloned into the pET32a protein expression vector containing a His tag to construct MdZAT1-pET32a. The recombinant vector plasmid was transformed into Escherichia coli BL21 (DE3) by heat shock method to induce protein prokaryotic expression. The results of the EMSA experiment showed that MdZAT1 could bind to the promoter of MdMYB114. The results showed that MdZAT1 could specifically bind to the TTGGGT sequence of the MdMYB114 promoter, see Figure 3 B in.

[0109] In order to further study the regulatory activity of MdZAT1 on the MdMYB114 promoter, the promoter sequence of MdMYB114 was cloned and amplified using primer sequences of MdZAT1-pGreenⅡ62-SK-F: 5'-GCTCTAGAACTAGTGGATCCATGCCTAAGGATAGGAGGGG3' and MdZAT1-pGreenⅡ62-SK-R: 5'-TCGACGGTATCGATAAGCTTTCACGGCTGGTTGTTGTCCG-3' with BamHI and HanIII restriction sites, respectively. Referring to the gene cloning method in Example 1, the gene was ligated to the cloning vector pGreenII 62-SK to obtain the fusion plasmid MdZAT1-pGreenII 62-SK (BamHI, HanIII). The pMdMYB114-LUC (BamHI, SalI) plasmid was obtained by using MdMYB114-pGreenⅡ0800-F: 5'-TCGACGGTATCGATAAGCTTCCGATATTATCGATATTTTG-3' and MdMYB114-pGreenⅡ0800-R: 5'-GCTCTAGAACTAGTGGATCCTCTCTTATCTGCCTGCTAGC-3' with BamHI and SalI restriction sites respectively, and transformed into GV3101 with pSoup+P19, and co-injected into tobacco leaves for observation, using pMdMYB114-LUC and pGreen62-SK as controls. The results showed that when pMdMYB114-LUC and pGreen62-SK-MdZAT1 were co-expressed in tobacco leaves, the luminescence signal was weaker than the control, and the activity of the MdMYB114 promoter was inhibited. The results showed that MdZAT1 down-regulated the expression of the MdMYB114 promoter. The above results indicate that MdZAT1 can inhibit the expression of MdMYB114 by directly binding to the MdMYB114 promoter. Figure 3 B in.

[0110] Example 5 Analysis of anthocyanin content and related gene expression

[0111] In order to further explore the relationship between MdZAT1 and anthocyanin biosynthesis, the present invention selected 'Fuli' apples, and measured the anthocyanin content and the relative expression of related genes during the coloring period of the apples after bagging, to explore the relationship between MdZAT1 and anthocyanin biosynthesis. The peels were sampled 0, 6, 12 and 18 days after bagging, and the anthocyanin content was measured. The determination method is as follows:

[0112] 1) Grind the sample tissue into powder in a mortar filled with liquid nitrogen.

[0113] 2) Weigh 0.5 g and add it into a centrifuge tube containing 10 mL of 10% hydrochloric acid methanol, wrap it with tin foil, and extract it at 4°C in the dark for 24 h.

[0114] 3) Remove the tin foil and centrifuge at 8000 rpm at 4°C for 10 min.

[0115] 4) Add 4 mL of 0.4 M sodium acetate (NaAC) buffer (pH = 4.5) and 4 mL of 0.025 M KCl buffer (pH = 1.0) to the centrifuge tubes, add 1 mL of the supernatant obtained in the previous step, and let stand at room temperature for 15 min.

[0116] 5) Measure the absorbance of each tube at 510 nm and 700 nm.

[0117] The formula is: ΔA=(A 510 -A 700 ) (pH＝1.0) -(A 510 -A 700 ) (pH＝4.5)

[0118] Anthocyanin content = ΔA*5*0.005*1000*449.2 / (26900*0.5)

[0119] In the anthocyanin content calculation formula, 5 represents the dilution multiple; 0.005 represents the dilution volume; 1000 represents the unit conversion; 449.2 is the molecular weight of anthocyanin; 0.5 represents the sample mass; and 26900 represents the extinction coefficient.

