Engineered immune cell and preparation method thereof

Abstract

Provided are an engineered immune cell prepared by transfecting an isolated nucleic acid molecule comprising: a nucleic acid sequence encoding a chimeric antigen receptor (CAR); a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof; and a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof.

Description

Engineered immune cells and preparation methods thereof Technical Field

[0001] The present application relates to the field of biomedicine, and specifically to an engineered immune cell and a method for preparing the same. Background Art

[0002] Improving cell function through genetic modification is an important means to increase the efficacy of cell therapy. Currently, the field of cell therapy mainly uses viral vectors to transfect cells to achieve stable expression of various molecules, and at the same time, improve cell functions including cell viability, proliferation rate, and long-term special functions of the expressed molecules, thereby achieving the purpose of cell therapy. However, viral vector transfection has a long design time, a complex preparation process, a long test cycle, and high costs. At the same time, the introduction of viral sequences into human hosts may trigger host immunogenicity, insertional mutagenesis, and cause safety risks that are difficult to predict. For example, reports have shown that lentiviral vectors can cause exogenous nucleic acid sequences to be inserted into thousands of sites in the T cell genome, which undoubtedly increases potential safety concerns.

[0003] There have been reports of attempts to use non-viral systems for cell transformation or cell transfection to achieve the purpose of cell therapy. However, the transfection efficiency mediated by non-viral systems is low, and the cytotoxicity required for the treatment of most of the transfected cells is large, which seriously affects the viability of the transfected cells. In particular, to date, the cytotoxicity produced by non-viral transfection of immune cells, stem cells, fibroblasts, etc. (especially primary cells) is even greater, resulting in high cell mortality and low proliferation rate, which in turn makes the transfection efficiency and live cell recovery rate unable to reach the level required for cell therapy. Under the limitations of existing non-viral methods, in order to achieve the cell amount required for cell therapy, various remedial methods including long-term in vitro cell directed expansion are required. However, long-term in vitro directed expansion is bound to change the phenotype and function of the cells and will significantly limit the cell therapy effect of the transfected cells, making the efficiency of cell therapy products produced by current non-viral methods far lower than the efficiency of cell products produced by viral methods. Considering the limitations of the viral method itself, the development and maturity of cell therapy have been greatly hindered.

[0004] Therefore, there is an urgent need to obtain a non-viral cell modification method that is safe, has high transfection efficiency, good cell viability, and can produce enough cells for clinical treatment in a short period of time, as well as engineered cells prepared by this method.

[0005] Summary of the Invention

[0006] The present application provides an isolated nucleic acid molecule with a novel design, and an engineered immune cell obtained by transfection (e.g., electroporation transfection) of the molecule. The engineered immune cell of the present application shows excellent safety and tumor cell killing activity.

[0007] In a first aspect, the present application provides an isolated nucleic acid molecule comprising: a nucleic acid sequence encoding a chimeric antigen receptor (CAR); a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof; and a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof.

[0008] In another preferred embodiment, the nucleic acid molecule further comprises a nucleic acid sequence encoding an additional exogenous protein selected from the group consisting of IL2 or a functionally active fragment thereof, IL7 or a functionally active fragment thereof, a cytokine, a BiTE or a combination thereof.

[0009] In another preferred embodiment, the nucleic acid molecule comprises a tandem expression unit, wherein the expression unit comprises:

[0010] (E1) a first expression unit for expressing the chimeric antigen receptor;

[0011] (E2) a second expression unit for expressing the IL-15, or a functionally active fragment thereof, or a fusion protein thereof;

[0012] (E3) a third expression unit for expressing the IL-21, or a functionally active fragment thereof, or a fusion protein thereof; and

[0013] (E4) optionally a fourth expression unit for expressing the additional exogenous protein,

[0014] The positions of the first, second, third and fourth expression units can be interchanged arbitrarily.

[0015] In the nucleic acid molecule, each independent expression unit is driven by an operably linked exogenous promoter or endogenous promoter, or driven by a further upstream promoter with a cleavable nucleic acid sequence at its 5' end (eg, 2A nucleic acid sequence, IRES nucleic acid sequence).

[0016] In another preferred embodiment, the number of the first expression unit, the second expression unit and the third expression unit are each independently 1, 2, or 3.

[0017] In another preferred embodiment, the number of the fourth expression units is 0, 1, 2, 3, 4, or 5.

[0018] In another preferred embodiment, the nucleic acid molecule encodes 1, 2, or 3 identical or different CAR molecules.

[0019] In another preferred embodiment, the nucleic acid molecule has the following structure: ARM5—P1—CAR1—P2 / L1—Z1—P3 / L2—Z2—(P4 / L3—Z3)m——ARM3 (Ia)

[0020] Among various

[0021] ARM5 is none or 5′ homology arm;

[0022] ARM3 is none or 3′ homology arm;

[0023] P1 is a promoterless, splicing acceptor, or the first exogenous promoter;

[0024] CAR1 is a nucleic acid sequence encoding the first chimeric antigen receptor (CAR);

[0025] P2 / L1 is the second exogenous promoter P2 or the nucleic acid sequence L1 encoding the cleavable part;

[0026] One of Z1 and Z2 is a nucleic acid sequence encoding IL-15, or a functionally active fragment thereof, or a fusion protein thereof, and the other is a nucleic acid sequence encoding IL-21, or a functionally active fragment thereof, or a fusion protein thereof;

[0027] L2 is the nucleic acid sequence L2 encoding the cleavable portion;

[0028] P3 is the third exogenous promoter;

[0029] P4 / L3 are each independently a fourth exogenous promoter P4 or a nucleic acid sequence L3 encoding a cleavable portion;

[0030] Z3 is a nucleic acid sequence encoding an additional exogenous protein;

[0031] m is 0, 1, 2, 3, 4 or 5.

[0032] In another preferred embodiment, each of the P4s is the same or different exogenous promoters, and each of the L3s is a nucleic acid sequence encoding the same or different cleavable moieties.

[0033] In another preferred embodiment, each Z3 is a nucleic acid sequence encoding the same or different additional exogenous proteins.

[0034] In another preferred embodiment, the ARM5 is the 5' homology arm, and the ARM3 is the 3' homology arm.

[0035] In another preferred embodiment, the nucleic acid molecule has the following structure: ARM5-P1-CAR1-L1-Z1-L2-Z2-ARM3 (II)

[0036] Wherein, ARM5, P1, CAR1, L1, Z1, L2, Z2, ARM3 and P2 are as defined above.

[0037] In another preferred embodiment, P1, P2 and P3 are each independently a constitutive or inducible promoter.

[0038] In another preferred embodiment, P1 is an exogenous promoter, such as PGK promoter.

[0039] In another preferred embodiment, P2 is a PGK promoter.

[0040] In another preferred embodiment, the PGK promoter sequence is shown as SEQ ID NO: 26.

[0041] In another preferred embodiment, the nucleic acid sequence encoding IL-15 or a functionally active fragment thereof encodes IL-15 or a fusion protein thereof, such as an IL-15-Fc fusion protein.

[0042] In another preferred embodiment, the nucleic acid sequence encoding IL-21 or a functionally active fragment thereof encodes IL-21 or a fusion protein thereof, such as IL-21-Fc fusion protein.

[0043] In another preferred embodiment, the 5' homology arm and the 3' homology arm are homologous to the target region in the immune cell genome, so that the nucleic acid sequence between the homology arms is positioned and knocked into the predetermined site.

[0044] In another preferred embodiment, the nucleic acid sequence is positioned and knocked in:

[0045] (s1) an endogenous promoter or its downstream, so that the nucleic acid sequence encoding the chimeric antigen receptor (CAR) is operably linked to the endogenous promoter and driven by the endogenous promoter, or driven by an exogenous promoter;

[0046] (s2) A site located at a target gene selected from the group consisting of TRBC, TRAC, PD-1, CD52, CD95, AAVS1 and CCR5.

[0047] In certain embodiments, the nucleic acid molecule comprises, in order from 5' to 3', the nucleic acid sequence encoding CAR, the nucleic acid sequence encoding IL-15 or a functionally active fragment thereof, and the nucleic acid sequence encoding IL-21 or a functionally active fragment thereof; or the nucleic acid sequence encoding CAR, the nucleic acid sequence encoding IL-21 or a functionally active fragment thereof, and the nucleic acid sequence encoding IL-15 or a functionally active fragment thereof.

[0048] In certain embodiments, the CAR comprises a target binding domain targeting a tumor-associated antigen, a target binding domain targeting a viral antigen, a target binding domain targeting an immune-associated antigen, or a combination thereof.

[0049] In certain embodiments, the tumor-associated antigen is selected from the group consisting of: GPC3, CD19, BCMA, GCC (GUCY2C), Her2, Claudin18.2 and Mesothelin; and the viral antigen is selected from the group consisting of: EBV-gp350 and HBV s protein.

[0050] In certain embodiments, the nucleic acid molecule further comprises one or more nucleic acid sequences encoding a cleavable moiety.

[0051] In certain embodiments, the nucleic acid sequence encoding the cleavable portion is located between any two sequences selected from the following groups: a nucleic acid sequence encoding the chimeric antigen receptor (CAR); a nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof; and a nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof.

[0052] In certain embodiments, the cleavable moiety comprises a 2A peptide.

[0053] In certain embodiments, the 2A peptide comprises P2A, T2A, F2A, or E2A.

[0054] In certain embodiments, the nucleic acid molecule further comprises a nucleic acid sequence encoding one or more other exogenous proteins.

[0055] In certain embodiments, the one or more other exogenous proteins comprise an antibody or an antigen-binding fragment thereof.

[0056] In certain embodiments, the antibody or antigen-binding fragment thereof comprises a multispecific antibody or antigen-binding fragment thereof.

[0057] In certain embodiments, the multispecific antibody or antigen-binding fragment thereof comprises a bispecific T cell engager (BiTE).

[0058] In certain embodiments, the BiTE comprises a CD3 binding domain.

[0059] In certain embodiments, the BiTE further comprises a tumor-associated antigen binding domain.

[0060] In certain embodiments, the tumor-associated antigen is selected from the group consisting of: GPC3, CD19, BCMA, GCC (GUCY2C), Her2, Claudin18.2 and Mesothelin; and the viral antigen is selected from the group consisting of: EBV-gp350 and HBV s protein.

[0061] In certain embodiments, the nucleic acid molecule further comprises a 5' homology arm, wherein the 5' homology arm is homologous to a target region in the genome of an immune cell.

[0062] In certain embodiments, the 5' homology arm is located upstream of the nucleic acid sequence encoding the chimeric antigen receptor (CAR).

[0063] In certain embodiments, the nucleic acid molecule further comprises a 3' homology arm, wherein the 3' homology arm is homologous to a target region in the genome of an immune cell.

[0064] In certain embodiments, the 3' homology arm is located downstream of the nucleic acid sequence encoding IL-21 or a functionally active fragment thereof.

[0065] In certain embodiments, the target region is located at a target gene, and the target gene is selected from the group consisting of TRBC, TRAC, PD-1, CD52, CD95, AAVS1, and CCR5.

[0066] In certain embodiments, the target binding domain of the CAR comprises the amino acid sequence shown in SEQ ID NO:1.

[0067] In certain embodiments, the target binding domain of the CAR comprises an amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NOs. 31 and 32.

[0068] In certain embodiments, the CAR comprises a hinge region, a transmembrane domain, a costimulatory domain, and an intracellular domain.

[0069] In certain embodiments, the hinge region is a hinge region derived from CD8α.

[0070] In certain embodiments, the transmembrane domain is a transmembrane domain derived from CD8α.

[0071] In certain embodiments, the costimulatory domain is a costimulatory domain derived from 41BB.

[0072] In certain embodiments, the costimulatory domain comprises the amino acid sequence shown in SEQ ID NO:3.

[0073] In certain embodiments, the intracellular domain is an intracellular domain derived from CD3ζ.

[0074] In certain embodiments, the intracellular domain comprises the amino acid sequence shown in SEQ ID NO:4.

[0075] In certain embodiments, the CAR comprises the amino acid sequence shown in SEQ ID NO:5.

[0076] In certain embodiments, the IL-15 or a functionally active fragment thereof comprises the amino acid sequence shown in any one of SEQ ID NOs: 6-7, 9.

[0077] In certain embodiments, the IL-21 or a functionally active fragment thereof comprises the amino acid sequence shown in any one of SEQ ID NOs: 10-11, 13.

[0078] In certain embodiments, the cleavable portion comprises the amino acid sequence set forth in any one of SEQ ID NOs: 14-16.

[0079] In certain embodiments, the 5' homology arm comprises the nucleic acid sequence shown in SEQ ID NO:17.

[0080] In certain embodiments, the 3' homology arm comprises the nucleic acid sequence shown in SEQ ID NO:18.

[0081] In certain embodiments, the nucleic acid molecule comprises a nucleic acid sequence that is at least 3 kb in length.

[0082] In certain embodiments, the nucleic acid molecule comprises the nucleic acid sequence shown in any one of SEQ ID NOs: 20-21, 23-24, and 27-30.

[0083] In certain embodiments, the nucleic acid molecule comprises a circular nucleic acid molecule, a supercoiled nucleic acid molecule and / or a linear nucleic acid molecule.

[0084] In certain embodiments, the nucleic acid molecule comprises a DNA molecule and / or an RNA molecule.

[0085] In certain embodiments, the nucleic acid molecule comprises a single-stranded nucleic acid molecule and / or a double-stranded nucleic acid molecule.

[0086] In a second aspect, the present application provides a vector comprising the nucleic acid molecule described in the present application.

[0087] In certain embodiments, the vector is a non-viral vector.

[0088] In certain embodiments, the vector is a plasmid.

[0089] In another preferred embodiment, the plasmid is derived from a microorganism and the content of the microbial group DNA in the plasmid is <10 wt % of the total DNA, preferably ≤5 wt %, and more preferably ≤1 wt %.

[0090] In a third aspect, the present application provides a method for preparing modified immune cells, the method comprising transfecting the immune cells to be modified with the nucleic acid molecule described in the present application or the vector described in the present application.

[0091] In another preferred embodiment, the method is an electroporation method based on a donor plasmid combined with a targeted nuclease, or a targeted electroporation method based on a donor plasmid.

[0092] In another preferred embodiment, the method comprises:

[0093] (a) providing a donor plasmid, wherein the donor plasmid contains the nucleic acid molecule of claim 1, wherein the plasmid is derived from a microorganism and the content of the microbial DNA in the plasmid is less than 10 wt% (preferably ≤ 5 wt%, more preferably ≤ 1 wt%) of the total DNA; and

[0094] (b) transfecting the immune cells to be modified with the plasmid, so that the cells contain and / or express the nucleic acid molecule.

[0095] In another preferred embodiment, in step (b), the transfection includes electrotransfection.

[0096] In another preferred embodiment, in step (b), transfection is performed in the presence of a gene editing system (or gene editing reagent), so that the nucleic acid molecule is integrated into a specific location of the cell genome.

[0097] In another preferred embodiment, the gene editing system comprises a nuclease and a guide RNA.

[0098] In another preferred embodiment, the nuclease includes a Cas protein, preferably Cas9.

[0099] In another preferred embodiment, the gene editing system comprises a ribonucleoprotein complex RNP, and the RNP comprises the Cas protein and the guide RNA.

[0100] In certain embodiments, the method comprises: transfecting the immune cell to be modified with a transfection composition comprising the nucleic acid molecule described herein, or the vector described herein, so that the cell comprises and / or expresses the nucleic acid molecule, wherein at least a portion of the nucleic acid molecule or the vector is obtained from a host cell; and in the nucleic acid molecule portion or the vector portion obtained from the host cell, the content of the genomic DNA of the host cell is about 10% (w / w) or less.

[0101] In the present application, in the modified immune cells, one or more additional genes may also be knocked out or knocked down. For example, the additional genes may include genes expressing immune checkpoints (e.g., PD-1). For example, the additional genes may include Fas-FasL-induced cell death-related genes (e.g., CD95). For example, the transfection composition may include one or more guide RNAs targeting the additional genes to be knocked out or knocked down (e.g., ). For example, the guide RNA may target genes expressing immune checkpoints (e.g., PD-1), and / or Fas-FasL-induced cell death-related genes (e.g., CD95).

[0102] In the present application, the host cell is not or does not include a mammalian immune cell.

[0103] In certain embodiments of the methods of the present application, the immune cells include immune effector cells.

[0104] In certain embodiments of the method of the present application, the immune cells include T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes and / or mast cells.

[0105] In certain embodiments of the methods of the present application, the immune cells include peripheral blood lymphocytes.

[0106] In certain embodiments of the methods of the present application, the immune cells are primary cells.

[0107] In certain embodiments of the methods of the present application, the immune cells include autologous cells and / or allogeneic cells derived from the subject.

[0108] In certain embodiments of the methods of the present application, the immune cells are activated cells.

[0109] In certain embodiments of the methods of the present application, the activation comprises contacting the immune cell to be modified with an activation composition.

[0110] In certain embodiments of the methods of the present application, the activating composition comprises anti-CD3 and / or anti-CD28 antibodies.

[0111] In certain embodiments of the methods of the present application, the activation comprises contacting the immune cells to be modified with the activation composition for no more than about 4 days.

[0112] In certain embodiments, the method comprises performing the transfection while contacting the immune cell to be modified with the activating composition for a period of about 2 days or less.

[0113] In certain embodiments of the method of the present application, the transfection comprises electroporating the immune cells to be modified.

[0114] In certain embodiments of the methods of the present application, the concentration of the nucleic acid molecule or the vector in the transfection composition is about 5 μg / mL to about 3000 μg / mL.

[0115] In certain embodiments of the methods of the present application, the concentration of the nucleic acid molecule or the vector in the transfection composition is about 200 μg / mL to about 800 μg / mL.

[0116] In certain embodiments of the method of the present application, the nucleic acid molecule or the vector is extracted from the host cell.

[0117] In certain embodiments of the methods of the present application, the host is a microbial host.

[0118] In certain embodiments of the method of the present application, the host is selected from one or more of the following groups: bacteria, fungi, actinomycetes, mycoplasmas, chlamydia, rickettsiae and spirochetes.

[0119] In certain embodiments of the methods of the present application, the host comprises Gram-negative bacteria.

[0120] In certain embodiments of the methods of the present application, the host comprises Escherichia coli.

[0121] In certain embodiments of the methods of the present application, the size of the genomic DNA of the host cell is at least about 10 kb.

[0122] In certain embodiments of the method of the present application, the content of genomic DNA in the host cell is less than about 1% (w / w).

[0123] In certain embodiments of the method of the present application, the content of genomic DNA in the host cell is less than about 9‰ (w / w).

[0124] In certain embodiments of the method of the present application, the content of genomic DNA in the host cell is determined by qPCR.

[0125] In certain embodiments of the method of the present application, the nucleic acid molecule portion or the vector portion obtained from the host cell is treated so that the content of the genomic DNA of the host cell is reduced; and / or the content of the genomic DNA of the host cell in the nucleic acid molecule portion or the vector portion obtained from the host cell is measured, and based on the content, it is determined whether the nucleic acid molecule portion or the vector portion is treated so that the content of the genomic DNA of the host cell is reduced.

[0126] In certain embodiments of the method of the present application, the content of the genomic DNA of the host cell in the nucleic acid molecule portion or the vector portion obtained from the host cell is determined, and when the content of the genomic DNA of the host cell is about 10% (w / w) or above, the nucleic acid molecule portion or the vector portion is treated so that the content of the genomic DNA of the host cell is reduced.

[0127] In certain embodiments of the methods of the present application, the treating comprises contacting the nucleic acid molecule portion or the vector portion with one or more reagents selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide.

[0128] In certain embodiments of the methods of the present application, the DNase is capable of non-specifically cleaving linear DNA.

[0129] In certain embodiments of the method of the present application, the DNase is an exonuclease.

[0130] In certain embodiments of the method of the present application, the treatment comprises 2+ and Ca 2+ The transfection composition is contacted with the agent in the presence of .

[0131] In certain embodiments of the method of the present application, the transfection composition further comprises a gene editing system capable of integrating the nucleic acid molecule into a specific location of the cell genome.

[0132] In certain embodiments of the methods of the present application, the gene editing system comprises a site-specific enzyme or a nucleic acid molecule encoding the same (eg, mRNA encoding the site-specific enzyme).

[0133] In certain embodiments of the method of the present application, the site-specific enzyme is selected from the group consisting of: transcription activator-like effector nuclease (TALEN), zinc finger nuclease (ZFN), transposase, integrase and Cas protein.

[0134] In certain embodiments of the method of the present application, the Cas protein is a Cas9 protein.

[0135] In certain embodiments of the methods of the present application, the transposase comprises PiggyBac (PB) transposase, and / or Sleeping Beauty (SB) transposase.

[0136] In certain embodiments, the gene editing further comprises knocking out one or more genes in the cell. The knocked-out genes may include, for example, genes expressing immune checkpoints (such as PD-1) and / or genes associated with Fas-FasL-induced cell death (e.g., CD95).

[0137] In certain embodiments of the methods of the present application, the gene editing system further comprises one or more guide RNAs.

[0138] For example, the gene editing system may include one or more guide RNAs targeting the gene to be knocked out. For example, the gene to be knocked out can be selected from the following group: TRBC, TRAC, PD-1, CD95, AAVS1 and CCR5. For example, the gene editing system may include a guide RNA targeting the gene expressing the immune checkpoint (such as PD-1). For example, the gene editing system may include a guide RNA targeting the Fas-FasL-induced cell death-related gene (e.g., CD95).

[0139] In certain embodiments of the methods of the present application, the guide RNA is complementary to a nucleic acid sequence in a target region of the cell genome.

[0140] In certain embodiments of the method of the present application, the gene editing system comprises a ribonucleoprotein complex RNP, and the RNP comprises the Cas protein and the guide RNA.

[0141] In certain embodiments, the target region is located in a gene region selected from the group consisting of TRBC, TRAC, PD-1, CD95, AAVS1, and CCR5.

[0142] In a fourth aspect, the present application provides a kit comprising the nucleic acid molecule described in the present application or the vector described in the present application.

[0143] In a fifth aspect, the present application provides a kit for transfection, comprising: 1) the nucleic acid molecule described in the present application or the vector described in the present application obtained from a host cell; and 2) a reagent capable of reducing or degrading the genomic DNA of the host cell.

[0144] In certain embodiments of the kit of the present application, the reagents in 2) comprise one or more selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide.

[0145] In certain embodiments of the kit of the present application, the DNase is capable of non-specifically cleaving linear DNA.

[0146] In certain embodiments of the kit of the present application, the DNase is an exonuclease.

[0147] In certain embodiments of the present application, the kit further comprises Mg 2+ and Ca 2+ of reagents.

[0148] In a sixth aspect, the present application provides a transfection composition comprising the nucleic acid molecule described herein, or the vector described herein, wherein at least a portion of the nucleic acid molecule or the vector is obtained from a host cell; and in the nucleic acid molecule portion or the vector portion obtained from the host cell, the content of the host cell's genomic DNA is less than about 10% (w / w).

[0149] In certain embodiments of the transfection composition of the present application, the concentration of the nucleic acid molecule or the vector is about 5 μg / mL to about 3000 μg / mL.

[0150] In certain embodiments of the transfection composition of the present application, the concentration of the nucleic acid molecule or the vector is about 200 μg / mL to about 800 μg / mL.

[0151] In certain embodiments of the transfection composition of the present application, the host is a microbial host.

[0152] In certain embodiments of the transfection composition of the present application, the host is selected from one or more of the following groups: bacteria, fungi, actinomycetes, mycoplasmas, chlamydia, rickettsiae and spirochetes.

[0153] In certain embodiments of the transfection composition of the present application, the host comprises Gram-negative bacteria.

[0154] In certain embodiments of the transfection composition of the present application, the host comprises Escherichia coli.

[0155] In certain embodiments of the transfection composition of the present application, the size of the genomic DNA of the host cell is at least about 10 kb.

[0156] In certain embodiments of the transfection composition of the present application, the content of genomic DNA in the host cell is less than about 1% (w / w).

[0157] In certain embodiments of the transfection composition of the present application, the content of genomic DNA in the host cell is less than about 9‰ (w / w).

[0158] In certain embodiments of the transfection composition of the present application, the content of genomic DNA in the host cell is determined by qPCR.

[0159] In certain embodiments of the transfection composition of the present application, the nucleic acid molecule portion or the vector portion obtained from the host cell is treated so that the content of the genomic DNA of the host cell is reduced; and / or the content of the genomic DNA of the host cell in the nucleic acid molecule portion or the vector portion obtained from the host cell is measured, and based on the content, it is determined whether the nucleic acid molecule portion or the vector portion is treated so that the content of the genomic DNA of the host cell is reduced.

[0160] In certain embodiments of the transfection composition of the present application, the content of the genomic DNA of the host cell in the nucleic acid molecule portion or the vector portion obtained from the host cell is measured, and when the content of the genomic DNA of the host cell is about 10% (w / w) or above, the nucleic acid molecule portion or the vector portion is treated so that the content of the genomic DNA of the host cell is reduced.

[0161] In certain embodiments of the transfection composition of the present application, the treatment comprises contacting the nucleic acid molecule portion or the vector portion with one or more reagents selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB and cesium chloride-ethidium bromide.

[0162] In certain embodiments of the transfection composition of the present application, the DNase is capable of non-specifically cleaving linear DNA.

[0163] In certain embodiments of the transfection composition of the present application, the DNase is an exonuclease.

[0164] In certain embodiments of the transfection composition of the present application, the treatment comprises 2+ and Ca 2+ The transfection composition is contacted with the agent in the presence of .

[0165] In certain embodiments, the transfection composition of the present application further comprises a gene editing system capable of integrating the nucleic acid molecule into a specific location of the cell genome.

[0166] In certain embodiments of the transfection composition of the present application, the gene editing system comprises a site-specific enzyme or a nucleic acid molecule encoding the same.

[0167] In certain embodiments of the transfection composition of the present application, the site-specific enzyme is selected from the group consisting of: transcription activator-like effector nuclease (TALEN), zinc finger nuclease (ZFN), transposase, integrase and Cas protein.

[0168] In certain embodiments of the transfection composition of the present application, the Cas protein is a Cas9 protein.

[0169] In certain embodiments of the transfection composition of the present application, the transposase comprises PiggyBac (PB) transposase and / or Sleeping Beauty (SB) transposase.

[0170] In certain embodiments of the transfection composition of the present application, the gene editing system further comprises one or more guide RNAs.

[0171] In certain embodiments of the transfection composition of the present application, the guide RNA is complementary to a nucleic acid sequence in a target region of the cell genome.

[0172] In certain embodiments of the transfection composition of the present application, the gene editing system comprises a ribonucleoprotein complex RNP, and the RNP comprises the Cas protein and the guide RNA.

[0173] In certain embodiments of the transfection composition of the present application, the target region is located in a gene region selected from the group consisting of TRBC, TRAC, PD-1, CD95, AAVS1 and CCR5.

[0174] In a seventh aspect, the present application also provides immune cells prepared by the method described in the present application.

[0175] In an eighth aspect, the present application provides a modified immune cell comprising the nucleic acid molecule described herein, or the vector described herein.

[0176] In certain embodiments of the modified immune cells of the present application, the nucleic acid molecule is integrated into the genome of the immune cell.

[0177] In certain embodiments of the modified immune cell of the present application, the nucleic acid molecule is integrated into a target gene in the genome of the immune cell.

[0178] In certain embodiments of the modified immune cells of the present application, the nucleic acid molecule is expressed under the regulation of an endogenous regulatory sequence of the target gene.

[0179] In certain embodiments of the modified immune cells of the present application, the target gene is selected from the group consisting of: TRBC, TRAC, PD-1, CD95, AAVS1 and CCR5.

[0180] In certain embodiments of the modified immune cells of the present application, one or more additional genes are knocked down or knocked out.

[0181] In certain embodiments, the additional gene is different from the target gene into which the nucleic acid molecule or functionally active fragment thereof is integrated.

[0182] In certain embodiments, the one or more additional genes include immune checkpoint genes.

[0183] In certain embodiments, the one or more additional genes include a Fas-FasL-induced cell death-associated gene.

[0184] In certain embodiments, the one or more additional genes include PD-1 and / or CD95.

[0185] In certain embodiments, the immune cells comprise immune effector cells.

[0186] In certain embodiments, the immune cells include T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes and / or mast cells.

[0187] In certain embodiments, the immune cells include peripheral blood lymphocytes.

[0188] In certain embodiments, the immune cells are primary cells.

[0189] In certain embodiments, the immune cells include autologous cells and / or allogeneic cells derived from the subject.

[0190] In certain embodiments, the immune cells are activated cells.

[0191] In certain embodiments of the modified immune cells of the present application, the activation comprises contacting the immune cells to be modified with an activation composition.

[0192] In certain embodiments of the modified immune cells of the present application, the activation composition comprises anti-CD3 and / or anti-CD28 antibodies.

[0193] In certain embodiments of the modified immune cells of the present application, the activation comprises contacting the immune cells to be modified with the activation composition for no more than about 4 days.

[0194] In certain embodiments, the immune cells are isolated cells.

[0195] In a ninth aspect, the present application provides a cell population comprising the cells described herein and / or their progeny.

[0196] In a tenth aspect, the present application provides a pharmaceutical composition comprising the nucleic acid molecule described herein, the vector described herein, the cell described herein, and / or the cell population described herein.

[0197] In certain embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant.

[0198] In the eleventh aspect, the present application provides the use of the nucleic acid molecules described in the present application, the vectors described in the present application, the cells described in the present application, the cell populations described in the present application, and / or the pharmaceutical compositions described in the present application for preparing drugs.

[0199] In certain embodiments, the medicament is used to prevent, treat and / or alleviate cancer.

[0200] In certain embodiments, the cancer comprises tumor associated antigen-positive cancer cells.

[0201] In certain embodiments, the tumor-associated antigen is selected from the group consisting of: GPC3, CD19, BCMA, Claudin18.2 and Mesothelin.

[0202] In certain embodiments, the cancer is liver cancer, hepatocellular carcinoma, or multiple myeloma.

[0203] In the twelfth aspect, the present application provides a method for preventing, treating and / or alleviating a disease or condition in a subject, the method comprising administering to the subject an effective amount of the nucleic acid molecule described herein, the vector described herein, the cell described herein, the cell population described herein, and / or the pharmaceutical composition described herein.

[0204] In certain embodiments, the disease or condition is cancer.

[0205] In certain embodiments, the cancer comprises tumor associated antigen-positive cancer cells.

[0206] In certain embodiments, the tumor-associated antigen is selected from the group consisting of: GPC3, CD19, BCMA, Claudin18.2 and Mesothelin.

[0207] In certain embodiments, the cancer is liver cancer, hepatocellular carcinoma, or multiple myeloma.

[0208] In the thirteenth aspect, the present application provides the nucleic acid molecules described in the present application, the vectors described in the present application, the cells described in the present application, the cell populations described in the present application, and / or the pharmaceutical compositions described in the present application, which are used to prevent, treat and / or alleviate a disease or condition in a subject.

[0209] Those skilled in the art can easily discern other aspects and advantages of the present application from the detailed description below. In the detailed description below, only exemplary embodiments of the present application are shown and described. As will be appreciated by those skilled in the art, the content of this application enables those skilled in the art to modify the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application relates. Accordingly, the descriptions in the drawings and specification of this application are merely exemplary and not restrictive. BRIEF DESCRIPTION OF THE DRAWINGS

[0210] The features and advantages of the inventions of this application can be better understood by referring to the exemplary embodiments and drawings described in detail below. The drawings are briefly described as follows:

[0211] Figures 1A-1D show the expansion performance and biomarker expression of the engineered immune cells of the present application.

[0212] Figures 2A-2C show the performance of the engineered immune cells of the present application after cryopreservation and recovery.

[0213] Figures 3A-3B show the ability of the engineered immune cells of the present application to be activated and expanded after being revived from cryopreservation.

[0214] FIG4 shows the proliferation of the engineered immune cells of the present application.

[0215] Figures 5A-5B show the killing effect of the engineered immune cells of the present application on tumor cells.

[0216] Figures 6A-6F show the in vivo tumor-suppressing effect of the engineered immune cells of the present application.

[0217] 7A-7B show the expression of exogenous genes by the engineered immune cells of the present application.

[0218] 8A-8B show the in vivo tumor-suppressing effect of the engineered immune cells of the present application.

[0219] 9A-9B show the expression of exogenous genes by the engineered immune cells of the present application and their killing effects on tumor cells.

[0220] Figures 10A-10E show the performance comparison of different engineered immune cells of the present application.

[0221] Figures 11A-11B show the in vivo tumor-suppressing effect of the engineered immune cells of the present application.

[0222] 12A-12C show the detection of cell viability, cell proliferation ability and cell protein expression ability after cells were transfected with plasmids containing different amounts of host genomic DNA.

[0223] Figures 13A-13B show the inhibition of RPMI-8226 multiple myeloma cells and HepG2 liver cancer cells by engineered immune cells under the control of exogenous promoters. BCMA-CAR-15 represents the BCMA CAR-2A-IL15 structure; BCMA-CAR-15-21 represents the BCMA CAR-2A-IL15-2A-IL21 structure; BCMA-CAR-PGK-15-21 represents the PGK-BCMA CAR-2A-IL15-2A-IL21 structure; and PGK-GPC3CAR represents the PGK-GPC3 CAR-2A-IL15-2A-IL21 structure. DETAILED DESCRIPTION

[0224] After extensive and in-depth research, the inventors have developed for the first time a method for efficient electroporation of immune cells based on a plasmid (or donor plasmid) combined with a localized nuclease. Specifically, the present invention has developed a plasmid containing a nucleic acid molecule comprising the following elements and a method for efficient localized electroporation of immune cells based on the plasmid in combination with a localized nuclease: a nucleic acid sequence encoding a chimeric antigen receptor (CAR); a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof; and a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof. The present invention was completed on this basis.

[0225] The inventors unexpectedly discovered that immune cells represented by T cells are extremely sensitive to conventional plasmid-based electroporation methods, resulting in decreased viability after transfection and inability to efficiently prepare localized integrated immune cells. However, when the plasmid is treated so that the content of the microbiome DNA in the plasmid is significantly reduced (such as ≤5wt%, more preferably ≤1wt%, more preferably ≤0.2%, more preferably ≤0.1%), the donor plasmid carrying the CAR coding sequence can be efficiently introduced into immune cells represented by T cells, and the prepared CAR immune cells have high viability, high amplification capacity and high CAR expression rate.

[0226] In addition, the inventors have also developed a nucleic acid molecule or plasmid carrying a nucleic acid sequence encoding CAR, a nucleic acid sequence encoding IL21 (or its fusion protein or active fragment), and a nucleic acid sequence encoding IL15 (or its fusion protein or active fragment). By the method of the present invention, the plasmid can be efficiently introduced into immune cells represented by T cells. The CAR-T cells of the present invention can have excellent amplification ability, high survival rate and high CAR expression rate when incubated with target cells in vitro without the addition of IL-2. However, the IL-15 and IL-21 expressed by the CART cells themselves of the present invention, when there are no target cells or IL-2 cytokines during incubation, or when there are no target cells and only IL-2, cannot provide sufficient support for cell survival, so that the survival time of the CART cells in this case is greatly reduced, suggesting that there is no tumorigenic risk or the risk is extremely low.

[0227] The following describes the implementation of the present invention through specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0228] Definition of terms

[0229] In this application, the term "transfection efficiency" generally refers to the relative amount of material introduced into and / or expressed by a cell undergoing transfection. In this application, the transfection may refer to the introduction of one or more materials (e.g., polynucleotides) into a cell. The introduced material may be maintained stably or transiently in the cell undergoing transfection. In this application, the transfection efficiency may be measured by the amount of the introduced material.

[0230] In the present application, the term "deoxyribonuclease (DNase)" generally refers to an enzyme that can cut the phosphodiester bond on the DNA backbone. The DNase can be a type of nuclease. The DNase can digest double-stranded DNA into deoxynucleotides (for example, under weak alkaline conditions). For example, the DNase can be essentially inactive (for example, unable to cut) towards circular or supercoiled nucleic acid molecules or fragments thereof (for example, closed-loop double-stranded DNA and / or supercoiled DNA). For example, the DNase can cut linear double-stranded DNA. For example, the DNase can be a DNA exonuclease. For example, the DNase can be exonuclease V. For example, the DNase can be ATP-Dependent DNase, for example, Plasmid-Safe TM ATP-Dependent DNase.

[0231] In the present application, the term "nucleic acid molecule or a fragment thereof" generally refers to a nucleotide (e.g., ribonucleotide, deoxyribonucleic acid and / or a modified form of the foregoing) or a fragment thereof. The nucleic acid molecule or its fragment may comprise a polymer form of a nucleotide or a fragment thereof. The nucleic acid molecule or its fragment may be interchangeable with "polynucleotide" in some cases. The nucleic acid molecule may comprise DNA, RNA, cDNA, genomic DNA sense and antisense strands, as well as synthetic forms, mixtures and / or polymers thereof. The nucleic acid molecule or its fragment may comprise any topological conformation, for example, may comprise a single strand, a double strand, a partially double strand, a triple strand, a hairpin structure, a circular and / or padlock conformation. The nucleotides in the nucleic acid molecule or its fragment may be natural or modified. The nucleotides in the nucleic acid molecule or its fragment may be linked together by naturally occurring and / or non-naturally occurring nucleotide bonds.

[0232] As used herein, the term "exogenous nucleic acid molecule" generally refers to a nucleic acid molecule that is not directly produced within an organism, tissue, or cell. For example, the nucleic acid molecule is introduced into the organism, tissue, or cell from an external source in some form. The structure, composition, or function of the nucleic acid molecule may be identical or different from that of a corresponding endogenously expressed nucleic acid molecule. For example, in some cases, the exogenous nucleic acid molecule may have the same nucleotide sequence as the corresponding endogenously expressed nucleic acid molecule. In other cases, the exogenous nucleic acid molecule is not identical to any endogenously expressed nucleic acid molecule.

[0233] In the present application, the term "transfection composition" generally refers to the mixture required for transfection. In the present application, the transfection composition may include one or more materials (such as polynucleotides or exogenous nucleic acid molecules) that are desired to be introduced. For example, the transfection composition may include exogenous nucleic acid molecules encoding exogenous genes to be transfected. For example, the transfection composition may include a carrier comprising the nucleic acid molecules. For example, the transfection composition may also include impurities (in some cases, the impurities may include nucleic acid molecules or fragments thereof). In the present application, the impurities may include nucleic acid molecules or fragments thereof of microbial origin. The impurities carried by the carrier may include impurities carried by the carrier (for example, nucleic acid molecules or fragments thereof that are homologous or heterologous to the backbone of the carrier).

[0234] In this application, the terms "total nucleic acid molecule content" and "total DNA amount" are used interchangeably and generally refer to the total mass of all substances containing nucleotides in the transfection composition. For example, the substance containing nucleotides can include the nucleic acid molecules or fragments thereof and the material.

[0235] In this application, the term "editing efficiency of gene editing" generally refers to the ratio of nucleic acid molecules that are cut at the target location by the gene editing method to all nucleic acid molecules processed by the gene editing method. The editing efficiency of gene editing can reflect the ability of the gene editing method to act on the target location.

[0236] In this application, the term "DNA homologous recombination efficiency" generally refers to the ratio of individuals (e.g., cell number) undergoing DNA homologous recombination to the total number of individuals undergoing DNA homologous recombination. The DNA homologous recombination efficiency can be verified by methods such as gene sequencing and detection of corresponding protein expression.

[0237] In this application, the term "cell viability" generally refers to the ability of a cell to survive and / or perform a biological function (e.g., division, proliferation, secretion, killing, preservation, and / or resuscitation) under certain conditions. In some cases, the cell viability can be measured by the ratio of surviving cells to the total number of surviving cells and dead cells at a specific time and under conditions. In this application, cell viability can also be measured by the ratio of cells with a certain biological function and / or activity to the total number of cells at that time under a specific time and under conditions.

[0238] In this application, the term "host" generally refers to an organism used to carry, amplify or produce exogenous nucleic acid molecules to be transfected, and may include host cells, such as microorganisms or mammalian cells, etc. In this application, host cells are not immune cells.

[0239] In this application, the term "microorganism" generally refers to eukaryotic and prokaryotic microbial species from the Archaea, Bacteria and / or Eucarya domains. For example, the microorganisms can include bacteria, viruses, fungi, actinomycetes, rickettsiae, mycoplasmas, chlamydiae and / or spirochetes. In this application, the term bacteria generally refers to any type of prokaryotic organism, including prokaryotes in all phyla in the Prokaryotic kingdom. The bacteria can include cocci, bacilli, spirochetes, spheroplasts, and protoplasts. The bacteria can include Gram-positive and Gram-negative bacteria. "Gram-negative" and "Gram-positive" refer to staining patterns using the Gram staining method, which is well known in the art.

[0240] In this application, the term "genomic DNA of a host cell" generally refers to a genomic DNA molecule of a host cell or a fragment thereof.

[0241] In this application, the terms "nucleic acid molecule or fragment thereof derived from the genome of a host (e.g., a microorganism)" and "host genomic DNA" are used interchangeably and generally refer to a nucleic acid molecule or a fragment of a nucleic acid molecule that is derived from the genome of the host (e.g., a microorganism). Information on genomes derived from hosts (e.g., microorganisms) can be found in the A genomic catalog of Earth's microbiomes, Nature Biotechnology (2020).

[0242] In the present application, term " gram-negative bacteria " generally refers to the bacterium that does not retain the primary dye used in gram staining but is dyed by counterstain.Therefore, gram-negative bacteria presents redness in gram staining method usually.The content of peptidoglycan is lower in the cell wall of described gram-negative bacteria, and the content of lipid is higher.For example, the cell wall of described gram-negative bacteria can have lipopolysaccharide layer.For example, described gram-negative bacteria can comprise intestinal bacteria, Pseudomonas aeruginosa, Proteus, Shigella dysenteriae, Klebsiella pneumoniae, Brucella, influenza (haemophilus) bacillus, parainfluenzae (haemophilus) bacillus, catarrhal (moraxella) bacillus, Acinetobacter, Yersinia, Legionella pneumophila, Bordetella pertussis, Bordetella parapertussis, Shigella, Pasteurella, Vibrio cholerae, parahaemolyticus and / or shigella-like Pseudomonas.

[0243] In this application, the term "Escherichia coli" generally refers to Escherichia coli. Escherichia coli belongs to the genus Escherichia of the family Enterobacteriaceae.

[0244] In this application, the term "transient transfection" generally refers to a transfection method in which an exogenous gene introduced into a cell is not integrated into the cell's own genome. The procedures for transient transfection are known to those skilled in the art. For example, the transient transfection can be performed by liposome-mediated transfection. For example, the transient transfection can include electroporation transfection. The transient transfection can be performed using a transfection reagent, such as FuGENE6.

[0245] In this application, the term "stable transfection" generally refers to the introduction and integration of an exogenous nucleic acid molecule into the genome of a transfected cell. For example, the exogenous gene is integrated into the genome of a transfected cell.

[0246] In this application, the term "stem cell" generally refers to a class of undifferentiated cells that have the ability to self-renew while retaining varying degrees of potential to form differentiated cells and tissues. The stem cells may be anergic stem cells, multipotent stem cells, or totipotent stem cells. Anergic stem cells are derived stem cells that have lost their ability to differentiate. Totipotent stem cells can form all cells and tissues found in a complete organism. For example, totipotent stem cells can form a complete organism.

[0247] In this application, the terms "pluripotent stem cells" and "multipotent stem cells" are used interchangeably and generally refer to stem cells that have the ability to form cells and tissues ultimately found in a whole organism, but cannot form a whole organism.

[0248] In this application, the term "mesenchymal stem cell" generally refers to a cell that can produce a mesenchymal lineage. The mesenchymal stem cell can be considered to belong to the multipotent stem cell. The mesenchymal stem cell can produce one or more cells of the mesenchymal lineage. The cells of the mesenchymal lineage can be derived from different tissues, for example, bone marrow tissue, adipose tissue, muscle tissue, reproductive tissue (e.g., amniotic membrane, amniotic fluid or umbilical cord tissue), skin tissue, bone tissue and / or tooth tissue.

[0249] In this application, the term "immune cell" generally refers to a cell that plays a role in an immune response. The immune cell may include lymphocytes, monocytes and / or granulocytes, and their precursors and / or mature derivatives. The immune cell may include T cells, B cells, Th cells, natural killer cells, monocytes, macrophages, eosinophils, basophils, mast cells, dendritic cells and / or granulocytes. The immune cell may include immune effector cells. The immune effector cells may participate in an immune response, such as promoting immune effector responses. The immune effector cells may include T cells, such as α / β T cells and γ / δ T cells, B cells, natural killer (NK) cells, natural killer T (NTK) cells, mast cells and bone marrow-derived phagocytes.

[0250] In this application, the term "fibrocyte" generally refers to a functionally inactive fibroblast. The fibrocyte can transform into a fibroblast (e.g., to participate in the repair process when the tissue is damaged). In this application, the term "muscle cell" generally refers to a cell or a group of cells derived from muscle. The muscle cell can be derived from cells and tissues of skeletal muscle, smooth muscle (e.g., from the digestive tract, bladder, and blood vessels), and cardiac muscle.