[0120] RNA from the peel was extracted and reverse transcribed into cDNA in the same manner as step (i) in Example 1. The expression levels of anthocyanin-related genes and MdZAT1 were measured using a fluorescent quantitative PCR instrument. The specific primers for the MdZAT1 gene are MdZAT1-F and MdZAT1-R. Specific primers were designed in the non-conserved regions of the MdMYB114, MdCHS, MdCHI, MdF3H, MdDFR, MdANS, MdUFGT, MdMYB1, MdbHLH3, MdbHLH33 and MdGST genes, as well as the internal reference primers MdActin-F and MdActin-R for apple, and the sequences are as follows:

[0121] MdCHS-F: 5'-GGAGACAACTGGAGAAGGACTGGAA-3';

[0122] MdCHS-R: 5'-CGACATTGATACTGGTGTCTTC-3';

[0123] MdCHI-F:5’-GGGATAACCTCGCGGCCAAA-3’;

[0124] MdCHI-R:5’-GCATCCATGCCGGAAGCTACAA-3’;

[0125] MdF3H-F:5’-TGGAAGCTTGTGAGGACTGGGGT-3’;

[0126] MdF3H-R:5’-CTCCTCCGATGGCAAATCAAAGA-3’;

[0127] MdDFR-F:5’-GATAGGGTTTGAGTTCAAGTA-3’;

[0128] MdDFR-R:5’-TCTCCTCAGCAGCCTCAGTTTTCT-3’;

[0129] MdANS-F:5’-CCAAGTGAAGCGGGTTGTGCT-3’;

[0130] MdANS-R:5’-CAAAGCAGGCGGACAGGAGTAGC-3’;

[0131] MdUFGT-F:5’-CCACCGCCCTTCCAAACACTCT-3’;

[0132] MdUFGT-R:5’-CACCCTTATGTTACGCGGCATGT-3’;

[0133] MdGST-F:5’-AGTTGTAGAAGATGGTGACT-3’;

[0134] MdGST-R:5’-CAGGTCGTTGAAGTTGTG-3’;

[0135] MdMYB1-F:5’-TGCCTGGACTCGAGAGGAAGACA-3’;

[0136] MdMYB1-R:5’-CCTGTTTCCCAAAAGCCTGTGAA-3’;

[0137] MdMYB114-F:5’-ATTAAGATGGTTGAACTATC-3’;

[0138] MdMYB114-R:5’-GAAGCCTAATCGTAAGAT-3’;

[0139] MdbHLH3-F: 5'-ACCACCTCAGCCAGAACCT-3';

[0140] MdbHLH3-R: 5'-CCTTCACCTTGGCTCTTAGTT-3';

[0141] MdbHLH33-F: 5'-TCCGACAGAAGACTCCATGATG-3';

[0142] MdbHLH33-R: 5'-CGTGTTTAGCAAAAGAGTGAGCC-3';

[0143] MdActin-F: 5'-TGACCGAATGAGCAAGGAAATTACT-3';

[0144] MdActin-R: 5'-TACTCAGCTTTTGGCAATCCACATC-3'.

[0145] The results showed that the content of anthocyanins gradually increased with the development of the fruit. The expression levels of MdMYB1, MdbHLH3, MdCHI, MdCHS, MdDFR and MdANS were the highest at 6 days after bagging, while the relative expression levels of MdbHLH33, MdGST, MdF3H and MdUFGT were the highest at 12 days after bagging. The relative expression level of MdMYB114 increased with the increase of bagging days, while the relative expression trend of MdZAT1 was the opposite, see Figure 4 The results showed that MdZAT1 was highly negatively correlated with anthocyanin biosynthesis, see Figure 4 G.

[0146] Example 6: MdZAT1 inhibits the accumulation of anthocyanins in apple callus

[0147] In order to further study the function of MdZAT1 in anthocyanin biosynthesis, the cDNA specific fragment of the MdZAT1 gene obtained in step (iii) of Example 1 was amplified using primer sequences MdZAT1-pRI101-F: 5'-GTCGACATGCCTAAGGATAGGAGGGG-3' and MdZAT1-pRI101-R: 5'-GGATCCCGGCTGGTTGTTGTCC-3' with SalⅠ and BamHI restriction sites, respectively, and ligated to the cloning vector pLB with reference to the gene cloning method in step (ii) of Example 1 to obtain the fusion plasmid MdZAT1-pLB (SalⅠ, BamHI). Then, the empty vector pRI101 and MdZAT1-pLB (SalⅠ, BamHI) were digested with restriction endonucleases SalⅠ and BamHI, respectively, subjected to agarose gel electrophoresis, gel recovery, and the linear pRI101 vector and the target gene MdZAT1 specific fragment were connected with T4-DNA ligase, transformed into Escherichia coli DH5α, and the recombinant plasmid MdZAT1-p-pRI101 was extracted from the single colonies with correct sequencing.

[0148] The above recombinant plasmids were transferred into LBA4404 Agrobacterium by freeze-thaw method, and used to infect 'Wanglin' ​​callus to obtain MdZAT1 overexpression transgenic callus. MdZAT1-OE transgenic callus was identified at DNA and RNA levels.

[0149] PCR amplification was performed using the upstream and downstream primers of MdZAT1-pRI101. The results are shown in Figure 5 B, in ddH 2 The PCR products using DNA from MdZAT1-OE callus and 'Wang Lin' callus as templates had no target bands; the PCR products using DNA from MdZAT1-OE callus and MdZAT1-pRI101 recombinant vector plasmid as templates had target bands, indicating that the transgenic callus obtained in the present invention was MdZAT1-OE. RNA from transgenic and 'Wang Lin' callus was extracted separately. Figure 5 C, the relative expression level of MdZAT1 in transgenic callus was significantly higher than that in 'Wanglin' ​​callus, and MdZAT1-OE transgenic callus was further verified. Figure 5 As shown in A, the coloration of 'Wang Lin' callus is significantly stronger than that of MdZAT1-OE transgenic callus. Anthocyanin extraction and anthocyanin content determination were performed on them. The determination method was the same as that in Example 5. The results were consistent with the phenotype. The anthocyanin content of MdZAT1-OE transgenic callus was significantly lower than that of the control. Figure 5 D. The relative expression levels of anthocyanin-related genes in MdZAT1-OE callus were significantly lower than those in wild-type callus, see Figure 5 Middle E. The results showed that overexpression of MdZAT1 could inhibit the accumulation of anthocyanins in callus tissue.

[0150] Example 7: Overexpression of MdZAT1 inhibits the biosynthesis of anthocyanins in apple peel

[0151] In order to further verify the function of MdZAT1 in anthocyanin synthesis, the MdZAT1-pRI101 vector plasmid in Example 6 was transformed into Agrobacterium GV3101 and then transiently transformed into the pericarp. Figure 6 A; transient overexpression of MdZAT1 in the pericarp resulted in a significantly lower content of anthocyanins than that in the control, as shown in Figure 6 B. The expression of anthocyanin-related genes in the peel samples transiently overexpressing MdZAT1 was inhibited, and MdANS, MdUFGT, MdGST and MdbHLH3 were significantly downregulated, see Figure 6 C.

[0152] Example 8 Silencing of MdZAT1 promotes the biosynthesis of anthocyanins in apple peel

[0153] The virus-induced gene silencing (VIGS) system was used to inhibit the expression of MdZAT1 in the pericarp. The gene fragment of the specific fragment nucleotide sequence (SEQ ID NO. 2) in MdZAT1 was amplified using primer sequences MdZAT1-pTRV2-F and MdZAT1-pTRV2-R with restriction sites BamHI and XhoI, respectively. The method was the same as step (iii) of Example 1. The MdZAT1-pTRV2 vector was constructed, and the vector plasmid was transformed into Agrobacterium GV3101, and then transiently transformed into the pericarp with pTRV1 as an auxiliary vector. Figure 7 A; transient silencing of MdZAT1 in the pericarp resulted in a significantly higher content of anthocyanins than that in the control, as shown in Figure 7 B. The expression of anthocyanin-related genes in the peel samples of MdZAT1 transiently silenced was significantly upregulated, see Figure 7 The above results indicate that MdZAT1 is a negative regulator of anthocyanin accumulation in fruits.

[0154] Example 9: MdZAT1 binds to the promoters of MdCHI and MdANS to inhibit their expression

[0155] To investigate how MdZAT1 affects anthocyanin biosynthesis, we tested whether MdZAT1 binds to the promoters of MdCHI, MdCHS, MdF3H, MdDFR, MdANS, MdUFGT, MdMYB1, MdbHLH3, MdbHLH33, and MdGST, based on the differences in the expression of anthocyanin biosynthesis-related genes in transgenic materials. Yeast one-hybrid assays were performed to investigate the potential interactions of MdZAT1 with each promoter. Primers with EcoRI and SacI restriction sites were used to construct the promoter-pHIS2 vector. The primer sequences are as follows:

[0156] MdCHI-pHIS2-F: 5'-GAATTCTTCCGCTGCGGTGG-3';

[0157] MdCHI-pHIS2-R: 5'-GAGCTCTATAGCATTAATTAATGGGTGGGA-3';

[0158] MdCHS-pHIS2-F: 5'-GAATTCGAACCCAGAACGCATGAGT-3';