[0251] In this application, the term "plasmid" generally refers to a construct comprising genetic material. The plasmid can be designed to be able to deliver genetic material (e.g., one or more nucleic acid sequences) into a cell. The plasmid can contain an autonomously replicating sequence of a single-stranded or double-stranded nucleic acid (e.g., DNA or RNA) derived from any source. The plasmid can be used interchangeably with the term "vector" in this application. The plasmid can have different configurations, for example, it can be a linear plasmid, a circular plasmid or a supercoiled plasmid. The linear plasmid can be a linear DNA molecule. The supercoiled plasmid can include two nucleic acid chains that maintain a complete structure (e.g., it can include covalently closed circular DNA, cccDNA) and is in a supercoiled configuration. The circular plasmid can maintain a complete circular structure for at least one nucleic acid chain. The plasmid may not be integrated into the genome of the cell.

[0252] As used herein, the term "multiple cloning site" or "multiple cloning site (MCS)" generally refers to a nucleic acid sequence comprising at least one restriction site. The MCS allows for the ligation of nucleic acid molecules into the vectors described herein. For example, the restriction sites allow for the insertion of nucleic acid molecules at specific locations. The restriction sites may be restriction endonuclease recognition sites. For example, the restriction endonuclease can be AcIlHindIII, Sspl, MLuCI, Tsp509I, Pcil, AgeKBspMI, BfuAI, SexAI, MLuI, BceAI, HpyCH4IV, HpyCH4III, Bael, BsaXI, SpeI, Bsrl, Bmrl, BglII, AfeI, AluI, StuI, Seal, Clal, BspDI, PI-SceI, Nsil, Asel, Swail, CspCI, MfeI, BssSI, BmgBI, PmLl, Dralll, Ale1, EcoP15I, PvuII, AlwNI or BtsMutI.

[0253] In this application, the term "exogenous promoter" generally refers to a promoter that is not derived from the host in which it is located. The exogenous promoter can be transfected and / or inserted into the cells of the host (e.g., the genome of the cell). The promoter can be a recognition site for a polynucleotide (DNA or RNA) to which RNA polymerase binds. The RNA polymerase can effectively catalyze the assembly of a messenger RNA complementary to the appropriate DNA strand of the coding region. The number of the promoter can be one or more.

[0254] The exogenous promoter may be constitutive or inducible, and representative examples include PGK promoter, EF1α promoter, etc. The sequence of PGK promoter may be shown as SEQ ID NO: 26.

[0255] In this application, the term "gene editing" generally refers to the operation of inserting, deleting and / or replacing nucleic acids in the genome. The gene editing can be achieved by homology-directed repair (HDR), non-homologous end joining (NHEJ) or single base changes. The gene editing can use gene editing tools familiar to those skilled in the art, for example, zinc finger nuclease system (ZFN), TALEN system and / or CRISPR technology.

[0256] In this application, the term "gene editing knock-in" generally refers to a genetic engineering process (e.g., it can be referred to as knock-in), which involves a one-to-one replacement of DNA sequence information in a genetic locus or the insertion of sequence information not found in an endogenous locus. The gene editing knock-in can utilize gene homologous recombination. For example, in some cases, gene homologous recombination can be utilized to transfer exogenous functional genes (genes that did not originally exist in the genome or have been inactivated) into cells and homologously recombined with homologous sequences in the genome so that they are inserted into the genome and expressed in the cell. For example, the gene editing knock-in can cause exogenous genes to at least partially replace the cell genome. The gene editing knock-in can use CRISPR technology to achieve fixed-point "targeted knock-in". For another example, the gene editing knock-in can use a transposon and transposase system, such as PiggyBac (PB) transposase, and / or Sleeping Beauty (SB) transposase.

[0257] In this application, the term "donor plasmid" generally refers to a plasmid that can transcribe and / or translate the encoded exogenous gene in the cell to be introduced. For example, the donor plasmid can be suitable for the gene editing knock-in. For example, the donor plasmid can include a nucleic acid molecule encoding the exogenous gene. The donor plasmid can also include elements such as a promoter to regulate the expression of the exogenous gene (for example, production and / or accumulation at the transcriptional level and / or translation level). The donor plasmid can be a plasmid suitable for a eukaryotic expression system. Preferably, the donor plasmid of the present invention includes the nucleic acid molecule of the first aspect of the present invention.

[0258] In the present application, the term "exogenous gene to be knocked in" generally refers to a heterologous gene that can be introduced by gene editing knock-in. The exogenous gene to be knocked in can be integrated into the object to be introduced (e.g., a cell, such as a subject's body). The exogenous gene to be knocked in may include being integrated into the genome of the object to be introduced. The exogenous gene to be knocked in can be a natural gene derived from a different species; it can also be an engineered gene (e.g., a chimeric gene). In the present invention, representative exogenous genes to be knocked in include (but are not limited to): nucleic acid sequences encoding chimeric antigen receptors (CARs), nucleic acid sequences encoding IL-15 or functionally active fragments thereof, nucleic acid sequences encoding IL-21 or functionally active fragments thereof, and nucleic acid sequences encoding additional exogenous proteins (such as cytokines, BITEs, antibodies), etc.

[0259] In this application, the term "antibody" generally refers to an immunoglobulin that is reactive to a specified protein or peptide or a fragment thereof. The antibody can be an antibody from any class, including but not limited to IgG, IgA, IgM, IgD and IgE, and an antibody from any subclass (e.g., IgG1, IgG2, IgG3, and IgG4). The antibody can have a heavy chain constant region selected from, for example, IgG1, IgG2, IgG3, or IgG4. The antibody can also have a light chain selected from, for example, kappa (κ) or lambda (λ). The antibodies of the present application can be derived from any species.

[0260] In this application, the term "antigen-binding fragment" generally refers to a portion of an antibody molecule that comprises amino acid residues that interact with the antigen and impart specificity and affinity to the antibody for the antigen. Examples of antigen-binding fragments may include, but are not limited to, Fab, Fab', F(ab)2, Fv fragments, F(ab')2, scFv, di-scFv, and / or dAb. In this application, the term "Fab" generally refers to a fragment containing a heavy chain variable domain and a light chain variable domain, and also contains the constant domain of the light chain and the first constant domain (CH1) of the heavy chain; the term "Fab'" generally refers to a fragment that differs from Fab by the addition of a small number of residues (including one or more cysteines from the antibody hinge region) to the carboxyl terminus of the heavy chain CH1 domain; the term "F(ab')2" generally refers to a dimer of Fab', an antibody fragment comprising two Fab fragments connected by a disulfide bridge on the hinge region. The term "Fv" generally refers to the smallest antibody fragment that contains a complete antigen recognition and binding site. In some cases, the fragment may be composed of a dimer of a heavy chain variable region and a light chain variable region in tight non-covalent association; the term "dsFv" generally refers to a disulfide-stabilized Fv fragment in which the bond between a single light chain variable region and a single heavy chain variable region is a disulfide bond. The term "dAb fragment" generally refers to an antibody fragment consisting of a VH domain. In this application, the term "scFv" generally refers to a monovalent molecule formed by pairing a heavy chain variable domain and a light chain variable domain of an antibody covalently linked by a flexible peptide linker; such scFv molecules may have the general structure: NH2-VL-linker-VH-COOH or NH2-VH-linker-VL-COOH.

[0261] In this application, the term "bispecific antibody" generally refers to an antibody having a variable region that recognizes one or more epitopes on one or more antigens. Bispecific antibodies include, but are not limited to, full-length antibodies, antibodies with two or more VL and VH domains, antibody fragments such as Fab, Fv, dsFv, scFv, diabodies, and antibody fragments that have been covalently or non-covalently linked. In some cases, the bispecific antibody can recognize two different epitopes on the same or different antigens. In some cases, the bispecific antibody can recognize two different antigens. In this application, multispecific antibodies include bispecific or trispecific antibodies, or antigen-binding fragments thereof.

[0262] In this application, the terms "antigen binding domain" and "target binding domain" are used interchangeably and generally refer to a domain that can bind to a target antigen. The antigen binding domain may include antigen receptors and fragments thereof, antibodies or antigen binding fragments thereof that can specifically bind to the antigen. The antigen binding domain may be a domain that can bind to a tumor-associated antigen. In this application, the tumor-associated antigen may include but is not limited to: CD19, CD20, CD22, CD123, CD33 / IL3Ra, CD138, CD33, BCMA, CS1, C-Met, EGFRvIII, CEA, Her2, GD2, MAG3, GPC3, Claudin18.2, Mesothelin and NY-ESO-1.

[0263] In this application, the term "chimeric antigen receptor" generally refers to a fusion protein comprising an extracellular domain capable of binding to an antigen and at least one intracellular domain. CAR is a core component of a chimeric antigen receptor T cell (CAR-T), which may include an antigen (e.g., tumor-specific antigen and / or tumor-associated antigen) binding domain, a transmembrane domain, a co-stimulatory domain, and an intracellular signaling domain. In this application, the CAR can be based on the antigen (e.g., CD19) specificity of an antibody in combination with a T cell receptor activation intracellular domain. Genetically modified T cells expressing CAR can specifically recognize and eliminate malignant cells expressing target antigens. For descriptions of CAR and CAR-T cells, see, for example, Sadelain M, Brentjens R, Riviere I. The basic principles of chimeric antigen receptor design. Cancer Discov. 2013; 3(4): 388-398; Turtle CJ, Hudecek M, Jensen MC, Riddell SR. Engineered T cells for anti-cancer therapy. Curr Opin Immunol. 2012; 24(5): 633-639; Dotti G, Gottschalk S, Savoldo B, Brenner MK. Design and development of therapies using chimeric antigen receptor-expressing T cells. Immunol Rev. 2014; 257(1): 107-126. In the present invention, tumor-associated antigens (TAAs) include TAAs of hematological tumors and TAAs of solid tumors. Representative TAAs include (but are not limited to): GPC3, CD19, BCMA, GCC (GUCY2C), Her2, Claudin18.2 and Mesothelin.

[0264] In this application, the term "BiTE" generally refers to a bispecific T cell engager. The BiTE can be a single polypeptide chain molecule having two antigen binding domains, one of which binds to a T cell antigen and the second of which binds to an antigen present on the surface of a target cell (see WO05 / 061547; Baeuerle, P et al. (2008) " A New Class Of Antibodies That Recruit T Cells Drugs of the Future 33:137-147; or Bargou et al. (2008) "Tumor Regression in Cancer Patients by Very Low Doses of a T Cell-Engaging Antibody / 'Science 321:974-977).

[0265] In this application, the term "polyprotein" generally refers to a polypeptide chain comprising multiple protein molecules, wherein the multiple protein molecules may be present in series in the polypeptide chain. In the polypeptide chain, any two protein molecules may be optionally separated by a cleavable portion (e.g., a 2A peptide).

[0266] In this application, the term "homology arm" generally refers to a polynucleotide suitable for targeting the exogenous gene to be knocked into the donor plasmid to the genome by homologous recombination. The homologous recombination can refer to the recombination between sister chromatids (sister chromatin) or between DNA molecules containing homologous sequences on the same chromosome or within the molecule. The homology arms can have 2 (for example, there can be 5' homology arms and / or 3' homology arms). The homology arms can be located upstream and downstream of the exogenous gene to be knocked into the donor plasmid. In some cases, the targeted position of the exogenous gene to be knocked into the genome can produce a break due to the action of a nuclease. The homology arms can be exactly the same as the DNA sequence at both ends (i.e., 5' and / or 3' ends) of the break of the targeted position or have at least 80% identity. For example, the homology arms can be at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to the DNA sequences at both ends of the break at the targeted location. In the present application, the donor plasmid can comprise a 5' homology arm and / or a 3' homology arm.

[0267] In this application, the term "cell viability" generally refers to the ability of cells to survive under certain conditions. The cell viability can be measured by the ratio of viable cells to the total number of cells present under certain conditions over a certain period of time. The cell viability can reflect the effect of certain conditions on cells. For example, the higher the cell viability, the more favorable the conditions are for cell viability.

[0268] In this application, the term "cell expansion capacity" generally refers to the ability of a cell to proliferate and / or self-replicate. The cell expansion capacity can be measured by the total number of cells produced by cell expansion over a certain period of time. For example, the greater the increase in the number of cells over a certain period of time, the higher the cell expansion capacity. The cell expansion capacity can also be reflected in an improvement in cell function (e.g., proliferation).

[0269] In the present application, the term "cell killing ability" generally refers to the killing ability of a cell for its target cell. For example, immune effector cells (such as T cells, NK cells) can mediate the killing of target cells (such as tumor cells), and kill target cells. For example, the mediation can include the positioning of immune effector cells to target cells (for example, by mutual recognition of molecules and / or epitopes expressed by immune effector cells and target cells). The cell killing ability can be measured by the number of target cells that die due to cell-mediated target cell killing under certain time and conditions.

[0270] In this application, the term "cell secretory capacity" generally refers to the ability of a cell to secrete a secretory factor. For example, the secretory factor can be a molecule that leaves the cell due to secretion. The secretory factor can also include a protein encoded by an exogenous gene. The cell secretory capacity can be measured by the amount of secretory factor produced by the cell under certain conditions and time periods.

[0271] In this application, the term "cell preservation ability" generally refers to the ability of cells to survive and / or retain the original functions of cells under storage conditions. For example, the storage conditions may include long-term storage at ambient temperature or low temperature (e.g., non-refrigerated temperature or refrigerated temperature, such as storage under liquid nitrogen conditions). Preservation can reduce the metabolic level of the cells and temporarily remove the cells from the growth state. The cells can be revived after the preservation. The cell preservation ability can be measured by the ratio of the number of cells after the preservation to the number of cells before the preservation under certain time and conditions.

[0272] In this application, the term "cell recovery capacity" generally refers to the ability of cells to resume growth after re-culturing. Re-culturing can refer to thawing cells frozen in liquid nitrogen or at -80°C and then re-culturing them. Cell recovery capacity can be measured by the ratio of the number of cells that resume growth after re-culturing to the total number of cells re-cultured under a certain time and conditions.

[0273] In this application, the term "cell line" generally refers to a clonal population of cells that can continue to divide. For example, the cell line can acquire the ability to proliferate indefinitely in vitro.

[0274] In this application, the term "complementary" generally refers to Watson-Crick base pairing between nucleotides, and specifically refers to nucleotides that hydrogen bond to each other, wherein a thymine or uracil residue is linked to an adenine residue by two hydrogen bonds, and a cytosine and guanine residue are linked by three hydrogen bonds. Typically, nucleic acids include nucleotide sequences that are described as having "percent complementarity" with a specified second nucleotide sequence. Those skilled in the art will recognize that two complementary nucleotide sequences include a sense strand and an antisense strand.

[0275] In this application, the terms "homology", "identity" or "similarity" generally refer to the sequence similarity between two peptides or between two nucleic acid molecules. The term "homologous region" generally refers to a region on a donor molecule that has a certain degree of homology to the target sequence. Homology can be determined by comparing positions in each sequence. For example, homology between sequences can be determined by performing a sequence alignment. When a position in the compared sequences is occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence has less than 40% identity with one of the sequences of the present application, although preferably less than 25% identity. A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) has a certain percentage (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%) of "sequence identity" or "homology" with another sequence, meaning that when aligned, that percentage of bases (or amino acids) in the two sequences being compared are identical. The alignment and percentage homology or sequence identity can be determined using software programs known in the art, such as those described in Ausubel et al., eds. (2007) Current Protocols in Molecular Biology.

[0276] In this application, the term "transfection" generally refers to a method for introducing a biologically active substance (e.g., nucleic acid, protein, enzyme, or small molecule) into a cell. The nucleic acid can be DNA (delivered as a plasmid or oligomer) and / or RNA, or a combination thereof.

[0277] In this application, the term "electroporation" generally refers to a transfection method in which an external electric field is applied to cells. In certain embodiments, the electroporation method used is electrostatic poration.

[0278] In this application, the terms "IL15" and "IL-15" are used interchangeably and generally refer to the cytokine interleukin-15 and / or its functionally active fragments. IL-15 can bind to the IL-15 receptor on various different cells of the immune system, thereby mediating related signal transduction. The amino acid sequence of human IL-15 can be found in Uniprot KB: P40933. As used herein, the term "IL-15" includes human IL-15 (hIL-15), variants, isoforms and species homologs of hIL-15, and analogs having at least one common epitope with hIL-15 (such as fusion proteins containing IL-15, such as fusion proteins of IL-15 and Fc).

[0279] In this application, the terms "IL21" and "IL-21" are used interchangeably and generally refer to the cytokine interleukin-21 and / or its functionally active fragments. IL-21 can bind to the IL-21 receptor on various different cells of the immune system, thereby mediating related signal transduction. The amino acid sequence of human IL-21 can be found in UniProtKB: Q9HBE4. As used herein, the term "IL-21" includes human IL-21 (hIL-21), variants, isoforms and species homologs of hIL-21, and analogs having at least one common epitope with hIL-21 (such as fusion proteins containing IL-21, such as fusion proteins of IL-21 and Fc).

[0280] In this application, the term "functionally active fragment" generally refers to a fragment that has a partial region of a full-length protein or nucleic acid but retains or partially retains the biological activity or function of the full-length protein or nucleic acid. For example, a functionally active fragment can retain or partially retain the ability of the full-length protein to bind to another molecule. For example, a functionally active fragment of IL-15 can retain or partially retain the receptor binding function or one or more other biological activities of full-length IL-15. For example, a functionally active fragment of IL-21 can retain or partially retain the receptor binding function or one or more other biological activities of full-length IL-21.

[0281] Unless the context requires otherwise, the terms "comprising", "having" and "including" are used interchangeably in this application and generally mean that other components, elements, values, steps, etc. may also be included. In some cases, "comprising" covers the cases of "being" or "consisting of". For example, based on the description that a certain composition "comprising" ingredient "A", those skilled in the art can infer that, in some cases, the composition may consist only of ingredient A.

[0282] In this application, the term "about" generally means within 30%, within 25%, within 20%, within 15%, within 10%, within 9%, within 8%, within 7%, within 6%, within 5%, within 4%, within 3%, within 2%, within 1%, within 0.5% or within 0.05% of a specified value or range of values ​​involved in this application. In this application, when the term "about" is used before the first value in two or more values, it applies to each value in the series.

[0283] Detailed Description of the Invention

[0284] Isolated nucleic acid molecules and vectors

[0285] In a first aspect, the present application provides an isolated nucleic acid molecule comprising: a nucleic acid sequence encoding a chimeric antigen receptor (CAR); a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof; and a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof.

[0286] In certain embodiments, the nucleic acid molecule comprises, in order from 5' to 3', the nucleic acid sequence encoding CAR, the nucleic acid sequence encoding IL-15 or a functionally active fragment thereof, and the nucleic acid sequence encoding IL-21 or a functionally active fragment thereof. For example, the nucleic acid sequence encoding IL-15 or a functionally active fragment thereof may be included on the 3' side (or downstream) of the nucleic acid sequence encoding CAR, and one or more first spacer nucleic acid sequences may be included between the two. For example, the 3' end of the nucleic acid sequence encoding CAR may be connected to the 5' end of the first spacer nucleic acid sequence, and the 3' end of the first spacer nucleic acid sequence may be connected to the 5' end of the nucleic acid sequence encoding IL-15 or a functionally active fragment thereof. For example, the nucleic acid sequence encoding IL-21 or a functionally active fragment thereof may be included on the 3' side (or downstream) of the nucleic acid sequence encoding IL-15 or a functionally active fragment thereof, and one or more second spacer nucleic acid sequences may be included between the two. For example, the 3' end of the nucleic acid sequence encoding IL-15 or its functionally active fragment can be connected to the 5' end of the second spacer nucleic acid sequence, and the 3' end of the second spacer nucleic acid sequence can be connected to the 5' end of the nucleic acid sequence encoding IL-21 or its functionally active fragment. The first spacer nucleic acid sequence and the second spacer nucleic acid sequence can be the same or different. In certain embodiments, the first spacer nucleic acid sequence and / or the second spacer nucleic acid sequence may contain nucleic acid sequences encoding one or more other proteins.

[0287] In the present application, the chimeric antigen receptor CAR may include a target binding domain targeting a tumor-associated antigen. For example, the chimeric antigen receptor may include at least one target binding domain targeting an antigen. For example, the chimeric antigen receptor can specifically bind to an antigen. For example, the chimeric antigen receptor can specifically bind to two antigens, and / or, can specifically bind to at least two different epitopes of an antigen. In the present application, the antigen can be a tumor-associated antigen (TAA). The tumor-associated antigen can be an associated antigen of the following tumor cells: for example, breast cancer cells, B cell lymphomas, Hodgkin lymphoma cells, ovarian cancer cells, prostate cancer cells, mesothelioma cells, lung cancer cells (for example, small cell lung cancer cells), non-Hodgkin B cell lymphoma (B-NHL) cells, ovarian cancer cells, prostate cancer cells, mesothelioma cells, lung cancer cells (for example, small cell lung cancer cells), melanoma cells, chronic lymphocytic leukemia cells, Glioma, glioblastoma, medulloblastoma, colorectal cancer cells, etc. Cancer cell-associated antigens can also be expressed by non-cancerous cells.

[0288] In the present application, the tumor-associated antigen can be selected from: GPC3, CD19, BCMA, Claudin18.2 and Mesothelin. For example, the antigen can be CD19. For example, the antigen can be GPC3, or BCMA.

[0289] In some cases, the target binding domain can be a single-chain antibody (scFv), or a cAb VHH (camelid antibody variable domain) and its humanized variants, IgNAR VH (shark antibody variable domain) and its humanized variants, sdAb VH (single domain antibody variable domain) and "camelized" antibody variable domain. The target binding domain can also be a T cell receptor (TCR)-based recognition domain, such as a single-chain TCR (scTv, a single-chain two-domain TCR containing VαVβ).

[0290] In some cases, the target binding domain of the CAR may comprise the amino acid sequence shown in SEQ ID NO:1.

[0291] In certain cases, the target binding domain of the CAR may comprise an amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO. 31 or 32.

[0292] In the present application, the chimeric antigen receptor may include a transmembrane domain. The N-terminus of the transmembrane domain may be directly or indirectly connected to the C-terminus of the target binding domain. In the present application, any transmembrane (TM) structure provided for inserting a polypeptide into the cell membrane of a eukaryotic cell (e.g., a mammalian cell) may be applicable to the transmembrane domain.

[0293] For example, the transmembrane domain may comprise a transmembrane domain derived from a protein selected from the group consisting of the alpha, beta or zeta chain of the T cell receptor, CD28, CD3e, CD45, CD4, CD5, CD8a, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 and CD154.

[0294] In some cases, the chimeric antigen receptor may comprise a hinge region. The hinge region may be located between the target binding domain and the transmembrane domain. The hinge region may be an immunoglobulin heavy chain hinge region, or a hinge region polypeptide from a receptor (e.g., a hinge region from CD8).