[0159] MdCHS-pHIS2-R: 5'-GAGCTCGAGATACAACTGCGAGCGAC-3';

[0160] MdDFR-pHIS2-F: 5'-GAATTCCTGTTCGTTTGTAATGGCAT-3';

[0161] MdDFR-pHIS2-R: 5'-GAGCTCATCTTGTGTGTATGTGCTTACC-3';

[0162] MdANS-pHIS2-F: 5'-GAATTCGGCTAGTTCTGTATTATGGTTGATAT-3';

[0163] MdANS-pHIS2-R: 5'-GAGCTCTAGTTGGTTCCAATTGGGTT-3';

[0164] MdUFGT-pHIS2-F: 5'-GAATTCGAATTCCTGAGTCCCCTGTAC-3';

[0165] MdUFGT-pHIS2-R: 5'-GAGCTCGAGCTCACTGGAGTGGACA-3';

[0166] MdMYB1-pHIS2-F: 5'-GAATTCTATAAAATATCGATGATATCGGAAATATC-3';

[0167] MdMYB1-pHIS2-R: 5'-GAGCTCGCTCCCCTTCCACGC-3';

[0168] MdGST-pHIS2-F: 5'-GAATTCGAAACTGTCGTTCGTTGAAATTTAGCT-3';

[0169] MdGST-pHIS2-R: 5'-ATTCGCGAACGCGTGAGCTCCTTCTTGTACAACAAAGTGC-3'.

[0170] The promoter-pHIS2 vector plasmids were transformed into Y187 yeast competent cells, and the bacterial solution was applied to solid culture medium (SD / -Trp-His) to confirm the 3-AT concentration that could inhibit the background expression of promoter-pHIS2. The results showed that the solid culture medium lacking tryptophan and histidine (SD / -Trp-His) with a concentration of 120mM 3-AT could inhibit the background expression of MdDFR-p-pHIS2, MdANS-p-pHIS2, MdUFGT-p-pHIS2 and MdMYB1-p-pHIS2, and the solid culture medium with a concentration of 180mM 3-AT could inhibit the background expression of MdF3H-p-pHIS2, MdbHLH3-p-pHIS2, MdbHLH33-p-pHIS2, MdCHI-p-pHIS2, MdCHS-p-pHIS2 and MdGST-p-pHIS2. MdZAT1-pGADT7 and promoter-pHIS2 vector plasmids were co-transformed into Y187, and pGADT7 and promoter-pHIS2 vector plasmids were used as controls. The bacterial solution was spread on solid culture medium (SD / -Trp-His-Leu). After 2 days, it was found that yeast plaques containing MdZAT1-pGADT7, MdANS-p-pHIS2 and MdCHI-p-pHIS2 grew on SD / -Trp / -His / -Leu with 3-AT concentration, while yeast cells co-transformed with other promoter-pHIS2 and MdZAT1-pGADT7 had no plaque growth, as shown in Figure 2. Figure 8 A and C. The results showed that MdZAT1 interacted with the promoters of MdCHI and MdANS, but had no interaction with the promoters of MdCHS, MdDFR, MdUFGT, MdMYB1, MdbHLH3, MdbHLH33 and MdGST.

[0171] EMSA experiments were further used to verify the interaction between MdZAT1 and the MdANS and MdCHI promoters. Two predicted binding sites were detected in the MdANS promoter and one predicted binding site was detected in the MdCHI promoter. Biotin-labeled probes were designed. The probe sequences used are as follows:

[0172] MdANS-probe1-BJ-F: ​​5'-GGATTATTGCTCCAATTGGGTTAAAGTTGTGGGACC-3'; MdANS-probe1-BJ-R: 5'-GGTCCCACAACTTTAACCCAATTGGAGCAATAATCC-3 ';MdANS-probe1-JZ-F: 5'-GGATTATTGCTCCAATTGGGTTAAAGTTGTGGGACC-3'; MdANS-probe2-BJ-F: ​​5'-CTAAATTTTGTAAACCCAATTGGAACCAACTA-3';

[0173] MdANS-probe2-BJ-R:5'-TAGTTGGTTCCAATTGGGTTTACAAAATTTAG-3';

[0174] MdANS-probe2-JZ-F: 5'-CTAAATTTTGTAAACCCAATTGGAACCAACTA-3';

[0175] MdCHI-probe-BJ-F: ​​5'-TATTAAAGATAGGATTTGGGTAATTAATCATCATCT-3';

[0176] MdCHI-probe-BJ-R: 5'-AGATAATGATTAATTACCCAAATCCTATCTTTAATA-3';

[0177] MdCHI-probe-JZ-F: 5'-TATTAAAGATAGGATTTGGGTAATTAATCATCATCT-3'.