[0295] The hinge region may have a length of about 4 to about 50 amino acids, for example, about 4 to about 10 amino acids, about 10 to about 15 amino acids, about 15 to about 20 amino acids, about 20 to about 25 amino acids, about 25 to about 30 amino acids, about 30 to about 40 amino acids, or about 40 to about 50 amino acids.

[0296] The hinge region may comprise at least one cysteine. The amino acid sequence of the hinge region may be known in the art, see, for example, Tan et al. (1990) Proc. Natl. Acad. Sci. USA 87:162; and Huck et al. (1986) Nucl. Acids Res. 14:1779.

[0297] In the present application, the hinge region may comprise the amino acid sequence of a human IgG1, IgG2, IgG3 or IgG4 hinge region. For example, the hinge region may comprise one or more amino acid substitutions and / or insertions and / or deletions compared to a wild-type (naturally occurring) hinge region.

[0298] In the present application, the chimeric antigen receptor may include a costimulatory domain. The length of the costimulatory domain may be about 30-about 70 amino acids. The costimulatory domain may be derived from a polypeptide of a receptor. For example, the costimulatory domain may be the intracellular portion of a transmembrane protein. For example, the costimulatory domain may include a costimulatory domain derived from the following proteins: 4-1BB (CD137), CD28, ICOS, OX-40, BTLA, CD27, CD30, GITR and / or HVEM. For example, the costimulatory domain may include a costimulatory domain derived from the following proteins: CD28, 4-1BB, OX-40 and / or ICOS.

[0299] In the present application, the chimeric antigen receptor may further include a linker. The linker may be located between the transmembrane domain and the costimulatory domain. The linker may be a connecting peptide. For example, the connecting peptide may have a length of about 6 to about 40 amino acids. The connecting peptide may have any amino acid sequence as long as it has a flexible structure.

[0300] In the present application, the chimeric antigen receptor may include an intracellular signaling domain. For example, the intracellular signaling domain may include an intracellular signaling domain derived from the following proteins: CD8β, CD4, CD3ζ, CD28, CD134 and / or CD7. For example, the intracellular signaling domain may include a signaling domain derived from CD3ζ.

[0301] In the present application, the intracellular signaling domain may comprise a portion containing an ITAM motif from an ITAM motif-containing polypeptide. For example, the intracellular signaling domain may include DAP12; FCER1G (Fcε receptor Iγ chain); CD3D (CD3δ); CD3E (CD3ε); CD3G (CD3γ); CD3Z (CD3ζ); and CD79A (antigen receptor complex-associated protein α chain).

[0302] In certain embodiments, the CAR may comprise a hinge region, a transmembrane domain, a costimulatory domain, and an intracellular domain. For example, the hinge region may be a hinge region derived from CD8α. In certain cases, the hinge region may comprise the hinge region sequence in the amino acid sequence shown in SEQ ID NO: 2. For example, the transmembrane domain may be a transmembrane domain derived from CD8α. In certain cases, the transmembrane domain may comprise the transmembrane domain portion in the amino acid sequence shown in SEQ ID NO: 2. In certain embodiments, the hinge region and the transmembrane domain may comprise the amino acid sequence shown in SEQ ID NO: 2. For example, the costimulatory domain may be a costimulatory domain derived from 41BB. In certain cases, the costimulatory domain may comprise the amino acid sequence shown in SEQ ID NO: 3. For example, the intracellular domain may be an intracellular domain derived from CD3ζ. In certain cases, the intracellular domain may comprise the amino acid sequence shown in SEQ ID NO: 4. In certain embodiments, the CAR comprises the amino acid sequence shown in SEQ ID NO: 5.

[0303] In the present application, the IL-15 or functionally active fragment thereof may comprise its endogenous signal peptide or a signal peptide derived from another protein. For example, the IL-15 or functionally active fragment thereof may comprise a signal peptide derived from IL-7. In the present application, the IL-15 or functionally active fragment thereof may comprise the amino acid sequence set forth in any one of SEQ ID NOs: 6-7, and 9.

[0304] In the present application, the IL-21 or functionally active fragment thereof may comprise its endogenous signal peptide or a signal peptide derived from another protein. For example, the IL-21 or functionally active fragment thereof may comprise a signal peptide derived from CCL19. In the present application, the IL-21 or functionally active fragment thereof may comprise the amino acid sequence set forth in any one of SEQ ID NOs: 10-11 and 13.

[0305] The nucleic acid molecules described herein may further comprise one or more nucleic acid sequences encoding cleavable moieties. The nucleic acid sequence encoding the cleavable moiety may be located between any two sequences selected from the group consisting of: a nucleic acid sequence encoding the chimeric antigen receptor (CAR); a nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof; and a nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof. For example, the nucleic acid sequence encoding the cleavable moiety may be included between the nucleic acid sequence encoding the CAR and the nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof. For example, the nucleic acid sequence encoding the cleavable moiety may be included between the nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof and the nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof. In certain embodiments, the nucleic acid sequence encoding the first cleavable moiety may be included between the nucleic acid sequence encoding the CAR and the nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof, and the nucleic acid sequence encoding the second cleavable moiety may be included between the nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof and the nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof. The first cleavable moiety and the second cleavable moiety may be the same or different.

[0306] For example, the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof can be expressed in the form of a polyprotein. For example, the cleavable portion can be included between two or more proteins in the polyprotein.

[0307] In the present application, the cleavable moiety may comprise a 2A peptide. The 2A peptide may comprise P2A, T2A, F2A or E2A.

[0308] For example, the cleavable portion may comprise the amino acid sequence set forth in any one of SEQ ID NOs: 14-16.

[0309] In certain cases, the nucleic acid molecules of the present application may further comprise nucleic acid sequences encoding one or more other exogenous proteins.

[0310] In the present application, the other exogenous proteins may include any one or more functional proteins. For example, the other exogenous proteins may be selected from the group consisting of cytokines, chemokines, and antibodies or antigen-binding fragments thereof. For example, the functional proteins may be used to treat diseases associated with genetic defects. For example, the functional proteins may be proteins that are missing and / or mutated in the host cell into which the transfected cells are located.

[0311] In some cases, the one or more other exogenous proteins may comprise an antibody or an antigen-binding fragment thereof. For example, the antibody or antigen-binding fragment thereof may comprise a multispecific antibody or an antigen-binding fragment thereof. For example, the multispecific antibody or antigen-binding fragment thereof may simultaneously target immune effector cells (e.g., T cells, NK cells) and tumor cells.

[0312] For example, the multispecific antibody or antigen-binding fragment thereof may include a bispecific T cell engager (BiTE). For example, the BiTE can specifically bind to at least one tumor-associated antigen (TAA) and a T cell. For example, the BiTE can specifically bind to an antigen expressed on the surface of a T cell, for example, it can specifically bind to a CD3 receptor. For example, the BiTE can specifically target an MHC-independent tumor-associated antigen (TAAS). For example, the BiTE may comprise a CD3 binding domain. The BiTE may comprise at least one antigen-binding portion, for example, it may comprise at least one single-chain antibody scFv. For example, the BiTE may comprise a tumor-associated antigen binding domain. For example, the tumor-associated antigen may be selected from: GPC3, CD19, BCMA, Claudin18.2 and Mesothelin.

[0313] In the present application, when the isolated nucleic acid molecule encodes both a CAR and a BiTE, the tumor-associated antigen targeted by the BiTE may be the same as or different from the tumor-associated antigen targeted by the CAR. In certain embodiments, the BiTE and the CAR target the same epitope. In certain embodiments, the BiTE and the CAR target the same target, but each specifically recognizes or binds to a different epitope of the target. In certain embodiments, the BiTE and the CAR target different targets.

[0314] In the present application, the isolated nucleic acid molecules may also include one or more homology regions. For example, each of the homology regions may include at least 10 nucleotides (for example, at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, at least 50 nucleotides, at least 60 nucleotides, at least 70 nucleotides, at least 80 nucleotides, at least 90 nucleotides, at least 100 nucleotides, at least 110 nucleotides, at least 120 nucleotides, at least 130 nucleotides, at least 140 nucleotides, at least 150 nucleotides, at least 160 nucleotides, at least 170 nucleotides, at least 180 nucleotides, at least 190 nucleotides, at least 200 nucleotides or more). For example, in the isolated nucleic acid molecules, the homology regions may be located at 3' ends and / or 5' ends of the nucleic acid sequence of the coding CAR, IL-15 or its functionally active fragment or IL-21 or its functionally active fragment. In certain embodiments, at least one of the homologous regions is located 5' to the nucleic acid sequence encoding the CAR, and at least another homologous region is located 3' to the nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof.

[0315] For example, the nucleotide sequence of the homology region (or homology arm) can be respectively with the 5' end and / or 3' end of the genomic DNA of the immune cell to be modified to be knocked into the position and have at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identity. For example, the homology arm can be 100-1000bp size. For example, the homology arm can be about 150bp-1000bp, can be about 200bp-1000bp, can be about 300bp-1000bp, can be about 400bp-1000bp, can be about 800bp-1000bp.

[0316] In certain embodiments, the isolated nucleic acid molecule of the present application further comprises a 5' homology arm, which may be homologous to the target region in the immune cell genome. The target region may be located at a target gene (e.g., a coding region, a non-coding region, or other regulatory region of the target gene). The target gene may be selected from: TRBC, TRAC, PD-1, CD95, AAVS1, and CCR5. In certain embodiments, in the isolated nucleic acid molecule, the 5' homology arm is located upstream of the nucleic acid sequence encoding the chimeric antigen receptor (CAR). For example, the 5' homology arm may include the nucleic acid sequence shown in SEQ ID NO: 17.

[0317] In certain embodiments, the isolated nucleic acid molecule of the present application further comprises a 3' homology arm, which may be homologous to a target region in the immune cell genome. The target region may be located at a target gene (e.g., a coding region, a non-coding region, or other regulatory region of the target gene). The target gene may be selected from the group consisting of: TRBC, TRAC, PD-1, CD95, AAVS1, and CCR5. In certain embodiments, in the isolated nucleic acid molecule, the 3' homology arm is located downstream of the nucleic acid sequence encoding IL-21 or a functionally active fragment thereof. For example, the 3' homology arm may comprise the nucleic acid sequence shown in SEQ ID NO: 18.

[0318] For example, the isolated nucleic acid molecule of the present application may comprise (in order from 5' to 3'): 5' homology arm - nucleic acid sequence encoding CAR - nucleic acid sequence encoding a cleavable portion (e.g., 2A peptide) - nucleic acid sequence encoding IL-15 or a functionally active fragment thereof - nucleic acid sequence encoding a cleavable portion (e.g., 2A peptide) - nucleic acid sequence encoding IL-21 or a functionally active fragment thereof - 3' homology arm.

[0319] For example, the isolated nucleic acid molecule of the present application may comprise (in order from 5' to 3'): 5' homology arm - a nucleic acid sequence encoding a CAR - a nucleic acid sequence encoding a cleavable portion (e.g., a 2A peptide) - a nucleic acid sequence encoding an IL-15 or a functionally active fragment thereof - a nucleic acid sequence encoding a cleavable portion (e.g., a 2A peptide) - a nucleic acid sequence encoding an IL-21 or a functionally active fragment thereof - a polyA-3' homology arm.

[0320] For example, the isolated nucleic acid molecule of the present application may comprise (in order from 5' to 3'): 5' homology arm - a nucleic acid sequence encoding a CAR - a nucleic acid sequence encoding a cleavable portion (e.g., a 2A peptide) - a nucleic acid sequence encoding an IL-7 signal peptide - a nucleic acid sequence encoding an IL-15 or a functionally active fragment thereof - a nucleic acid sequence encoding a cleavable portion (e.g., a 2A peptide) - a nucleic acid sequence encoding a CCL19 signal peptide - a nucleic acid sequence encoding an IL-21 or a functionally active fragment thereof - a polyA-3' homology arm.

[0321] In certain embodiments, the isolated nucleic acid molecule comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 20-21, 23-24, and 27-30.

[0322] The isolated nucleic acid molecule of the present application can be integrated into the genome of the immune cell. For example, the expression of the isolated nucleic acid molecule can be regulated by the endogenous promoter of the immune cell genome. For example, after the isolated nucleic acid molecule is integrated into the genome of the cell, its expression can be regulated by an endogenous promoter. For example, the homologous region can be homologous to the target region of the immune cell genomic DNA. For example, the target region can be located at a target gene (for example, a coding region, a non-coding region or other regulatory region of the target gene). The target gene can be selected from: TCR-β subunit constant gene (TRBC), TCR-α subunit constant gene (TRAC), PD-1, CD95, AAVS1 and CCR5.

[0323] In the present application, the size of the isolated nucleic acid molecule can be at least about 1000 bp (for example, it can be at least about 1500 bp, it can be at least about 2000 bp, it can be at least about 2500 bp, it can be at least about 3000 bp, it can be at least about 3500 bp, it can be at least about 4000 bp, at least about 4500 bp, at least about 5000 bp, at least about 5500 bp, at least about 6000 bp, at least about 6500 bp, at least about 7000 bp, at least about 7500 bp, at least about 8000 bp, at least about 8500 bp, at least about 9000 bp, at least about 9500 bp or more), wherein the isolated nucleic acid molecule is integrated into the genome of the transfected cell. For example, the isolated nucleic acid molecule can be at least about 1 kb in size, e.g., at least about 1.5 kb, at least about 2 kb, at least about 2.5 kb, at least about 3 kb, at least about 3.5 kb, at least about 4 kb, at least about 4.5 kb, at least about 5 kb, at least about 5.5 kb, at least about 6 kb, at least about 6.5 kb, at least about 7 kb, at least about 7.5 kb, at least about 8 kb, at least about 8.5 kb, at least about 9 kb or larger.

[0324] In the present application, the isolated nucleic acid molecule may include a circular nucleic acid molecule, a supercoiled nucleic acid molecule and / or a linear nucleic acid molecule.

[0325] In the present application, the isolated nucleic acid molecule may include a DNA molecule and / or an RNA molecule.

[0326] In the present application, the isolated nucleic acid molecule may include a single-stranded nucleic acid molecule and / or a double-stranded nucleic acid molecule.

[0327] The present application also provides a vector, which may comprise the isolated nucleic acid molecule described herein. In some cases, the vector is a non-viral vector (e.g., does not comprise any viral components or any characteristic nucleic acid sequences derived from viruses). For example, the vector may be a plasmid.

[0328] In this application, the term "vector" can be used to refer to a nucleic acid molecule separated from a vector for introduction into a cell into which a heterologous nucleic acid sequence can be inserted, into which the nucleic acid sequence can be replicated and / or expressed. The nucleic acid sequence can be "heterologous", which means that the nucleic acid sequence is foreign to the cell to be transfected or the nucleic acid sequence to be inserted. Vectors include DNA, RNA, plasmids, cosmids and artificial chromosomes (e.g., YAC) and the like. Those skilled in the art can construct vectors by recombinant preparation technology (e.g., Sambrook et al., 2001; Ausubel et al., 1996). Vectors can be used to transfect cells to produce antibodies or other exogenous proteins (e.g., CAR, cytokines, etc.).

[0329] In the present application, the vector may include regulatory sequences, such as promoters. A promoter is typically a region in a nucleic acid sequence that controls transcription initiation and rate. A promoter may include genetic elements that can bind regulatory proteins and molecules (e.g., RNA polymerase and other transcription factors). A promoter may or may not be used in conjunction with an "enhancer," which refers to a cis-acting regulatory sequence that participates in the transcriptional activation of a nucleic acid sequence.

[0330] Vectors or constructs generally comprise at least one termination signal. A "termination signal" or "terminator" is composed of a DNA sequence that participates in the specific termination of an RNA transcript by RNA polymerase. Therefore, in certain embodiments, it is contemplated that the termination signal produced by the RNA transcript is terminated. In eukaryotic systems, the terminator region may also comprise a specific DNA sequence that allows site-specific cleavage of the new transcript to expose a polyadenylation site. This signals a specialized endogenous polymerase to add an extended sequence of approximately 200 A residues (polyA) to the 3' end of the transcript. RNA molecules modified with this polyA tail appear more stable and are more effectively translated. Therefore, in other embodiments relating to eukaryotic organisms, the terminator may comprise a signal for cutting RNA, for example, the terminator signal may promote polyadenylation information.

[0331] The isolated nucleic acid molecule or vector of the present application may also comprise a polyadenylation signal to effect appropriate polyadenylation of the transcript.

[0332] In certain embodiments, the vector may contain one or more origins of replication (often referred to as "ori"), which are specific nucleic acid sequences at which replication is initiated. Alternatively, if the host cell is yeast, an autonomously replicating sequence (ARS) may be used.

[0333] In the present application, the plasmid may comprise a circular plasmid. For example, the plasmid may be free from the interference of the DNase process and be enzymolyzed. For example, the plasmid may be a circular plasmid, a supercoiled plasmid and / or a linear plasmid. In the present application, the plasmid may comprise a multiple cloning site.

[0334] For example, the isolated nucleic acid molecule can be extracted from the host cell. Common plasmid extraction methods are well known to those skilled in the art.

[0335] Method, kit and transfection composition for preparing immune cells

[0336] On the other hand, the present application provides a method for preparing modified immune cells. The method includes, using the isolated nucleic acid molecule described in the present application (for example, it includes: encoding the chimeric antigen receptor (CAR) nucleic acid sequence; encoding the IL-15 or its functionally active fragment nucleic acid sequence; and encoding the IL-21 or its functionally active fragment nucleic acid sequence), or the vector described in the present application (for example, a plasmid vector comprising the nucleic acid molecule) transfection (for example, by electroporation transfection) immune cells to be modified.

[0337] For example, the method may include transfecting (e.g., by electroporation) the immune cell to be modified with the isolated nucleic acid molecule described herein (e.g., which comprises, in order from 5' to 3',: a nucleic acid sequence encoding the chimeric antigen receptor (CAR); a nucleic acid sequence encoding the IL-15 or a functionally active fragment thereof; and a nucleic acid sequence encoding the IL-21 or a functionally active fragment thereof), or the vector described herein (e.g., a plasmid vector comprising the nucleic acid molecule).

[0338] In certain embodiments, the method may include: transfecting the immune cell to be modified with a transfection composition comprising a nucleic acid molecule described herein, or a vector described herein, so that the cell comprises and / or expresses the nucleic acid molecule, wherein at least a portion (e.g., at least 1 w / w%, at least 5 w / w%, at least 10 w / w%, at least 15 w / w%, at least 20 w / w%, at least 25 w / w%, at least 30 w / w%, at least 35 w / w%, at least 40 w / w%, at least 45 w / w%, at least 50 w / w%, at least 55 w / w%, at least 60 w / w%, at least 65 w / w%, at least 70 w / w%, at least 75 w / w%, at least 80 w / w%, at least 85 w / w%, at least 90 w / w%, at least 95 w / w%, at least 99 w / w%, at least 100 w / w%) of the nucleic acid molecule or the vector is obtained from a host cell (e.g., at least a portion of the plasmid is obtained from a microbial host cell); and in the cell obtained from the host cell In the nucleic acid molecule portion or the vector portion, the content of the genomic DNA of the host cell is about 10% (w / w) or less (e.g., about 9% (w / w) or less, about 8% (w / w) or less, about 7% (w / w) or less, about 6% (w / w) or less, about 5% (w / w) or less, about 4% (w / w) or less, about 3% (w / w) or less, about 2% (w / w) or less, about 1.5% (w / w) or less, about 1% (w / w) or less, about 9‰ ( w / w) or less, about 8‰ (w / w) or less, about 7‰ (w / w) or less, about 6‰ (w / w) or less, about 5‰ (w / w) or less, about 4‰ (w / w) or less, about 3‰ (w / w) or less, about 2‰ (w / w) or less, about 1.5‰ (w / w) or less, about 1‰ (w / w) or less, about 0.5‰ (w / w) or less, about 0.1‰ (w / w) or less, about 0.01‰ (w / w) or less, about 0.001‰ (w / w) or less or lower).

[0339] In some embodiments, the method may include: treating the isolated nucleic acid molecule with DNase. In some embodiments, the DNase can non-specifically cut linear DNA. In some embodiments, the DNase includes an exonuclease. In some embodiments, the treatment includes treating the isolated nucleic acid molecule with MgCl2. 2+ and Ca 2+ The isolated nucleic acid molecule is contacted with the DNase in the presence of .

[0340] In certain embodiments, the method may include reducing the amount of genomic DNA from the host cell in the fraction of isolated nucleic acid molecules obtained from the host cell. For example, after the reduction, the content of genomic DNA in the host cell can be about 10% (w / w) or less (for example, about 10% or less, about 9% or less, about 8% or less, about 7% or less, about 6% or less, about 5% or less, about 4% or less, about 3% or less, about 2.5% or less, about 2% or less, about 1.5% or less, about 1% or less, about 9‰ or less, about 8‰ or less, about 7‰ or less, about 6‰ or less, about 5.5‰ or less, about 5‰ or less, about 4.5‰ or less, about 4‰ or less, about 3.5‰ or less, about 3‰ or less, about 2.5‰ or less, about 2‰ or less, about 1.5‰ or less, about 1‰ or less, about 0.5‰ or less, about 0.3‰ or less, about 0.1‰ or less, about 0.01‰ or less, about 0.001‰ or less or less; all are mass percentages).

[0341] In some embodiments, the method may include: treating the nucleic acid molecule portion obtained from the separation of the host cell with DNase. In some embodiments, the DNase can non-specifically cut linear DNA. In some embodiments, the DNase includes an exonuclease. In some embodiments, the treatment includes MgCl2 2+ and Ca 2+ The isolated nucleic acid molecule portion obtained from the host cell is contacted with the DNase in the presence of.

[0342] In the present application, the transfection efficiency of cells transfected with the isolated nucleic acid molecule treated with the deoxyribonuclease (DNase) can be increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 1.0%, at least about 110%, at least about 120%, at least about 130%, at least about 140%, at least about 150%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, at least about 1000% or more compared to the isolated nucleic acid molecule that has not been treated with the deoxyribonuclease (DNase).

[0343] For example, the methods of the present application can be in vitro methods or ex vivo methods.

[0344] On the other hand, the present application provides a kit for transfection (e.g., electroporation). The kit comprises: 1) a portion of a nucleic acid molecule isolated from a host cell as described in any aspect of the present application (e.g., a plasmid obtained from a microbial host cell); and 2) a reagent capable of reducing or degrading the genomic DNA of the host cell. In certain embodiments, the reagent in 2) comprises one or more selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide. In certain embodiments, the DNase is capable of non-specifically cutting linear DNA. In certain embodiments, the DNase comprises an exonuclease. In certain embodiments, the kit further comprises a reagent containing Mg. 2+ and Ca 2+ of reagents.