[0178] The results of EMSA experiments showed that MdZAT1 could bind to the promoter of MdANS; MdZAT1 could bind to the promoter of MdCHI through the TTGGGT motif. Figure 8 B. The results showed that MdZAT1 could specifically bind to the TTGGGT sequence of MdANS and MdCHI promoters.

[0179] In order to further study the regulatory activity of MdZAT1 on MdANS and MdCHI promoters, primer sequences with BamHI and SalI restriction sites were used:

[0180] MdCHI-pGreenⅡ0800-F: 5'-TCGACGGTATCGATAAGCTTTTCCGCTGCGGTGGG-3';

[0181] MdCHI-pGreenⅡ0800-R: 5'-GCTCTAGAACTAGTGGATCCGGGTGGGACCGTGGG-3';

[0182] MdANS-pGreenⅡ0800-F: 5'-TCGACGGTATCGATAAGCTTGGCTAGTTCTGTATTATGGT-3';

[0183] MdANS-pGreenⅡ0800-R: 5'-GCTCTAGAACTAGTGGATCCTAGTTGGTTCCAATTGGGTT-3'.

[0184] The promoter sequences of MdCHI and MdANS were cloned to construct MdANS-pGreenII 0800-LUC and MdCHI-pGreenII 0800-LUC vectors; the CDS sequence of MdZAT1 was cloned to construct MdZAT1-pGreenII 62-SK vector, which was transformed into GV3101 carrying pSoup+P19 (GV3101 (pSoup-p19) chemical transformation competent cells), and co-injected into tobacco leaves for observation. pMdANS-LUC and pGreen62-SK, pMdCHI-LUC and pGreen62-SK were used as controls, respectively. The results showed that when pMdANS-LUC and pMdCHI-LUC and pGreen62-SK-MdZAT1 were co-expressed in tobacco leaves, the luminescence signal was weaker than that of the control, and the activity of the MdANS and MdCHI promoters was inhibited. See Figure 8 The results showed that MdZAT1 downregulated the expression of MdANS and MdCHI promoters. These results suggest that MdZAT1 can inhibit the expression of MdANS and MdCHI by directly binding to their promoters, thereby affecting the biosynthesis of anthocyanins.

[0185] According to the above results, the present invention found that MdZAT1 can bind to the promoters of MdCHI and MdANS and downregulate the expression of MdCHI and MdANS to negatively regulate the biosynthesis of anthocyanins. The discovery of the MdZAT1 gene provides a basis for improving the appearance quality of apple fruit, which has important economic and social benefits for improving the quality of apples.

[0186] Sequence shown in SEQ ID NO.1 (nucleotide sequence):

[0187] ATGCCTAAGGATAGGAGGGGACGTTCTGTTTCTCGTGATAGGTATAGAGCATCTCCTTATCCATGCAGCTCCAGTCCTACAAGGCGGTTGTTGCCCAAAATTCCTTCAGAAACTGAGGACAATGTGAAAGAATGGGAAGAAGCCAGATGCCCCGTTTGCCTGGAGCATCCACACAATGCGGTTCTCCTAATATGTTCATCGTATGAACAAGGGTGCCGCCCTTACATGTGTGACACGAGCTACCGCCATTCAAATTGTCTAGACCTGTACTGCAAGTCATTTTCAGCAGAAACCTCACCAACTATCCCACCAGAAGGAGCAGCGCAGATATCAGATACTCAGTCGTCTCCATCTGCAACTCTTGAATCAACAATTACTCAAGTGCAAAACGATAGTACAATTGAGGAGGTGCTCTCCTCCATGAATGCCGTATCTTGTGAGCATCAGGCTGATCCGAAGCTAGTGTGCCCCCTCTGCCGTGGGGAGATAACAGATTGGATTATTGTTGAGTCTGCTCGTTGTTTCATGAATGCGAAATCAAGAAATTGTTCTTGTGAGACATGTAATTATAGCGGAACATATGCAGATCTCAGGAAGCATGCGAGGCTGGAGCATCCACTAGTGTGCCCATCAGAGGCAGATCCAGAGCGACAGCGTACCTGGAGGAGTTTGGAGCGACAGAGGGATATTGGCGACTTGTTCAGCTCAATCCAATCTTCAGTTGGAGAGGATAGGGGTGATGATAGCAGTAGTTTGCCTGCTGATGACGGTGCAGGCTGGCTAACCATATTCTTTCTAGTTAGAGTAGTTCGACCCGGGTCCAGTTCAAGGAGCAGCAGCTGGTCTGGTACCACAAGAACCAGAGCACAAGTTAGTATGAGAAGGAGAGCAACCAGGCTTTGGGGGGAGAGCTACGAGGGCGAAGCAGCATCTTCTACTC TAGAAGAGGATAACGAGTCTTCAGACGGCGACTCGGGTGTTAGGAGGAGACGCAGTGCGCGCCTCCGGCGATGGACAACACCGGACAACAACCAGCCGTGA.