[0345] In the present application, the kit may further include reagents and / or instruments required to obtain the transformed cells required for the electrotransfer. For example, the transformed cells may be stored at ultra-low temperatures (e.g., -70°C). In the present application, when performing the electrotransfer, the voltage of the electrotransfer instrument may be approximately 1500-2500V. In the present application, the electrotransfer cuvette may be adapted to be kept at ultra-low temperatures for the electrotransfer.

[0346] In the present application, said DNase can cut single-stranded DNA and / or double-stranded DNA.For example, said DNase can non-specifically cut linear DNA.For example, said DNase can comprise exonuclease.For example, there can be no any RNase among said DNase.In some embodiments, said DNase can not cut circular DNA.In some embodiments, said DNase can not cut single-stranded DNA.

[0347] In the present application, the kit may further comprise a buffer solution, which may contain Mg 2+ and Ca 2+ For example, the buffer may be a reaction buffer corresponding to the DNase. In the present application, the kit may further comprise deionized water (eg, DEPC-treated) required for DNase enzymatic DNA hydrolysis.

[0348] On the other hand, the present application provides a kit comprising: 1) an isolated nucleic acid molecule portion obtained from a host cell as described in any aspect of the present application; and 2) instructions for use, wherein the instructions describe processing the isolated nucleic acid molecule portion obtained from a host cell (e.g., a plasmid obtained from a microbial host cell) in 1) by the method of the present application and / or determining the quality of a transfection composition comprising the isolated nucleic acid molecule portion obtained from a host cell (e.g., a plasmid obtained from a microbial host cell) by the method of the present application.

[0349] In another aspect, the present application provides a transfection composition comprising an isolated nucleic acid molecule treated by the method described herein.

[0350] In the present application, the transfection efficiency of the transfection composition (isolated nucleic acid molecule or vector, such as a plasmid) on cells can be determined by: 1) determining the proportion of cells expressing the isolated nucleic acid molecule among the transfected cells, wherein the transfection composition (or plasmid) contains the isolated nucleic acid molecule; and / or 2) determining the proportion of cells containing the isolated nucleic acid molecule among the transfected cells, wherein the transfection composition contains the isolated nucleic acid molecule.

[0351] In another aspect, the present application provides immune cells transfected with the isolated nucleic acid molecule, vector or transfection composition described herein.

[0352] In another aspect, the present application provides immune cells prepared by the method described in the present application.

[0353] On the other hand, the present application provides a cell population comprising the cells and / or their progeny described herein. For example, the cell population may comprise at least 10 3 (e.g., at least 10 4 At least 10 5 At least 10 6 At least 10 7 At least 10 8 At least 10 9 At least 10 10 or more) of the cells.

[0354] On the other hand, the present application provides a pharmaceutical composition comprising the isolated nucleic acid molecules, vectors, transfection compositions, immune cells, and / or cell populations described herein. In certain embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant. The pharmaceutically acceptable adjuvant may include, for example, a substance that does not cause significant stimulation to the organism and does not significantly negatively affect the biological activity and properties of the administered active ingredient (e.g., modified cells or cell populations). For example, the pharmaceutically acceptable adjuvant may include, but is not limited to, a diluent, a buffer, an adhesive, a surfactant, a humectant, an adsorption carrier, a lubricant, a filler and / or a disintegrant.

[0355] In another aspect, the present application provides the use of the isolated nucleic acid molecules, vectors, cells, cell populations, and / or pharmaceutical compositions described herein for the preparation of a medicament. In certain embodiments, the medicament is for preventing, treating, and / or ameliorating cancer.

[0356] In another aspect, the present application provides a method for preventing, treating, and / or alleviating a disease or condition in a subject, the method comprising administering to the subject an effective amount of the isolated nucleic acid molecule, the vector, the transfection composition, the cell, the cell population, and / or the pharmaceutical composition described herein. In certain embodiments, the disease or condition is cancer.

[0357] On the other hand, the present application provides an electroporation method (e.g., a plasmid electroporation method), comprising: electroporating an immune cell (e.g., a T cell) with a plasmid comprising a nucleic acid sequence encoding a CAR, encoding an IL-15 or a functionally active fragment thereof, and encoding an IL-21 or a functionally active fragment thereof, so that the immune cell comprises and / or expresses the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof, wherein the plasmid is extracted from a host cell (e.g., a microbial host cell), and the content of the genomic DNA of the host cell contained in the plasmid accounts for about 10% (w / w) or less of the plasmid DNA content (e.g., about 9% (w / w) or less, about 8% (w / w) or less, about 7% (w / w) or less, about 6% (w / w) or less, about 5% (w / w) or less, about 4% (w / w) or less, about 3% (w / w) or less, about 2% (w / w) or less). Below, about 1.5% (w / w) below, about 1% (w / w) below, about 9‰ (w / w) below, about 8‰ (w / w) below, about 7‰ (w / w) below, about 6‰ (w / w) below, about 5‰ (w / w) below, about 4‰ (w / w) below, about 3‰ (w / w) below, about 2‰ (w / w) below, about 1.5‰ (w / w) below, about 1‰ (w / w) below, about 0.5‰ (w / w) below, about 0.1‰ (w / w) below, about 0.01‰ (w / w) below, about 0.001‰ (w / w) below or lower).

[0358] On the other hand, the present application provides an electroporation method (e.g., a plasmid electroporation method), comprising: electroporating immune cells (e.g., T cells) with a plasmid containing nucleic acid sequences encoding CAR, IL-15 or a functionally active fragment thereof, and IL-21 or a functionally active fragment thereof in order from 5' to 3', so that the immune cells contain and / or express the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof, the plasmid is extracted from a host cell, and the content of the genomic DNA of the host cell contained in the plasmid accounts for less than about 10% (w / w) of the plasmid DNA content (e.g., less than about 9% (w / w), less than about 8% (w / w), less than about 7% (w / w)). w / w), about 6% (w / w) or less, about 5% (w / w) or less, about 4% (w / w) or less, about 3% (w / w) or less, about 2% (w / w) or less, about 1.5% (w / w) or less, about 1% (w / w) or less, about 9‰ (w / w) or less, about 8‰ (w / w) or less, about 7‰ (w / w) or less, about 6‰ (w / w) or less, about 5‰ (w / w) or less, about 4‰ (w / w) or less, about 3‰ (w / w) or less, about 2‰ (w / w) or less, about 1.5‰ (w / w) or less, about 1‰ (w / w) or less, about 0.5‰ (w / w) or less, about 0.1‰ (w / w) or less, about 0.01‰ (w / w) or less, about 0.001‰ (w / w) or less or lower).

[0359] On the other hand, the present application provides a one-step electroporation method, which comprises: electroporating immune cells (e.g., T cells) with a plasmid comprising a nucleic acid sequence encoding CAR, encoding IL-15 or a functionally active fragment thereof, and encoding IL-21 or a functionally active fragment thereof, so that the immune cells contain and / or express the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof (e.g., the coding sequences of the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof are knocked into the genome of the immune cells, and one or more endogenous genes in the genome of the immune cells are knocked out, for example, the endogenous genes may include CD3, PD-1, CD95, TRBC, TRAC, AAVS1 or CCR5, etc.), the plasmid is extracted from the host cell, and the content of the genomic DNA of the host cell contained in the plasmid is The plasmid DNA content is about 10% (w / w) or less (e.g., about 9% (w / w) or less, about 8% (w / w) or less, about 7% (w / w) or less, about 6% (w / w) or less, about 5% (w / w) or less, about 4% (w / w) or less, about 3% (w / w) or less, about 2% (w / w) or less, about 1.5% (w / w) or less, about 1% (w / w) or less, about 9‰ (w / w) or less, about 8‰ (w / w) or less, about 7‰ (w / w) or less, about 6‰ (w / w) or less, about 5‰ (w / w) or less, about 4‰ (w / w) or less, about 3‰ (w / w) or less, about 2‰ (w / w) or less, about 1.5‰ (w / w) or less, about 1‰ (w / w) or less, about 0.5‰ (w / w) or less, about 0.3‰ (w / w) or less, about 0.1‰ (w / w) or less, about 0.01‰ (w / w) or less, about 0.001‰ (w / w) or less or less). For example, the position where the nucleic acid sequence is knocked in may not be at the gene position where it is desired to be knocked out.

[0360] On the other hand, the present application provides a one-step electroporation method, which comprises: electroporating immune cells (e.g., T cells) with a plasmid containing nucleic acid sequences encoding CAR, IL-15 or a functionally active fragment thereof, and IL-21 or a functionally active fragment thereof in order from 5' to 3', so that the immune cells contain and / or express the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof (e.g., the coding sequences of the CAR, the IL-15 or a functionally active fragment thereof, and the IL-21 or a functionally active fragment thereof are knocked into the genome of the immune cells, and one or more endogenous genes in the genome of the immune cells are knocked out), the plasmid is extracted from the host cell, and the content of the genomic DNA of the host cell contained in the plasmid accounts for about 1% of the plasmid DNA content. 0% (w / w) or less (e.g., about 9% (w / w) or less, about 8% (w / w) or less, about 7% (w / w) or less, about 6% (w / w) or less, about 5% (w / w) or less, about 4% (w / w) or less, about 3% (w / w) or less, about 2% (w / w) or less, about 1.5% (w / w) or less, about 1% (w / w) or less, about 9‰ (w / w) or less, about 8‰ (w / w) or less, about 7‰ (w / w) or less, about 6‰ (w / w) or less, about 5‰ (w / w) or less, about 4‰ (w / w) or less, about 3‰ (w / w) or less, about 2‰ (w / w) or less, about 1.5‰ (w / w) or less, about 1‰ (w / w) or less, about 0.5‰ (w / w) or less, about 0.1‰ (w / w) or less, about 0.01‰ (w / w) or less, about 0.001‰ (w / w) or less or less). For example, the position where the nucleic acid sequence is knocked in may not be at the gene position where it is desired to be knocked out.

[0361] In some cases, the plasmid may further comprise a nucleic acid sequence encoding one or more other proteins (as described in other aspects of this application), for example, the one or more other proteins may include a multispecific antibody or antigen-binding fragment thereof (e.g., BiTE).

[0362] In certain embodiments, the electroporation method of the present application is a one-step electroporation method, i.e., it completes the knock-in and / or knock-out of the exogenous gene in a single electroporation transfection step. For example, the position where the nucleic acid sequence is knocked in may not be at the gene position where it is desired to be knocked out.

[0363] Host genomic DNA

[0364] The host cell of the present application can be a prokaryotic cell or a eukaryotic cell, which includes any transformable organism capable of replicating a vector or expressing a heterologous gene encoded by a vector. In the present application, the host cell is not an immune cell or does not contain an immune cell.

[0365] For example, the host can be a microbial host. For example, the host can be selected from one or more of the following groups: bacteria, fungi, actinomycetes, mycoplasmas, chlamydiae, rickettsiae and spirochetes. For example, the host can include gram-negative bacteria. For example, the host can include Escherichia coli (e.g., competent E. coli cells).

[0366] In the present application, the genomic DNA of the host cell may not be contained in the isolated nucleic acid molecule.

[0367] In the present application, the genomic DNA content of the host cell can be determined by qPCR.

[0368] In the present application, the size of the genomic DNA of the host cell can be at least about 50 kb, at least about 100 kb, at least about 150 kb, at least about 200 kb, at least about 250 kb, at least about 300 kb, at least about 350 kb, at least about 400 kb, at least about 450 kb, at least about 500 kb, at least about 600 kb, at least about 700 kb, at least about 800 kb, at least about 900 kb, at least about 1 Mb, at least about 2 Mb, at least about 3 Mb, at least about 4 Mb, at least about 5 Mb, at least about 6 Mb, at least about 7 Mb, at least about 8 Mb, at least about 9 Mb, at least about 10 Mb, at least about 20 Mb, at least about 50 Mb, at least about 100 Mb, at least about 200 Mb or larger. For example, the size of the genomic DNA of the host cell can be at least about 10 kb. In the present application, the size of the genomic DNA derived from the host (e.g., a microorganism) can be at least about 10 kb in size (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, at least about 50 kb, at least about 100 kb, at least about 150 kb, at least about 200 kb, at least about 250 kb, at least about 300 kb, at least about 350 kb, at least about 400 kb, at least about 500 kb, at least about 600 kb, at least about 700 kb, at least about 800 kb, at least about 900 kb, at least about 10 ...1500 kb, at least about 1600 kb, at least about 1700 kb, at least about 1800 kb, at least about 1900 kb, at least about 2000 kb, at least about 2500 kb, at least about 2 kb, at least about 450 kb, at least about 500 kb, at least about 600 kb, at least about 700 kb, at least about 800 kb, at least about 900 kb, at least about 1 Mb, at least about 2 Mb, at least about 3 Mb, at least about 4 Mb, at least about 5 Mb, at least about 6 Mb, at least about 7 Mb, at least about 8 Mb, at least about 9 Mb, at least about 10 Mb, at least about 20 Mb, at least about 50 Mb, at least about 100 Mb, at least about 200 Mb or greater).

[0369] In the present application, the genomic DNA of the host cell may be derived from a microorganism. For example, the microorganism may be selected from one or more of the following groups: bacteria, fungi, actinomycetes, mycoplasmas, chlamydia, rickettsiae and spirochetes.

[0370] In the present application, the microorganism may include Gram-negative bacteria. For example, the microorganism may be a microorganism suitable for preparing a backbone carrier of a carrier. For example, the microorganism may include Escherichia coli.

[0371] In the present application, the content of the host cell genomic DNA of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or larger) in size can account for about 10 (w / w)% or less, about 9 (w / w)% or less, about 8 (w / w)% or less, about 7 (w / w)% or less, about 6 (w / w)% or less, about 5 (w / w)% or less, about 4 (w / w)% or less, about 3 (w / w)% or less, about 2. 5 (w / w)% or less, about 2 (w / w)% or less, about 1.5 (w / w)% or less, about 1 (w / w)% or less, about 9 (w / w)‰ or less, about 8 (w / w)‰ or less, about 7 (w / w)‰ or less, about 6 (w / w)‰ or less, about 5 (w / w)‰ or less, about 4 (w / w)‰ or less, about 3 (w / w)‰ or less, about 2 (w / w)‰ or less, about 1 (w / w)‰ or less, about 0.5‰ (w / w) or less, about 0.3‰ (w / w) or less, about 0.1 (w / w)‰ or less, about 0.01 (w / w)‰ or less, about 0.001 (w / w)‰ or less or less. For example, the host cell genomic DNA of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or greater) in size can comprise less than about 2% of the plasmid content in the transfection composition; can comprise less than about 5‰ of the plasmid content of the transfection composition; or can comprise less than about 1‰ of the plasmid content of the transfection composition.

[0372] Transfection

[0373] Transfection is a method for intentionally introducing nucleic acids into cells. In certain embodiments, transfection is non-viral, meaning that the sequences used in the plasmid context are non-viral and the isolated nucleic acid molecules do not enter the cell via viral mechanisms. Transfection of animal cells typically involves opening transient holes or "pores" in the cell membrane to allow uptake of the material. Transfection can be performed using methods known in the art and described below.

[0374] In the present application, the transfection may include electroporation. For example, the transfection may include electroporating the cells to be modified. The electroporation may refer to cell electrotransfection or cell electroporation. The electroporation may utilize the effect of a powerful instantaneous battery to allow charged substances to enter cells through a cell membrane with a certain permeability. The electroporation may produce very little cytotoxicity. Compared to chemical transfection methods and / or viral transfection methods, the cytotoxicity produced by the electroporation is significantly reduced. The electroporation may be applied to almost all types of eukaryotic cells. The electroporation may be used to transiently or stably express exogenous proteins.

[0375] In the present application, the transfection may include transfection of a transposon system (eg, Sleeping beauty transposon system, or PiggyBac (PB) transposon system).

[0376] In the present application, the transfection may include transfected cells (e.g., cells to be transfected or modified as described herein). In the present application, the cells may include eukaryotic cells. The eukaryotic cells may be animal cells. Wherein, the animal cells may include mammalian cells (e.g., human cells, such as immune cells, such as T cells, such as human PBMCs).

[0377] In the present application, other transfection methods known in the art, such as chemical-based transfection methods and non-chemical-based transfection methods, may also be included. Chemical-based transfection methods may include methods such as calcium phosphate, dendrimers, lipofection, and cationic polymers (such as DEAE-dextrose or polyethyleneimine). Non-chemical methods may include cell squeezing, ultrasonic perforation, optical transfection, impalefection, and hydrodynamic delivery. Particle-based methods, such as transfection methods using gene guns, magnetic transfection (i.e., magnetic-assisted transfection), and particle bombardment, are also included.

[0378] In some embodiments, electroporation is used to help one or more isolated nucleic acid molecules enter the host cell. In this application, "electroporation" or "electric loading (electroloading)" generally refers to applying an electric current or electric field to the cell to help the isolated nucleic acid molecules enter the cell. For example, a flow electroporation instrument can be used to perform flow electroporation. In some embodiments, the method of electrostatic poration can be adopted.

[0379] In the method of the present application, after electroporation transfection cells can reach a transfection efficiency greater than about 35%, greater than about 40%, greater than about 50%, greater than about 60%, greater than about 70%, greater than about 80% or greater than about 90% (or any range that can be derived therefrom). Transfection efficiency can be measured by the percentage of cells expressing the gene product or by the secretion level of the product expressed by the gene. During and after the electroporation process, the cells maintain a high viability. Viability is generally greater than about 40% or higher. The viability of the electroporated cells can be at least about 20% of the viability of the initial non-electroporated cell population or the electroporated cell population transfected with a control construct, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or higher.

[0380] Cell squeezing is a transfection method that delivers molecules into cells by gently squeezing the cell membrane. It is a high-throughput, carrier-free microfluidic platform for intracellular delivery. Cell squeezing does not rely on exogenous materials or electric fields.

[0381] Ultrasound poration uses high-intensity ultrasound to induce pore formation in cell membranes. This pore formation is primarily attributed to the interaction of bubble cavitation with nearby cell membranes and is enhanced by the addition of ultrasound contrast agents, a source of pore nuclei.

[0382] Optical transfection is a method that uses a highly focused laser to transiently create tiny (approximately 1 μm diameter) pores in the plasma membrane of cells. In this technique, cells are processed one at a time, making it particularly suitable for single cell analysis.

[0383] Chemical-based transfection can be divided into several categories: cyclodextrins, polymers, liposomes, or nanoparticles (with or without chemical or viral processes). For example, in the calcium phosphate method, a HEPES-buffered saline solution (HeBS) containing phosphate ions is combined with a calcium chloride solution containing the DNA to be transfected. When the two are combined, a fine precipitate of positively charged calcium and negatively charged phosphate forms, on the surface of which the DNA to be transfected is bound. This suspension of precipitate is then added to the cells to be transfected (usually a monolayer culture). The cells will take up some of the precipitate and the DNA along with it. Other methods use highly branched organic compounds (so-called dendrimers) to bind to the DNA and allow it to enter the cell. One very effective method is to encapsulate the DNA to be transfected in liposomes, small membrane-encapsulated bodies that resemble the structure of cells in some ways and can actually fuse with the cell membrane, releasing the DNA into the cell. For eukaryotic cells, transfection is better achieved using cationic liposomes (or mixtures) because the cells are more sensitive. Another approach is to use cationic polymers such as DEAE-dextrose or polyethyleneimine. Negatively charged DNA binds to the polycation, and the complex is taken up by the cell via endocytosis.

[0384] In certain embodiments, a direct transfection method uses a gene gun, in which the DNA is coupled to nanoparticles of an inert solid (usually gold) and then "fired" directly into the nucleus of the target cell.

[0385] Magnetofection, or magnetic-assisted transfection, is a transfection method that uses magnetic forces to deliver DNA into target cells. First, nucleic acids are bound to magnetic nanoparticles. Then, magnetic forces are applied to deliver the nucleic acid-particle complex toward and into the target cells, where the payload is released.

[0386] Piercing transfection is performed by impaling cells with elongated nanostructures and arrays of such nanostructures, such as carbon nanofibers or silicon nanowires that have been functionalized with plasmid DNA.

[0387] Another particle-based transfection method is called particle bombardment. It delivers nucleic acids, often linked to microprojectiles, at high speed through membranes.

[0388] In the present application, the transfection can include stable transfection. For example, the transfection can cause the transfected cell to stably express an exogenous protein encoded by an exogenous gene (e.g., an isolated nucleic acid molecule of the present application). For example, the transfection can cause the exogenous gene to be integrated into the genome of the transfected cell (e.g., an immune cell, such as a T cell). In the present application, the integration can occur at a specific location in the genome.

[0389] Cells to be transfected or modified

[0390] In this application, the terms "cell," "cell line," and "cell culture" are used interchangeably. All of these terms also include freshly isolated cells, as well as cells that have been cultured, activated, or expanded in vitro. All of these terms also include progeny, i.e., any and all descendants. It should be understood that each progeny cell may not be identical due to intentional or unintentional mutations.

[0391] In the present application, the cell to be modified or transfected can be a eukaryotic cell, such as an animal cell. For example, the cell can be a mammalian cell. For example, the cell can be a human cell.

[0392] In the present invention, the cells may be immune effector cells. For example, the cells may be T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes and / or mast cells. For example, the cells may be peripheral blood lymphocytes.

[0393] For example, the cells can be primary cells. For example, the cells can include allogeneic cells and / or autologous cells derived from the subject. For example, in some cases, the cells are autologous cells derived from the subject. For example, in some cases, the cells are allogeneic cells derived from another donor.

[0394] For example, the cell may be an activated cell.For example, the activation may comprise contacting the cell to be modified with an activation composition.

[0395] For example, the cells may comprise immune cells (e.g., immune effector cells, such as T cells or NK cells, such as PBMCs, such as primary or autologous T cells or NK cells, such as primary or autologous PBMCs), and the activating composition may comprise anti-CD3 and / or anti-CD28 antibodies (e.g., the antibodies may be provided on magnetic beads).

[0396] Reagents or kits for activating T cells are also commercially available. Exemplary kits include anti-biotin particles (e.g., MACSiBead or Dynabead) and biotinylated antibodies against human CD2, CD3, and CD28. Anti-biotin particles loaded with biotinylated antibodies are used to simulate antigen presenting cells and activate resting T cells and purified T cells from PBMC. T cell expansion is achieved by culturing and activating again on the 14th day of cultivation. For example, T cells can also be activated by mitogens (e.g., ConA, PHA, and PWM).

[0397] For example, the activation can include contacting the cell to be modified with the activation composition for no more than about 4 days (e.g., within about 96 hours, within about 90 hours, within about 85 hours, within about 80 hours, within about 75 hours, within about 72 hours, within about 70 hours, within about 65 hours, within about 60 hours, within about 55 hours, within about 50 hours, within about 48 hours, within about 45 hours, within about 40 hours, within about 36 hours, within about 30 hours, within about 24 hours, within about 20 hours, within about 15 hours, within about 12 hours, within about 8 hours or less). For example, the activation can include contacting the cell to be modified with the activation composition for about 10 hours to about 48 hours (e.g., about 12 hours to about 24 hours). For example, the method includes performing the transfection while contacting the cell to be transfected with the activation composition for a period of about 2 days or less.