[0188] Sequence shown in SEQ ID NO.2 in the sequence listing (specific fragment nucleotide sequence):

[0189] CTGATCCGAAGCTAGTGTGCCCCCTCTGCCGTGGGGAGATAACAGATTGGATTATTGTTGAGTCTGCTCGTTGTTTCATGAATGCGAAATCAAGAAATTGTTCTTGTGAGACATGTAATTATAGCGGAACATATGCAGATCTCAGGAAGCATGCGAGGCTGGAGCATCCACTAGTGTGCCCATCAGAGGCAGATCCAGAGC GACAGCGTACCTGGAGGAGTTTGGAGCGACAGAGGGATATTGGCGACTTGTTCAGCTCAATCCAATCTTCAGTTGGAGGATAGGGGTGATGATAGCAGTAGTTTGCCTGCTGATGACGGTGCAGGCTGGCTAACCATATTCTTTCTAGTTAGAGTAGTTCGACCCGGGTCCAGTTCAAGGAGCAGCAGCTGGTCTGGTA.

[0190] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of the apple C2H2 zinc finger protein transcription factor MdZAT1 gene in any of the following: (1) Application in regulating anthocyanin synthesis in apple fruit; (2) Application in regulating the appearance quality of apple fruit; (3) Application in apple variety improvement; in, The nucleotide sequence of the MdZAT1 gene is the sequence shown in SEQ ID NO.1 or a fragment thereof.

2. Use of the protein encoding the MdZAT1 gene of claim 1 in any of the following: (1) Application in regulating anthocyanin synthesis in apple fruit; (2) Application in regulating the appearance quality of apple fruit; (3) Application in apple variety improvement.

3. Use of the vector comprising the MdZAT1 gene according to claim 1 in any of the following: (1) Application in regulating anthocyanin synthesis in apple fruit; (2) Application in regulating the appearance quality of apple fruit; (3) Application in apple variety improvement.

4. Use of the recombinant bacteria comprising the vector according to claim 3 in any of the following: (1) Application in regulating anthocyanin synthesis in apple fruit; (2) Application in regulating the appearance quality of apple fruit; (3) Application in apple variety improvement.

5. The use according to any one of claims 1 to 4, characterized in that: The MdZAT1 gene negatively regulates anthocyanin synthesis in apple fruit.

6. The use according to claim 5, characterized in that The negative regulation includes: overexpressing the MdZAT1 gene to reduce the synthesis amount of anthocyanins in apple fruit; and silencing the MdZAT1 gene to increase the synthesis amount of anthocyanins in apple fruit.

7. A method for inhibiting anthocyanin synthesis in apple fruit, characterized in that: The method comprises the steps of constructing the recombinant bacteria as claimed in claim 4, and transferring the recombinant bacteria into apples to overexpress the MdZAT1 gene, wherein the nucleotide sequence of the MdZAT1 gene is the sequence shown in SEQ ID NO.1 or a fragment thereof.

8. The method for inhibiting anthocyanin synthesis in apple fruit according to claim 7, characterized in that: The fragment includes a fragment whose nucleotide sequence is shown as SEQ ID NO.

2.

9. A method for increasing anthocyanin synthesis in apple fruit, characterized in that: The method comprises the steps of constructing the recombinant bacteria as claimed in claim 4, and transferring the recombinant bacteria into apples to inhibit the expression of the MdZAT1 gene, wherein the nucleotide sequence of the MdZAT1 gene is the sequence shown in SEQ ID NO.1 or a fragment thereof.

10. The method for increasing anthocyanin synthesis in apple fruit according to claim 9, characterized in that: The fragment includes a fragment whose nucleotide sequence is shown as SEQ ID NO.2.

Images