[0398] In certain embodiments, transfection can be performed on any prokaryotic or eukaryotic cell. In some aspects, electroporation involves transfecting human cells. In other aspects, electroporation involves transfecting animal cells. In some aspects, transfection involves transfecting cell lines or hybrid cell types. In some aspects, the cells to be transfected are cancer cells, tumor cells, or immortalized cells. In some cases, the tumor, cancer, immortalized cell, or cell line is induced, while in other cases, the tumor, cancer, immortalized cell, or cell line naturally enters its respective state or condition. In certain aspects, the cell or cell line can be A549, B cells, B16, BHK-21, C2C12, C6, CaCo-2, CAP / , CAP-T, CHO, CHO2, CHO-DG44, CHO-K1, COS-1, Cos-7, CV-1, dendritic cells, DLD-1, embryonic stem (ES) cells or derivatives, H1299, HEK, 293, 293T, 293FT, Hep G2, hematopoietic stem cells, HOS, Huh-7, induced pluripotent stem cells (iPSC) or derivatives thereof, Jurkat, K562, L5278Y, LNCaP, MCF7, MDA-MB-231, MDCK, mesenchymal cells, Min-6, monocytes, Neuro2a, NIH 3T3, NIH3T3L1, K562, NK-cells, NS0, Panc-1, PC12, PC-3, peripheral blood cells, plasma cells, primary fibroblasts, RBL, Renca, RLE, SF21, SF9, SH-SY5Y, SK-MES-1, SK-N-SH, SL3, SW403, Stimulus-triggered Acquisition of Pluripotency (STAP) cells or their derivatives SW403, T-cells, THP-1, tumor cells, U2OS, U937, peripheral blood lymphocytes, amplified T cells, hematopoietic stem cells or Vero cells. In some embodiments, the cell is a peripheral blood lymphocyte, amplified T cells, natural killer cells (NK cells), stem cells, hematopoietic stem cells or primary cells. In certain embodiments, the cell is a hematopoietic stem cell. In other specific embodiments, the cells are peripheral blood lymphocytes and / or peripheral blood mononuclear cells (PBMCs).

[0399] In certain embodiments, the cell is a cell known in the art to be difficult to transfect. Such cells are known in the art and include, for example, primary cells, insect cells, SF9 cells, Jurkat cells, CHO cells, stem cells, slowly dividing cells, T cells, and non-dividing cells. In some embodiments, the cell is a T cell. In some embodiments, the cell is a primary cell. In some embodiments, the cell is a stem cell. In some embodiments, the cell is a hematopoietic stem cell, including bone marrow and lymphoid progenitor cells. In some embodiments, the cell is a mesenchymal stem cell. In some embodiments, the cell is a germ cell, such as an egg cell or a sperm cell.

[0400] In some embodiments, cells can be cultured before or after transfection. For example, cells can be cultured during the selection phase after transfection, during the maintenance and clonal selection and initial expansion phases, during the screening phase, and / or during the large-scale production phase. Methods for culturing suspension and adherent cells are known to those skilled in the art. In some embodiments, cells can be cultured using commercially available cell culture vessels and cell culture media.

[0401] In the present application, the stem cells may include hematopoietic stem cells and / or mesenchymal stem cells. The hematopoietic stem cells may differentiate into blood cells (e.g., blood cells of the myeloid lineage and blood cells of the lymphoid lineage). The hematopoietic stem cells may have multipotency and self-renewal characteristics. The hematopoietic stem cells may differentiate into cells selected from the group consisting of monocytes, macrophages, neutrophils, basophils, eosinophils, red blood cells, megakaryocytes, platelets, T cells, B cells, and NK cells.

[0402] The mesenchymal stem cells can be adult stem cells derived from the early mesoderm of embryonic development, which have the potential for self-renewal and multidirectional differentiation and can maintain their biological characteristics after in vitro large-scale expansion. The mesenchymal stem cells can express HLA-I class antigens. The mesenchymal stem cells can not express or lowly express HLA-II class antigens. The mesenchymal stem cells can have the ability to differentiate into adipocytes, osteoblasts, and chondrocytes; they can also support the differentiation of hematopoietic stem cells into granulocytes, macrophages, and megakaryocytes. The mesenchymal stem cells can secrete cytokines, for example, CSF-1, GM-CSF, G-CSF, IL-6, c-kitligand and / or IL-3.

[0403] In the present application, the immune cell may include an immune effector cell. For example, the immune effector cell may include a lymphocyte (e.g., a cytotoxic T cell, a memory T cell), a macrophage, a dendritic cell, and a NK cell. For example, the immune cell may be selected from the group consisting of a T lymphocyte (e.g., an activated T lymphocyte or an unactivated T lymphocyte), a B lymphocyte, a NK cell, a macrophage, a dendritic cell, a monocyte, a granulocyte, and a mast cell.

[0404] Transfection composition

[0405] In the present application, the transfection composition can include the isolated nucleic acid molecule (e.g., plasmid). For example, the plasmid can be a circular plasmid, a supercoiled plasmid or a linear plasmid. In the present application, the plasmid (e.g., linear plasmid) can be treated with (e.g., deoxyribonuclease, e.g., exonuclease, e.g., exonuclease V) to make the content of the host genomic DNA of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or larger) size described in the present application meet the conditions described in the present application. In the present application, the treatment can not affect the structure or function of the isolated nucleic acid molecule of the present application with a circular structure.

[0406] For example, the transfection compositions described herein may be substantially or even completely free of any viral vectors, e.g., wherein the content of viral vectors is less than about 2 (w / w)%, less than about 1 (w / w)%, less than about 0.9 (w / w)%, less than about 0.8 (w / w)%, less than about 0.7 (w / w)%, less than about 0.6 (w / w)%, less than about 0.5 (w / w)%, less than about 0.4 (w / w)%, less than about 0.3 (w / w)%, less than about 0.2 (w / w)%, less than about 0.1 (w / w)% or less.

[0407] In the present application, the plasmid can be a DNA plasmid. For example, the DNA plasmid can be a double-stranded, closed-circular DNA molecule. For example, the DNA plasmid can be a double-stranded, linear DNA molecule.

[0408] In the present application, the genomic DNA of the host (e.g., at least about 10 kb in size, for example, at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb, at least about 50 kb, at least about 100 kb, at least about 150 kb, at least about 200 kb, at least about 250 kb, at least about 300 kb, at least about 350 kb, at least about 400 kb, at least about 450 kb, at least about The host's genomic DNA can be present in a different nucleic acid molecule than the plasmid (e.g., at least about 500 kb, at least about 600 kb, at least about 700 kb, at least about 800 kb, at least about 900 kb, at least about 1 Mb, at least about 2 Mb, at least about 3 Mb, at least about 4 Mb, at least about 5 Mb, at least about 6 Mb, at least about 7 Mb, at least about 8 Mb, at least about 9 Mb, at least about 10 Mb, at least about 20 Mb, at least about 50 Mb, at least about 100 Mb, at least about 200 Mb or larger). For example, the host's genomic DNA can be free in the transfection composition. For example, the host's genomic DNA can be free from the plasmid. The free can be separate, not attached to the plasmid.

[0409] In the present application, the concentration of the isolated nucleic acid molecule (e.g., the plasmid) in the transfection composition can be about 5 μg / mL to about 3000 μg / mL (e.g., about 5 μg / mL to about 2500 μg / mL, about 10 μg / mL to about 2000 μg / mL, about 10 μg / mL to about 1500 μg / mL, about 5 μg / mL to about 1000 μg / mL, about 10 μg / mL to about 1200 μg / mL, about 8 μg / mL to about 1000 μg / mL, about 10 μg / mL to about 1200 μg / mL, about 8 μg / mL to about 1000 μg / mL, about 10 μg / mL to about 15 ... about 1000 μg / mL, about 15 μg / mL to about 950 μg / mL, about 20 μg / mL to about 900 μg / mL, about 30 μg / mL to about 900 μg / mL, about 40 μg / mL to about 950 μg / mL, about 50 μg / mL to about 950 μg / mL, about 60 μg / mL to about 950 μg / mL, about 70 μg / mL to about 950 μg / mL, about 80 μg / mL to about 950 μg / mL, about 90 μg / mL to about 950 μg / mL, about 100 μg / mL to about 950 μg / mL, about 110 μg / mL to about 950 μg / mL, about 120 μg / mL to about 950 μg / mL, about 130 μg / mL to about 950 μg / mL, about 140 μg / mL to about 950 μg / mL, about 150 μg / mL to about 950 μg / mL, about 180 μg / mL to about 950 μg / mL, about 200 μg / mL to about 950 In some embodiments, the concentration of the isolated nucleic acid molecule (e.g., the plasmid) in the transfection composition is from about 200 μg / mL to about 800 μg / mL.

[0410] On the other hand, the present application provides a transfection composition prepared using the method described in the present application.

[0411] In the present application, the transfection composition can significantly improve transfection efficiency, particularly significantly improve the transfection efficiency of the nucleic acid molecules of the present invention in immune cells. The transfection composition can significantly reduce the cytotoxicity caused by transfection. The transfection composition can be directly applied to cell transfection. The method described in this application can be used as a quality control method for preparing and / or testing the transfection composition.

[0412] Nucleic acid molecule optimization

[0413] For example, the method may further comprise treating the isolated nucleic acid molecule (eg, plasmid) derived from the host cell such that the content of genomic DNA in the host cell is reduced.

[0414] For example, the treatment comprises contacting the isolated nucleic acid molecule (e.g., plasmid) derived from the host cell with one or more reagents selected from the group consisting of deoxyribonuclease (DNase), SDS, TX-100, CTAB, and cesium chloride-ethidium bromide. For example, the DNase is capable of non-specifically cleaving linear DNA. For example, the DNase comprises an exonuclease. For example, the treatment comprises contacting the isolated nucleic acid molecule (e.g., plasmid) ... MgCl2. 2+ and Ca 2+ The isolated nucleic acid molecule (eg, plasmid) derived from a host cell is contacted with the agent in the presence of.

[0415] The method of the present application may include the following steps: reducing the content of host genomic DNA in the transfection composition. In the present application, the reduction may refer to reducing the content of the host genomic DNA in the transfection composition to a level that meets the requirements of the method of the present application.

[0416] In the present application, the reduction can include purifying the isolated nucleic acid molecule. That is, the purification can be used to reduce the content of genomic DNA derived from the host cell in the isolated nucleic acid molecule (e.g., plasmid) to a level that meets the requirements of the method described in the present application. In the present application, the purification can be used to remove the host genomic DNA of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or larger); and / or, remove the genomic DNA derived from the host (e.g., microorganism). For example, the purification can include reducing the content of host cell genomic DNA in the isolated nucleic acid molecule (e.g., plasmid) using methods for purifying DNA well known to those skilled in the art. In the present application, the purification can not affect the integrity and / or activity of the DNA of the isolated nucleic acid molecule (e.g., plasmid). In the present application, the reduction can include purifying the isolated nucleic acid molecule (e.g., plasmid) using a reagent selected from the group consisting of DNA enzyme, SDS, TX-100, CTAB, and cesium chloride-ethidium bromide. For example, the reduction can use DNA enzyme. For example, the DNA enzyme can not affect the integrity and / or activity of the circular plasmid DNA.

[0417] In the present application, the DNase can cut double-stranded DNA. For example, the DNase can non-specifically cut linear DNA.

[0418] In the present application, the DNase may (e.g., non-specifically) cut linear (e.g., double-stranded linear) DNA. For example, the DNase may not affect the structure and / or activity of the plasmid (e.g., circular plasmid). In the present application, the DNase may include deoxyribonuclease. In the present application, the DNase may include DNA exonuclease. In the present application, the DNase may include exonuclease V. In the present application, the DNase may include ATP-Dependent DNase, for example, Plasmid-Safe TM ATP-Dependent DNase.

[0419] For example, the method described in the present application may include the following steps: contacting the DNase with the plasmid described in the present application (or isolated nucleic acid molecule). In the present application, the contacting may include contacting in the presence of a buffer (for example, the buffer may be a buffer in a kit sold as a set of the DNase). In the present application, the buffer may include MgCl2. 2+ and Ca 2+ For example, the buffer may contain Mg 2+ and Ca 2+ The buffer solution no longer contains any other cations. The buffer solution can improve the DNase cleavage efficiency.

[0420] In the method of the present application, the DNase treatment may include the following step: purifying the contacted plasmid or isolated nucleic acid molecule.

[0421] After the DNase treatment, the content of host genomic DNA of at least about 10 kb (e.g., at least about 15 kb, at least about 20 kb, at least about 30 kb, at least about 35 kb, at least about 40 kb, at least about 48 kb or larger) in the isolated nucleic acid molecule (or vector, such as a plasmid) can be reduced to less than about 10% of the total content of the isolated nucleic acid molecule (or vector, such as a plasmid).

[0422] In the present application, the contacting may further include contacting with RNase.

[0423] In the present application, a nuclease or DNase is an enzyme that hydrolyzes nucleic acids. For example, the DNase can be an exonuclease. An exonuclease is any group of enzymes that catalyzes the hydrolysis of a single nucleotide from the end of a DNA or RNA chain. Nucleases can also be classified according to whether they specifically digest DNA or RNA. Nucleases that specifically catalyze the hydrolysis of DNA can be referred to as deoxyribonucleases or DNA enzymes, while nucleases that specifically catalyze the hydrolysis of RNA can be referred to as ribonucleases or RNA enzymes. Some nucleases are specific for single-stranded or double-stranded nucleic acid sequences. Some enzymes have both exonuclease and endonuclease properties. In addition, some enzymes are capable of digesting both DNA and RNA sequences.

[0424] Optimal reaction conditions vary among different nucleases. Factors to consider include temperature, pH, enzyme cofactors, salt composition, ionic strength, and stabilizers. Suppliers of commercially available nucleases (e.g., Promega Corp.; New England Biolabs, Inc.) provide information on the optimal conditions for various enzymes. Most nucleases are used between pH 7.2 and pH 8.5, as measured at the incubation temperature. In addition, most nucleases show maximum activity at 37°C; however, a few enzymes require higher or lower temperatures for optimal activity (e.g., Taq I, 65°C; Sma I, 25°C). DNA concentration can also be a factor, as high DNA concentrations can reduce enzyme activity, while too dilute DNA concentrations can be below the Km of the enzyme and also affect enzyme activity. Non-limiting examples of nucleases include DNAse I, Benzonase, Exonuclease I, Exonuclease III, Mung Bean Nuclease, Nuclease BAL 31, RNAse I, S1 Nuclease, Lambda Exonuclease, RecJ and T7 Exonuclease. DNAse I is an endonuclease that non-specifically cuts DNA to release dinucleotides, trinucleotides and oligonucleotide products with 5'-phosphorylated and 3'-hydroxylated ends. DNAse I acts on single-stranded and double-stranded DNA, chromatin and RNA:DNA hybrids. Exonuclease I catalyzes the removal of nucleotides from single-stranded DNA in the 3' to 5' direction. Exonuclease III catalyzes the stepwise removal of mononucleotides from the 3'-hydroxyl end of duplex DNA. Exonuclease III also acts on the nicks of duplex DNA to produce single-stranded gaps. Single-stranded DNA is resistant to exonuclease III. Mung Bean Nuclease degrades single-stranded extensions from the ends of DNA. Mung bean nucleases are also RNA endonucleases. Nuclease BAL 31 degrades both the 3' and 5' ends of duplex DNA. Nuclease BAL 31 is also a highly specific single-stranded endonuclease that cuts at nicks, gaps, and single-stranded regions of duplex DNA and RNA. RNase I is a single-stranded specific RNA endonuclease that cuts at all RNA dinucleotides. S1 nuclease degrades single-stranded DNA and RNA by endonucleolysis to produce 5'-phosphoryl-terminated products. Double-stranded nucleic acids (DNA:DNA, DNA:RNA, or RNA:RNA) are resistant to degradation by S1 nucleases except at extremely high concentrations of the enzyme. Lambda exonuclease catalyzes the removal of 5' single nucleotides from duplex DNA. Its preferred substrate is 5'-phosphorylated duplex DNA, although lambda exonuclease also degrades single-stranded and non-phosphorylated substrates at a greatly reduced rate. While lambda exonuclease cannot initiate DNA digestion at the site of incision or nicking, RecJ is a single-stranded DNA-specific exonuclease that catalyzes the removal of deoxynucleotide monophosphates from DNA in the 5' to 3' direction.T7 exonuclease catalyzes the removal of single nucleotides from double-stranded DNA at the 5' end or at nicks and gaps in double-stranded DNA.

[0425] Gene editing system

[0426] In the present application, the transfection composition may further include a gene editing system that enables the isolated nucleic acid molecule to be integrated into a specific location of the genome of the cell (e.g., an immune cell, such as a T cell). For example, the gene editing system may include a site-specific enzyme (or referred to as a positioning nuclease) or an isolated nucleic acid molecule encoding it (e.g., a DNA molecule or an RNA molecule, such as an mRNA encoding the enzyme). For example, the site-specific enzyme may be selected from: transcription activator-like effector nuclease (TALEN), zinc finger nuclease (ZFN), transposase, integrase, and Cas protein. For example, the Cas protein is a Cas9 protein. For example, the gene editing system may further include one or more guide RNAs. For example, the guide RNA is complementary to a nucleic acid sequence in a target region of the cell genome.

[0427] For example, the gene editing system can further comprise one or more guide RNAs that target one or more genes to be knocked out.

[0428] In the methods and compositions of the present application, the site-specific enzyme can be provided in the form of a protein or a nucleic acid molecule (e.g., a DNA molecule or an RNA molecule). The site-specific enzyme and the guide RNA can be provided simultaneously (e.g., in the same molecule, the same complex, or the same composition) or separately (e.g., in different molecules or different compositions).

[0429] For example, the gene editing system may comprise a ribonucleoprotein complex RNP, and the RNP comprises the Cas protein and the guide RNA.

[0430] For example, the gene editing system and method can be known to those skilled in the art, as long as the purpose of gene editing can be achieved, and is not limited to a specific method. In the present application, the gene editing method can be selected from one or more of the following groups: CRISPR / Cas system, RNA editing system ADAR, RNA-guided nuclease, zinc finger protease, Mega-TAL nuclease, TALENs and Meganucleases. For example, the gene editing method can be using the CRISPR / Cas system.

[0431] In the present application, the gene editing may include gene editing knockout and / or gene editing knock-in. For example, the gene editing may include gene editing knock-in. For example, the gene editing knock-in may be performed using the CRISPR / Cas system.

[0432] For example, the CRISPR / Cas system can include a class of clustered regularly interspaced short palindromic repeats (CRISPRs) and some functionally related proteins (CRISPR-associated, Cas). The Cas protein encoding genes may include Cas9, Cas1, Cas2 and Csn2. For example, the Cas protein may be Cas9. The CRISPR / Cas system (e.g., CRISPR / Cas9 system) can have targeted cutting specificity for DNA molecules.

[0433] For example, the gene editing knock-in can be a process in which the Cas protein is targeted to a specific DNA sequence in the cell to insert the DNA sequence. The gene editing knock-in can be a process in which the exogenous gene to be knocked in the donor plasmid is homologously recombined with the specific DNA sequence in the cell to which it is targeted, mediated by a Cas protein (e.g., a Cas 9 protein).

[0434] In the present application, the isolated nucleic acid molecule (e.g., plasmid) can be used as a donor plasmid in the gene editing knock-in. For example, the donor plasmid can be double-stranded DNA or single-stranded DNA. The donor plasmid can serve as a donor template for the HDR repair mechanism.

[0435] The site-specific enzyme of the present application can cut the bond (i.e., phosphodiester bond) between specific nucleotide subunits in the nucleic acid sequence. In one embodiment, the site-specific enzyme is encoded on RNA. In other embodiments, the site-specific enzyme is a protein, enzyme or small molecule mimic with enzymatic activity. In some embodiments, the site-specific enzyme is encoded on DNA. In one embodiment, the site-specific enzyme is encoded on plasmid DNA. In some embodiments, the site-specific enzyme and donor DNA are encoded on the same plasmid.

[0436] In one embodiment, the site-specific enzyme is a transposase. The transposase may be a Sleeping Beauty transposase. In some cases, the transposase may be a PiggyBac (PB) transposase.

[0437] For example, a synthetic DNA transposon (e.g., the "Sleeping Beauty" transposon system) designed to introduce a precisely defined DNA sequence into a vertebrate chromosome can be used. The Sleeping Beauty transposon system consists of the Sleeping Beauty (SB) transposase and a transposon designed to insert a specific DNA sequence into the genome of a vertebrate. DNA transposons translocate from one DNA site to another in a simple cut-and-paste manner. Transposition is a precise process in which a defined DNA fragment is excised from one DNA molecule and moved to another site in the same or different DNA molecule or genome. The SB transposase inserts the transposon into the TA dinucleotide base pair of the recipient DNA sequence. The insertion site can be other locations on the same DNA molecule or in another DNA molecule (or chromosome). There are approximately 200 million TA sites in the mammalian (including human) genome. The TA insertion site replicates during the transposon integration process. The replication of the TA sequence is a hallmark of transposition and is used in some experiments to determine the mechanism. The transposase can be encoded within the transposon, or it can be provided by another source, in which case the transposon becomes a non-autonomous element. Non-autonomous transposons are the most useful genetic tools because they are unable to independently continue to excise and reinsert after insertion. All DNA transposons identified in the human genome and other mammalian genomes are non-autonomous because, although they contain transposase genes, these genes are non-functional and cannot produce the transposase that can move the transposon.

[0438] In the present application, the transposon system may include a transposon. The transposon may include an isolated nucleic acid molecule that can be incorporated into a nucleic acid by a transposase. The transposon may include two transposon ends (also referred to as "arms") connected by a sequence that is long enough to form a loop in the presence of a transposase. The transposon may be double-stranded, single-stranded, or mixed, containing single-stranded and double-stranded regions, depending on the transposase used to insert the transposon. The transposase may include Mu, Tn3, Tn5, Tn7, and / or Tn10. The ends of the transposon may be double-stranded. In the present application, the transposon may be inserted into double-stranded DNA through a transposition event. In the present application, the transposon may be considered as the exogenous gene. The plasmid may include the transposon. The plasmid may also include the isolated nucleic acid molecule required for the transposition event. For example, the transposon system may include the Sleeping Beauty transposon system. The Sleeping Beauty transposon system is a member of the Tc1 / mariner transposon superfamily. For example, the transposon system may comprise a Piggy Bac transposon system.

[0439] In another embodiment, the site-specific enzyme is an integrase. For example, phiC31 integrase is a sequence-specific recombinase encoded in the genome of bacteriophage phiC31. The phiC31 integrase mediates recombination between two 34 base pair sequences called attachment sites (att), one obtained in the phage and the other obtained in the bacterial host. This serine integrase has been shown to work efficiently in many different cell types, including mammalian cells. In the presence of phiC31 integrase, an attB-containing donor plasmid can be unidirectionally integrated into the target genome by recombination at a site with a sequence similar to the natural attP site (called a pseudo-attP site). The phiC31 integrase can integrate plasmids of any size as a single copy and does not require cofactors. The integrated transgene is stably expressed and is heritable.

[0440] In one embodiment, the site-specific nuclease is a Cas nuclease. In a related embodiment, the Cas nuclease is Cas9. In another embodiment, the nuclease is Cas9 and the composition further comprises a guide RNA. Another example of a sequence-specific nuclease system that can be used with the methods and compositions described herein includes the Cas9 / CRISPR system (Wiedenheft, B. et al. Nature 482, 331-338 (2012); Jinek, M. et al. Science 337, 816-821 (2012); Mali, P. et al. Science 339, 823-826 (2013); Cong, L. et al. Science 339, 819-823 (2013)). The Cas9 / CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) system utilizes RNA-guided DNA binding and sequence-specific target DNA cutting. The guide RNA / Cas9 combination confers nuclease site specificity. The guide RNA (gRNA) comprises approximately 20 nucleotides complementary to a target genomic DNA sequence upstream of the genomic PAM (protospacer adjacent motif) site (NNG) and the constant RNA scaffold region. The Cas (CRISPR-associated) 9 protein binds to the gRNA and the target DNA bound to the gRNA and introduces a double-strand break in a defined position upstream of the PAM site. Cas9 has two independent nuclease domains homologous to the HNH and RuvC endonucleases, and by mutating either of the two domains, the Cas9 protein can be converted into a nickase that introduces single-strand breaks (Cong, L. et al. Science 339, 819-823 (2013)). It is particularly contemplated that the methods and compositions of the present invention can be used with single-stranded or double-stranded inducible forms of Cas9 and with other RNA-guided DNA nucleases (e.g., Cas9-like systems of other bacteria).

[0441] The site-specific nucleases of the methods and compositions described herein can be engineered, chimeric, or isolated from an organism. The sequence-specific nuclease can be introduced into a cell in the form of RNA encoding the sequence-specific nuclease (eg, mRNA).

[0442] In one embodiment, the site-specific enzyme is a site-specific nuclease, such as a zinc finger nuclease. Zinc finger nucleases generally comprise a DNA binding domain (i.e., zinc finger) and a cleavage domain (i.e., nuclease). The zinc finger binding domain can be modified to recognize and bind to any selected nucleic acid sequence. Compared to naturally occurring zinc finger proteins, the modified zinc finger binding domain can have new binding specificity. The modification method includes, but is not limited to, rational design and various types of selection. In some embodiments, the zinc finger nuclease may also comprise a nuclear localization signal or sequence (NLS). NLS is an amino acid sequence that facilitates targeting of the zinc finger nuclease protein to the nucleus to introduce double-strand breaks at the target sequence of the chromosome. Nuclear localization signals are known in the art. See, for example, Makkerh et al. (1996) Current Biology 6: 1025-1027. The zinc finger nuclease also comprises a cleavage domain. The cleavage domain portion of the zinc finger nuclease can be obtained from any endonuclease or exonuclease. Non-limiting examples of endonucleases from which a cleavage domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases.

[0443] In another embodiment, the targeting endonuclease can be a meganuclease. A meganuclease is an endodeoxyribonuclease characterized by a large recognition site, that is, a recognition site typically of about 12 base pairs to about 40 base pairs. As a result of this requirement, the recognition site typically only occurs once in any given genome. Naturally occurring meganucleases recognize 15 to 40 base pair cleavage sites and are generally divided into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cyst box family, and the HNH family. A meganuclease can be targeted to a specific chromosomal sequence by modifying its recognition sequence using techniques well known to those skilled in the art.

[0444] In another embodiment, the targeting endonuclease can be a transcription activator-like effector (TALE) nuclease. TALE is a transcription factor from the plant pathogen Xanthomonas that can be easily engineered to bind to new DNA targets. TALE or its truncated form can be linked to the catalytic domain of an endonuclease (e.g., Fok1) to produce a targeted endonuclease known as a TALE nuclease or TALEN.

[0445] In another embodiment, the nuclease can be a homing nuclease. Homing endonucleases include 1-5′cel, 1-Ceul, 1-Pspl, Vl-Sce, 1-SceTV, 1-Csml, 1-Panl, 1-Scell, 1-Ppol, 1-Scelll, 1-Crel, 1-Tevl, 1-Tev, and 1-7evIII. Their recognition sequences are known. See also U.S. Patent No. 5,420,032; U.S. Patent No. 6,833,252.

[0446] In certain embodiments, the site-specific enzyme comprises an engineered (non-naturally occurring) homing endonuclease (meganuclease). Recognition sequences for homing endonucleases and meganucleases (e.g., l-Scel, l-Ceul, VI-Pspl, Vl-Sce, l-ScelN, l-Csml, l-Panl, l-Scell, l-Ppol, l-Scelll, l-Crel, l-Tevl, l-Tevll, and I-7evIII) are known. See also U.S. Patent No. 5,420,032; U.S. Patent No. 6,833,252. In addition, the DNA binding specificity of homing endonucleases and meganucleases can be engineered to bind to non-natural target sites. See, e.g., U.S. Patent Publication No. 20070117128. The DNA binding domains of homing endonucleases and meganucleases can be altered in the context of the nuclease as a whole (ie, such that the nuclease contains a cognate cleavage domain) or can be fused to a heterologous cleavage domain.

[0447] In one embodiment, the site-specific enzyme is a site-specific nuclease selected from the group consisting of omega, zinc finger, TALE and CRISPR / Cas9.

[0448] Transfected cells or cell populations

[0449] In another aspect, the present application provides a cell (eg, immune cell) or cell population prepared by the method described herein.

[0450] In another aspect, the present application provides a modified cell (eg, an immune cell), which may comprise the isolated nucleic acid molecule described herein, or the vector described herein.

[0451] In another aspect, the present application provides a cell population, which may comprise the cells described in the present application and / or their progeny.

[0452] For example, the isolated nucleic acid molecule can be integrated into the genome of the cell (eg, immune cell).

[0453] For example, the isolated nucleic acid molecule can be integrated into a target gene in the genome of the cell (e.g., an immune cell). For example, the isolated nucleic acid molecule can be expressed under the control of an endogenous regulatory sequence of the target gene. The target gene can be selected from the group consisting of TRBC, TRAC, PD-1, AAVS1, and CCR5.

[0454] The cells may include immune cells, e.g., immune effector cells. For example, the immune cells may include T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes and / or mast cells. For example, the immune cells may include peripheral blood lymphocytes.

[0455] For example, the cells can be primary cells. For example, the cells can include allogeneic cells and / or autologous cells derived from the subject. For example, in some cases, the cells are allogeneic cells derived from another donor. For example, in some cases, the cells are autologous cells derived from the subject. For example, in some cases, the cells include autologous cells derived from the subject and allogeneic cells derived from another donor.

[0456] For example, the cell can be an activated cell. In certain embodiments, the cell comprises an immune cell (eg, a T cell), which can be activated, and the activation can comprise contacting the cell with an activating composition.

[0457] For example, the activating composition may comprise anti-CD3 and / or anti-CD28 antibodies.

[0458] In certain embodiments, the activation can include contacting the immune cells to be modified with the activation composition for no more than about 4 days.

[0459] In certain cases, the cells of the present application are isolated cells.

[0460] For example, the present application provides a cell and / or cell line prepared using the method described in the present application.

[0461] In the present application, the cells and / or cell lines can have a significantly improved transfection positive ratio (for example, they can also have a significantly improved gene editing knock-in positive ratio (for example, target cell activation can increase the positive rate of CAR, antibodies, cytokines and / or chemokines being knocked in), significantly improved DNA homologous recombination efficiency and / or significantly improved cell viability). The cell lines described in the present application can maintain the ability to significantly improve the transfection positive ratio during multiple generations of proliferation (for example, at least about 5 generations, at least about 10 generations, at least about 15 generations, at least about 20 generations or longer).

[0462] In some embodiments, the transfection positive ratio is greater than about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70%. The CAR, the IL-15 or its functionally active fragment, and the IL-21 or its functionally active fragment positive ratio can be measured by determining the number of cells with their modification and dividing by the total number of cells. The integration of exogenous genes in cell genomic DNA can be determined by methods known in the art, such as direct genomic DNA sequencing, differential restriction digestion (if gene editing is to add, remove or change restriction enzyme sites), gel electrophoresis, array capillary electrophoresis, MALDI-TOF MS, dynamic allele-specific hybridization, molecular beacons, restriction fragment length polymorphism, primer extension, temperature gradient gel electrophoresis, etc.

[0463] In certain embodiments, the cells (e.g., immune cells, such as T cells) are capable of expressing appropriate amounts of the IL-15 (or its functionally active fragment) and the IL-21 (or its functionally active fragment). For example, the expression levels of the IL-15 (or its functionally active fragment) and the IL-21 (or its functionally active fragment) are not too high to cause safety issues associated with cytokine expression. In addition, the expression levels of the IL-15 (or its functionally active fragment) and the IL-21 (or its functionally active fragment) are not too low to produce a therapeutic effect.

[0464] For example, the cells (e.g., immune cells, such as T cells) or cell populations described herein can express the IL-15 or a functionally active fragment thereof in an amount of about 4 pg / mL to about 100 pg / mL (e.g., about 5 pg / mL to about 90 pg / mL, about 5 pg / mL to about 80 pg / mL, about 5 pg / mL to about 70 pg / mL, about 5 pg / mL to about 60 pg / mL, about 5 pg / mL to about 50 pg / mL, about 6 pg / mL to about 50 pg / mL, about 7 pg / mL to about 45 pg / mL, about 8 pg / mL to about 40 pg / mL, about 9 pg / mL to about 35 pg / mL, about 10 pg / mL to about 30 pg / mL, about 15 pg / mL to about 25 pg / mL, or about 20 pg / mL to about 60 pg / mL) or more. For example, 1 x 10 6 / mL to 2x10 6The cells described herein expressed in an amount of about 4 pg / mL to about 100 pg / mL (e.g., about 5 pg / mL to about 90 pg / mL, about 5 pg / mL to about 80 pg / mL, about 5 pg / mL to about 70 pg / mL, about 5 pg / mL to about 60 pg / mL, about 5 pg / mL to about 50 pg / mL, about 6 pg / mL to about 50 pg / mL, about 7 pg / mL to about 45 pg / mL, about 8 pg / mL to about 40 pg / mL, about 9 pg / mL to about 35 pg / mL, about 10 pg / mL to about 30 pg / mL, about 15 pg / mL to about 25 pg / mL, or about 20 pg / mL to about 60 pg / mL) or more after about 2-4 days (e.g., about 3 days) of culture.

[0465] For example, the cells (e.g., immune cells, such as T cells) or cell populations described herein can be expressed at about 4 pg / mL to about 300 pg / mL (e.g., about 5 pg / mL to about 290 pg / mL, about 5 pg / mL to about 280 pg / mL, about 5 pg / mL to about 270 pg / mL, about 5 pg / mL to about 260 pg / mL, about 5 pg / mL to about 250 pg / mL, about 6 pg / mL to about 250 pg / mL, about 7 pg / mL to about 280 pg / mL, about 7 pg / mL to about 290 pg / mL, about 5 pg / mL to about 290 pg / mL, about 5 pg / mL to about 280 pg / mL, about 5 pg / mL to about 270 pg / mL, about 5 pg / mL to about 260 pg / mL, about 5 pg / mL to about 250 pg / mL, about 6 pg / mL to about 250 pg / mL, about 7 pg / mL to about 245 pg / mL, about 8 pg / mL to about 240 pg / mL, about 9 pg / mL to about 235 pg / mL, about 10 pg / mL to about 230 pg / mL, about 15 pg / mL to about 225 pg / mL, about 20 pg / mL to about 220 pg / mL, about 20 pg / mL to about 210 pg / mL, about 20 pg / mL to about 200 pg / mL, about 20 pg / mL to about 180 pg / mL. / mL, about 20 pg / mL to about 170 pg / mL, about 20 pg / mL to about 160 pg / mL, about 20 pg / mL to about 150 pg / mL, about 20 pg / mL to about 140 pg / mL, about 20 pg / mL to about 130 pg / mL, about 20 pg / mL to about 120 pg / mL, about 20 pg / mL to about 110 pg / mL, about 20 pg / mL to about 100 pg / mL, about 20 pg / mL mL to about 90 pg / mL, about 10 pg / mL to about 80 pg / mL, about 10 pg / mL to about 70 pg / mL, about 10 pg / mL to about 60 pg / mL, about 10 pg / mL to about 50 pg / mL, about 10 pg / mL to about 40 pg / mL, about 10 pg / mL to about 30 pg / mL or about 5 pg / mL to about 25 pg / mL) or more. For example, 1 x 10 6 / mL to 2x10 6 / mL of the cells described herein, after about 2-4 days (e.g., about 3 days) of culture, the expression of the peptide can be increased from about 4 pg / mL to about 300 pg / mL (e.g., about 5 pg / mL to about 290 pg / mL, about 5 pg / mL to about 280 pg / mL, about 5 pg / mL to about 270 pg / mL, about 5 pg / mL to about 260 pg / mL, about 5 pg / mL to about 250 pg / mL, about 6 pg / mL to about 250 pg / mL, about 7 pg / mL to about 245 pg / mL, about 8 pg / mL to about 240 pg / mL, about 9 pg / mL to about 235 pg / mL, about 10 pg / mL to about 230 pg / mL, about 15 pg / mL to about 225 pg / mL, about 20 pg / mL to about 220 pg / mL, about 20 pg / mL to about 210 pg / mL, about 20 pg / mL to about 200 pg / mL, about 20 pg / mL to about 180 pg / mL. g / mL, about 20 pg / mL to about 170 pg / mL, about 20 pg / mL to about 160 pg / mL, about 20 pg / mL to about 150 pg / mL, about 20 pg / mL to about 140 pg / mL, about 20 pg / mL to about 130 pg / mL, about 20 pg / mL to about 120 pg / mL, about 20 pg / mL to about 110 pg / mL, about 20 pg / mL to about 100 pg / mL, about 20 pg / mL to about 90 pg / mL, about 10 pg / mL to about 80 pg / mL, about 10 pg / mL to about 70 pg / mL, about 10 pg / mL to about 60 pg / mL, about 10 pg / mL to about 50 pg / mL, about 10 pg / mL to about 40 pg / mL, about 10 pg / mL to about 30 pg / mL or about 5 pg / mL to about 25 pg / mL) or more.

[0466] In other embodiments, the cell viability after electroporation is at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85%. Cell viability can be measured by methods known in the art. For example, cells can be counted before and after electroporation using a cell counter device. In other embodiments, apoptosis can be measured. The introduction of a large amount of nucleic acid is considered to induce apoptosis. It is considered that the methods described herein result in less apoptosis than other methods in the art. In certain embodiments, the amount of cells showing apoptosis after electroporation is less than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10% or 5%. Apoptosis refers to the specific process of programmed cell death and can be measured by methods known in the art. For example, apoptosis can be measured by Annexin V.

[0467] Therapeutic uses

[0468] In another aspect, the present application provides a pharmaceutical composition comprising the nucleic acid molecule described herein, the vector described herein, the cell described herein, and / or the cell population described herein. The pharmaceutical composition may further comprise a pharmaceutically acceptable adjuvant.

[0469] In another aspect, the present application provides the use of the nucleic acid molecules, vectors, cells, cell populations, and / or pharmaceutical compositions described herein for the preparation of a medicament. The medicament can be used to prevent, treat, and / or alleviate cancer. The cancer may comprise cancer cells positive for a tumor-associated antigen. For example, the tumor-associated antigen can be selected from the group consisting of GPC3, CD19, BCMA, Claudin18.2, and Mesothelin. For example, the tumor-associated antigen can be GPC3. The cancer can be liver cancer or hepatocellular carcinoma.

[0470] On the other hand, the present application provides a method for preventing, treating and / or alleviating a disease or condition in a subject, the method comprising administering to the subject an effective amount of the nucleic acid molecule described herein, the vector described herein, the cell described herein, the cell population described herein, and / or the pharmaceutical composition described herein.

[0471] On the other hand, the present application provides the nucleic acid molecules described herein, the vectors described herein, the cells described herein, the cell populations described herein, and / or the pharmaceutical compositions described herein, which are used to prevent, treat and / or alleviate a disease or condition in a subject.

[0472] In the present application, the disease or condition may be cancer. The cancer may comprise cancer cells positive for a tumor-associated antigen. The tumor-associated antigen may be selected from the group consisting of GPC3, CD19, BCMA, Claudin18.2, and mesothelin. For example, the tumor-associated antigen may be GPC3 or BCMA. The cancer may be liver cancer, hepatocellular carcinoma, or multiple myeloma.

[0473] In certain embodiments, the cells and cell lines produced by the methods described herein are cells and cell lines that provide a therapeutic effect after editing the genomic DNA of the cells. Primary cells can be isolated, modified, and used ex vivo to be reintroduced into the subject to be treated by the methods described herein. Suitable primary cells include peripheral blood mononuclear cells (PBMCs), peripheral blood lymphocytes (PBLs), and other blood cell subsets (such as, but not limited to, CD4 T cells).+ T cells or CD8 + T cells). Other suitable primary cells include progenitor cells, such as bone marrow or lymphoid progenitor cells. Suitable cells also include stem cells, such as, for example, embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells, neuronal stem cells, mesenchymal stem cells, muscle stem cells and skin stem cells. For example, iPSC can be obtained in vitro from a patient with a known gene mutation, and the mutation can be modified to a wild-type allele using the methods described herein. The modified iPSC can then be differentiated into dopaminergic neurons and re-implanted into the patient. In another ex vivo therapeutic application, hematopoietic stem cells can be isolated from a patient with a known gene mutation, which can then be modified to correct the gene mutation. The HSC can then be administered back to the patient for a therapeutic effect, or can be differentiated into more mature hematopoietic cells in culture before being administered to the patient.

[0474] Another example of the present invention's method that can be used therapeutically is the site-specific integration of a chimeric antigen receptor (CAR). The term "chimeric antigen receptor" or "CAR" refers to a modified receptor that is transplanted onto immune effector cells with any specificity. These receptors are used to transplant the specificity of monoclonal antibodies onto T cells. The receptors are called chimeras because they are composed of parts from different sources. The most common form of these molecules is a fusion of a single-chain variable fragment (scFv) derived from a monoclonal antibody and the following fusions: CD3ζ transmembrane and intracellular domains (endodomain); CD28 or 41BB intracellular domains; or a combination thereof. Such molecules respond to the recognition of scFv by their targets and result in signal conduction. An example of such a construct is GPC3-CAR, which recognizes GPC3 (Glypican 3) specifically expressed on the surface of liver cancer cells. When T cells express this molecule, they recognize and kill target cells (e.g., liver cancer cells) expressing GPC3. To target malignant B cells, researchers have used chimeric immunoreceptors specific for the B lineage molecule CD19 to redirect the specificity of T cells. The variable parts of the immunoglobulin heavy and light chains are fused through a flexible linker to form scFv. The scFv is preceded by a signal peptide to direct the initial protein to the endoplasmic reticulum and subsequent surface expression (which is cleaved). The flexible spacer allows the scFv to be oriented in different directions to achieve antigen binding. The transmembrane domain is a typical hydrophobic alpha helix, which is usually derived from the original molecule of the signal transduction intracellular domain that protrudes into the cell and transmits the desired signal.

[0475] Artificial T-cell receptors are being studied as a cancer treatment using a technique called adoptive cell transfer. T cells are removed from a patient and modified so that they express receptors specific for a particular form of cancer. These T cells, which can then recognize and kill cancer cells, are then reintroduced into the patient. Modification of T cells derived from donors other than the patient is also under investigation.

[0476] These modified CAR T cells can be expanded in vitro, and then the expanded CAR T cell group can be infused into the patient. After infusion, T cells proliferate in the patient's body and, under the guidance of their modified receptors, identify and kill cancer cells with antigens on their surface. Many existing treatment methods involve the introduction of CARs infected by viruses. However, there are always safety issues when using viral infections in treatment methods. Therefore, the method described herein is a non-viral method for gene therapy and genome engineering. Previously, it was impossible to transfect immune cells with plasmid DNA because doing so resulted in severe toxicity to cells. The inventors of the present application found that by treating the transfection composition (for example, reducing the content of host genomic DNA) before cell transfection, the problem of affecting cell viability was overcome, and long segments of DNA (and / or high concentrations) were allowed to be transfected into cells while maintaining a high level of viability. Using the method described herein, CAR can be integrated into specific sites of immune cells. In some embodiments, the cells are autologous immune cells. Long-term expression of CAR in T cells or natural killer (NK) cells can be used for leukemia treatment or treatment of tumors associated with certain antigens.

[0477] In certain embodiments, using the method of the present application, the modified cells (e.g., immune cells, such as T cells) obtained by non-viral transfection (e.g., plasmid electroporation) of the isolated nucleic acid molecules of the present application (which encode the CAR described in the present application, such as GPC3-CAR, IL-15 or its functionally active fragment, and IL-21 or its functionally active fragment) surprisingly have good safety and tumor cell killing ability. For example, in certain embodiments, after the isolated nucleic acid molecule is transferred into the cell, it is inserted into a specific site (e.g., TRAC site) of the cell's genomic DNA, so that the exogenous protein (e.g., the CAR, the IL-15 or its functionally active fragment, and the IL-21 or its functionally active fragment) is expressed in a specific manner (e.g., timing and expression amount) under the regulation of the endogenous regulatory sequence (e.g., endogenous promoter) at the insertion site, so that the modified cell has both safety and therapeutic effect.

[0478] In some aspects, the method described herein relates to an improved method for ex vivo treatment. Cell populations can be isolated from an object, then cells can be activated by methods known in the art and / or methods described herein, and the genomic DNA of cells can be modified in a manner that corrects defects or site-specific integration of target genes. Cell populations can then be transplanted into an object for therapeutic purposes. In some cases, the cell populations separated can include cell subpopulations that are sensitive to certain in vitro operations (such as traditional transfection and / or electroporation methods), for example, or cell subpopulations can have resistance to traditional transfection and / or electroporation methods or genomic DNA manipulations. It is contemplated that modifying genomic DNA with the method described herein results in more efficient sequence modifications in such a group.

[0479] In addition, the cells and cell lines produced by the methods used herein can be used for drug development and / or reverse genetics research. Such cells and animals can show a phenotype associated with a specific mutation or its sequence modification, and can be used to screen for drugs that specifically interact with the mutation or mutant protein in question or drugs that can be used to treat the disease of sick animals. These cell lines can also provide tools for studying the effects of specific mutations, because cell lines and their corresponding "modified" cell lines represent "genetically identical" controls, thus providing a powerful tool for repairing disease-specific mutations, drug screening and discovery, and disease mechanism research.

[0480] The administration route of the immune cells of the present application can be, for example, intratumoral, intradermal, subcutaneous, intravenous, intralymphatic and intraperitoneal administration. In some embodiments, administration is intratumoral or intralymphatic. In some embodiments, the immune cells are administered directly into cancer tissue or lymph nodes.

[0481] In some embodiments, the immune cells are T cells. The T cells can be cells that have been exposed to an antigen or an antigen-presenting cell. For example, APCs can be cultured with a tumor antigen specific for the patient's cancer to differentiate into, for example, CD8-positive cytotoxic T lymphocytes (CTLs) or CD4-positive helper T cells. The T cells thus established can be administered to individuals with cancer.

[0482] The source of naive T cells (T cells) is not particularly limited and can be derived from, for example, the peripheral blood of vertebrates. The naive T cells used can be CD8 positive cells or CD4 positive cells separated from PBMC fractions. In some embodiments, with respect to the efficiency of inducing CTL, naive T cells are CD8 positive cells or CD4 positive cells mixed with other cells and components without separation from PBMC fractions. For example, when the cells of PBMC fractions are cultured in a culture medium supplemented with serum and tumor antigens, PBMCs differentiate into dendritic cell precursors. Dendritic cell precursors are then combined with peptides and differentiated into dendritic cells as antigen-presenting cells that present the peptide / tumor antigen. Antigen-presenting cells stimulate the CD8 positive T cells in PBMCs to differentiate into CTLs. Therefore, CTLs that can recognize the added peptides can be obtained. The CTLs thus obtained can be separated and used directly as cancer vaccines. Alternatively, before being used as cancer vaccines, they can be further cultured in the presence of interleukins (e.g., IL-2), antigen-presenting cells, and tumor antigens. The administration route is not particularly limited, and examples include intradermal, subcutaneous, intravenous, and intratumoral administration.

[0483] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0484] Example

[0485] The plasmids used in the following examples are described in the following table:

[0486] In the GPC3 CAR, the amino acid sequence of the scFv targeting GPC3 is shown in SEQ ID NO: 1. IL7 / 15 represents IL15 linked to an IL7 signal peptide. CCR19 / IL21 represents IL21 linked to a CCR19 signal peptide.

[0487] Example 1 Effect of Host Genomic DNA Content on the Performance of Immune Cells After Electroporation

[0488] Plasmid molecules 2 were obtained from different sources (respectively referred to as plasmid 2-1, plasmid 2-2, and plasmid 2-3), and the content of genomic DNA from the microorganisms producing the plasmids was detected. The results (amount of host genomic DNA contained in 1 mg of total DNA, μg) are shown in the following table:

[0489] Plasmids 2-1, 2-2, and 2-3 were obtained. A chemically synthesized sgRNA targeting the human TRAC gene (5'TCAGGGTTCTGGATATCTGT (SEQ ID NO: 25, with three thiomethyl and three oxymethyl modifications at the 5' and 3' ends, respectively, GenScript Biotech, Nanjing) was designed. Cas9 protein was purchased from Sino Biological (Cat. No. 40572-A08B). The sgRNA and Cas9 protein were prepared as ribonucleoprotein (RNP) for subsequent cell modification.

[0490] By electroporation, 2-1, 2-2, and 2-3 were introduced into two donor human T cells that had been activated for two days using Dynabeads (from Thermofisher, containing anti-CD3 and anti-CD28 antibodies), and the prepared RNPs were simultaneously introduced into these cells. The nucleic acid encoding molecule 2 was integrated into the TRAC gene of these human T cells and could be expressed via the endogenous promoter of the TRAC gene.

[0491] The survival rate and total number of living cells of T cells transfected with plasmid 2-1, 2-2 or 2-3 were detected by NC-200 cell counter, and the expression level of CAR in the transfected T cells was detected by flow cytometry and GPC3 protein.

[0492] The results are shown in Figures 12A-12C, respectively.

[0493] The results in Figure 12A show that compared with plasmid 2-1, which contains more nucleic acid molecules or fragments thereof derived from the genome of the host (e.g., a microorganism), the viability of T cells after transfection with plasmid 2-2 or 2-3 is significantly improved, wherein the lower the content of host genomic DNA, the higher the viability of the transfected T cells.

[0494] The results in Figure 12B show that compared with plasmid 2-1 containing more host genomic DNA, the total viable cell count of T cells after transfection with plasmid 2-2 or 2-3 was significantly increased, among which the lower the content of host genomic DNA, the higher the total or cell count of T cells after transfection.

[0495] The results in Figure 12C show that compared with plasmid 2-1 containing more host genomic DNA, the expression level of CAR expressed by T cells after transfection with plasmid 2-2 or 2-3 is significantly increased, among which the lower the content of host genomic DNA, the higher the expression level of CAR expressed by T cells after transfection.

[0496] Example 2 Performance of Engineered Immune Cells

[0497] A chemically synthesized sgRNA targeting the human TRAC gene (5'TCAGGGTTCTGGATATCTGT (SEQ ID NO: 25, with three thiomethyl and three oxymethyl modifications at the 5' and 3' ends, respectively) was designed and purchased from GenScript Biotech, Nanjing. Cas9 protein was purchased from Sino Biological (Cat. No. 40572-A08B). The sgRNA and Cas9 protein were prepared as ribonucleoprotein (RNP) for subsequent cell modification.

[0498] Plasmid molecule 2 was introduced into human T cells that had been activated for 2-3 days using Dynabeads (from Thermofisher, containing anti-CD3 and anti-CD28 antibodies) by electroporation, and the prepared RNPs were simultaneously introduced into the cells. The nucleic acid encoding molecule 2 was integrated into the TRAC gene of the human T cells and could be expressed via the endogenous promoter of the TRAC gene. The resulting cells were designated molecule 2 cells. The resulting cells were then tested.

[0499] The results are shown in Figures 1A-1D. Figure 1A shows that after the molecule 2 cells were expanded in Xvivo-15 (containing 5% SR + 100IU / ml rhIL-2, 10ng / mL rhIL-7, 5ng / mL rhIL-15) culture medium for 7 days, the cell number increased by at least 50 times. Figure 1B shows that the molecule 2 cells have a stable CAR molecule positive expression rate. Figure 1C shows that after TRAC knockout, CD3 in the molecule 2 cells was effectively knocked out. Figure 1D shows that there is a higher proportion of CD8 positive cells in the molecule 2 cells.

[0500] Example 3 Performance of engineered immune cells after cryopreservation and recovery

[0501] The viability, cell phenotype, and tumor cell killing ability of the frozen and revived Molecule 2 cells described in Example 1 were tested. The results are shown in Figures 2A-2C.

[0502] Figure 2A shows the cell viability of 5 different batches of molecule 2 cells (respectively referred to as CART-1, CART-2, CART-3, CART-4 and CART-5) after cryopreservation and recovery. The molecule 2 cells were frozen using CryoStor CS10 7 days after electroporation. The cell viability after cryopreservation and recovery was measured using NC-200 at 0 days, 1 day and 2 days after cryopreservation and recovery. The results show that the molecule 2 cells have a cell viability of at least 70% within 0-2 days after cryopreservation and recovery.

[0503] In addition, the ratios of CAR-positive cells and memory cells were measured before and after resuscitation, and the results are shown in Figure 2B. As shown in Figure 2B, the resuscitation process did not significantly change the CAR-positive rate and the proportion of memory cells in the cells, where TSM refers to CD62L+ / CD45RO- cells and TCM refers to CD62L+ / CD45RO+ cells.

[0504] In addition, the killing ability of the revived cells was tested. Briefly, the molecule 2 cells were co-incubated with Huh-7 cells, and the death rate of target cells generated by T cells killing target cells was counted after incubation. Death rate = N D / N L *100%. Of which, N L N is the number of target cells collected in 20 s during FACS detection. D is the number of dead target cells.

[0505] Figure 2C shows the mortality results for target Huh-7 cells. The horizontal axis, E:T, represents the ratio of effector cells (Molecule 2 cells) to target cells (tumor cells). As shown in Figure 2C, the resuscitated cells still retain their ability to kill target cells.

[0506] In addition, the expansion capacity of the molecule 2 cells described in Example 1 after freezing and revival was also tested, and the results are shown in Figures 3A and 3B. Briefly, the cells were cultured in Xvivo-15 medium (containing 5% SR + 100IU / ml rhIL-2), and Huh-7 target cells were co-incubated with the molecule 2 cells on day 0, day 5, day 6 and day 7 to activate the cells. It can be seen from the results of Figures 3A and 3B that the revived molecule 2 cells can still be continuously activated and expanded. Among them, Figure 3A shows that a portion of cells (about 5x10 5 Figure 3B shows the total number of amplified cells calculated.

[0507] Example 4: Expression of cytokines by engineered immune cells

[0508] The effect of the expression of IL-21 and / or IL-15 by the molecule 2 cells on their survival was further studied. The results are shown in Figure 4. Among them, 4 different batches of cells were tested, namely CART1, CART2, CART3 and CART4. "+Resti" means incubation with target cells (Huh-7 cells expressing GPC3), "-Resti" means not incubated with target cells, "+IL2" means adding additional recombinant human IL-2 (rhIL-2) to the culture medium, and "-IL2" means not adding additional IL-2 to the culture medium.

[0509] As shown in Figure 4, when the cells were cultured in vitro in a medium without rhIL-2 and not co-incubated with target cells, the Molecule 2 cells died rapidly. When the cells were cultured in vitro in a medium supplemented with 100 IU / ml rhIL-2 but not co-incubated with target cells, the proliferation and survival rates of the cells were only slightly increased. However, when the cells were co-incubated with target cells, the proliferation and survival rates of the cells were still increased, even without the addition of additional rhIL-2 to the culture medium.

[0510] The above results show that when the specific nucleic acid molecules of the present invention are introduced and integrated into the genome of T cells, the prepared CAR-T cells not only express CAR targeting tumor-associated antigens, but also express exogenous IL-21 and IL-15. Unexpectedly, compared with conventional CAR-T cells, in the presence of target cells, the CAR-T of the present invention can have excellent expansion ability and survival rate without the addition of IL-2. On day 14, in the presence of only target cells but without the addition of exogenous IL-2, the number of CAR-T cells of the present invention is about 1-2 orders of magnitude higher than the number of cells in the absence of target cells but with the addition of exogenous IL-2.

[0511] In addition, although the CAR-T cells of the present invention express IL-21 and IL-15, the expansion capacity of the CAR-T cells of the present invention is limited in the absence of target cells. Therefore, they are safe, indicating that there is no tumorigenic risk or the risk is extremely low.

[0512] Example 5: Engineered immune cells can effectively kill tumor cells in vitro

[0513] NCG mice (purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were subcutaneously injected with 1×10 7 HepG-2 cells (purchased from PharmaLegacy, Shanghai) were used to establish a subcutaneous tumor mouse model.

[0514] After about 14 days, the tumor grew to about 100 mm 3The volume of 1x10 8 100 μl of Molecule 2 cells were injected into the tail vein at a concentration of 1x10 / mL, and these mice were designated as the treatment group. 8 100 μl of control T cells (control T cells expressing CAR targeting CD19, wherein the scFv targeting CD19 is derived from the previously reported antibody FMC63) were injected into the tail vein at a concentration of / mL, referred to as the irrelevant CART control group. In addition, 2 model mice were injected with only the solvent, referred to as the solvent control group.

[0515] 18 days after the cell or solvent injection, peripheral blood cells were collected from two mice in each group and incubated with Huh-7 target cells in vitro. The results are shown in Figure 5A. Cells from the treatment group had a significant killing effect on Huh-7 target cells, while cells from the irrelevant CART control group or the solvent control group had no killing effect on Huh-7 target cells.

[0516] In addition, the levels of various cytokines in the cell culture supernatant after the co-incubation were measured. The results are shown in Figure 5B. After the cells from the treatment group were co-incubated, the expression levels of the various cytokines detected were upregulated. On the contrary, after the cells from the irrelevant CART control group or the solvent control group were co-incubated, the content of the various cytokines detected in the culture supernatant was almost zero.

[0517] Example 6: Engineered immune cells can effectively inhibit tumors in vivo

[0518] NCG mice (purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were subcutaneously injected with 1×10 7 HepG-2 cells (purchased from PharmaLegacy, Shanghai) were used to establish a subcutaneous tumor mouse model.

[0519] After about 14 days, the tumor grew to about 100 mm 3 The volume of 1x10 8 100 μl of Molecule 2 cells were injected into the tail vein at a concentration of 1x10 / mL, and these mice were referred to as the treatment group (three batches, 3 mice / group, a total of 9 mice). The other two model mice were injected with 1x10 8 100 μl of control T cells (CD19 CART cells) were injected into the tail vein at a concentration of 100 μl / mL, which was called the irrelevant CART control group. In addition, two model mice were injected with only the solvent, which was called the solvent control group.

[0520] The human cells (hCD45 +) ratio to determine the effectiveness of transplantation, and the results are shown in Figure 6A. As shown in Figure 6A, in the three treatment groups, the proportion of human cells was low on the 7th day, peaked on the 18th day, and then fell back from the 41st to the 69th day. Among them, the CAR expression of human cells in the peripheral blood of the three mice in the third treatment group was detected. The results are shown in Figure 6B. It can be seen that most of the human cells (hCD45 + ) all expressed CAR.

[0521] In addition, the tumor growth (Figures 6C and 6D), mouse survival rate (Figure 6E), and mouse body weight changes (Figure 6F) of mice in the treatment group, irrelevant CART control group, and solvent control group were detected.

[0522] As shown in Figure 6D, the tumor volume grew rapidly in both the unrelated CART control group and the solvent control group mice. In the 9 treated mice, the tumor volume was not significantly different from the control group 7 days after cell injection, but starting from the 11th day, the growth rate of the tumor volume decreased rapidly. Of the 9 mice in the treatment group, the tumor volume of 7 mice was reduced to zero on the 28th day and maintained until at least the 159th day after cell injection.

[0523] Fluorescence detection was performed on days 88, 116, and 145 after cell injection. As shown in Figure 6C, in each of the first and second treatment groups, one mouse had tumor recurrence and died (first treatment group) or showed very strong fluorescence values ​​(second treatment group) on day 145, but the fluorescence values ​​of the other seven treatment groups were zero on day 145. Surprisingly, one mouse in the first treatment group showed a small amount of fluorescence on day 116 (although the visible tumor volume was zero), but the fluorescence value was zero on day 145, suggesting that the recurrent tumor activated memory T cells, and that these memory T cells were able to eliminate the recurrent tumor cells.

[0524] As shown in Figure 6E, mice in the irrelevant CART control group and the solvent control group died on day 41 after injection. In contrast, the survival rates of mice in the first treatment group, the second treatment group, and the third treatment group were 66%, 66%, and 100%, respectively, on day 148 after cell injection.

[0525] As shown in the results of Figure 6F , among the 9 mice in the treatment group, except for the 2 mice that died, the body weights of the remaining 7 mice increased steadily.

[0526] Example 7: Expression of cytokines by engineered immune cells in vivo

[0527] NCG mice (purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were subcutaneously injected with 1×10 7HepG-2 cells (purchased from PharmaLegacy, Shanghai) were used to establish a subcutaneous tumor mouse model.

[0528] After about 14 days, the tumor grew to about 100 mm 3 The volume of 1×10 8 100 μl of Molecule 2 cells were injected into the tail vein at a concentration of 1:1 / mL, and these mice were designated as the treatment group. In addition, four model mice were injected with only the solvent, and designated as the solvent control group.

[0529] The expression of IFNγ, IL-15 and IL-21 in the peripheral blood of each group of mice was detected respectively. The results are shown in Figures 7A and 7B. On the 10th day after the injection of the cells, the peripheral blood of the mice was collected, and the content of IFNγ, IL-15 and IL-21 in each peripheral blood sample was detected by ELISA. As shown in the results of Figure 7A, the expression of IFNγ can be detected in the peripheral blood of each mouse, but the solvent control group does not express IFNγ. As shown in the results of Figure 7B, except for the positive control group (derived from a kit with known supernatant containing IL-15 and IL-21), the expression of IL-15 or IL-21 was not detected in the peripheral blood of each group of mice, indicating that the engineered immune cells of the present application do not express IL-15 or IL-21 in large quantities in the body, and thus have higher safety.

[0530] Example 8 In vivo tumor suppression effect of engineered immune cells

[0531] The hepatocellular carcinoma PDX model mice LI1035-R16P8 (Crown Biotech (Taicang) Co., Ltd.) were selected. On the 37th day after tumor inoculation, the subcutaneous tumor volume was about 100 mm. 3 -150mm 3 The mice were randomly divided into 3 groups, with 4 mice in each group. Two groups of mice were taken and 1x10 8 100 μl of Molecule 2 cells (2 different batches) were injected into the tail vein at a concentration of 1x10 / mL, and these mice were referred to as the first treatment group and the second treatment group. Another group of 4 model mice were injected with 1x10 8 100 μl of control T cells (expressing CAR targeting CD19, i.e., CD19-CART) were injected into the tail vein at a concentration of 100 μl / mL, referred to as the unrelated CART control group. The results are shown in Figure 8A. As can be seen from Figure 8A, the tumor volume of the mice in the unrelated CART control group grew rapidly, and the mice died on about the 45th day. In the mice in the first and second treatment groups, the tumor volume was controlled from the third day, and on the 17th day, the tumor volume was reduced to zero and maintained until the 135th day.

[0532] In addition, the body weight of the mice was measured. The results are shown in FIG8B . It can be seen that the body weight of the mice in each group increased steadily.

[0533] Example 9 Immune cells without knocked-in exogenous nucleic acid sequences cannot kill target cells

[0534] A chemically synthesized sgRNA targeting the human TRAC gene (5'TCAGGGTTCTGGATATCTGT (SEQ ID NO: 25, with three thiomethyl and three oxymethyl modifications at the 5' and 3' ends, respectively) was designed and purchased from GenScript Biotech, Nanjing. Cas9 protein was purchased from Sino Biological (Cat. No. 40572-A08B). The sgRNA and Cas9 protein were prepared as ribonucleoprotein (RNP) for subsequent cell modification.

[0535] By electroporation, plasmid molecule 2 was introduced into human T cells that had been activated for two days with Dynabead (from Thermofisher, containing anti-CD3 antibodies and anti-CD28 antibodies) without introducing Cas9 or sgRNA, obtaining DNA-Cas9-sgRNA group cells (i.e., containing only plasmid).

[0536] Plasmid molecule 2 was introduced into human T cells that had been activated for two days with Dynabead (from Thermofisher, containing anti-CD3 antibodies and anti-CD28 antibodies), and Cas9 was introduced into the cells to obtain DNA+Cas9-sgRNA group cells (i.e., containing plasmid and Cas9, but not sgRNA).

[0537] Plasmid molecule 2 was introduced into human T cells that had been activated for two days with Dynabead (from Thermofisher, containing anti-CD3 antibodies and anti-CD28 antibodies), and sgRNA was introduced into the cells to obtain DNA-Cas9+sgRNA group cells (i.e., containing plasmid and sgRNA, but not Cas9).

[0538] Plasmid molecule 2 was introduced into human T cells that had been activated for two days with Dynabead (from Thermofisher, containing anti-CD3 antibodies and anti-CD28 antibodies), and the prepared RNPs were introduced into the cells to obtain DNA+Cas9+sgRNA group cells.

[0539] CAR expression was measured in each group of cells on days 5, 6, and 9 after electroporation. The results are shown in Figure 9A. It can be seen that the proportion of CAR-positive cells was higher only in cells that were transfected with plasmid, Cas9, and sgRNA at the same time. This indicates that plasmids cannot stably express exogenous nucleic acid molecules for a long time if they are not integrated into the T cell genome.

[0540] In addition, the killing ability of each group of cells was also determined. Briefly, each group of cells was co-incubated with Huh-7 cells, and the death rate of target cells caused by T cells killing target cells was counted after incubation. Death rate = N D / N L *100%. Of which, N L N is the number of target cells collected in 20 s during FACS detection. D is the number of dead target cells.

[0541] Figure 9B shows the mortality results for Huh-7 target cells, with the abscissa E:T representing the ratio of effector cells to target tumor cells. As shown in Figure 9B, only cells co-transfected with the plasmid, Cas9, and sgRNA demonstrated significant killing activity against target cells.

[0542] Example 10 Performance of Engineered Immune Cells

[0543] A chemically synthesized sgRNA targeting the human TRAC gene (5'TCAGGGTTCTGGATATCTGT (SEQ ID NO: 25, with three thiomethyl and three oxymethyl modifications at the 5' and 3' ends, respectively) was designed and purchased from GenScript Biotech, Nanjing. Cas9 protein was purchased from Sino Biological (Cat. No. 40572-A08B). The sgRNA and Cas9 protein were prepared as ribonucleoprotein (RNP) for subsequent cell modification.

[0544] By electroporation, plasmid molecule 3 was introduced into human T cells that had been activated for three days using Dynabeads (from Thermofisher, containing anti-CD3 and anti-CD28 antibodies), and the prepared RNP was simultaneously introduced into the cells. The nucleic acid molecule encoding molecule 3 was integrated into the TRAC gene of the human T cells and could be expressed via the endogenous promoter of the TRAC gene. The resulting cells were molecule 3 cells. The obtained cells were tested.

[0545] The performance of the Molecule 2 cells and Molecule 3 cells after cryopreservation and thawing was compared in terms of viability, in vitro tumor cell killing ability, proliferation ability, cytokine expression, etc. The results are shown in FIG10 .

[0546] FIG10A shows that the viability of Molecule 2 cells and Molecule 3 cells after cryopreservation and thawing is comparable.

[0547] FIG10B shows that when co-incubated with target Huh-7 cells and activated by the target cells, the expansion capacity of molecule 2 cells was comparable to that of molecule 3 cells.

[0548] FIG10C shows that when co-incubated with target Huh-7 cells, the killing ability of molecule 2 cells and molecule 3 cells on target Huh-7 cells was comparable.

[0549] In addition, the ability of molecule 2 cells and molecule 3 cells expressing cytokines IL-15 and IL-21 was detected. Result is respectively as shown in Figure 10 D and Figure 10 E. When not incubated together with target cells, molecule 2 cells and molecule 3 cells can express IL-21, and the two express the level of IL-21 close, but when incubated together with Huh-7 target cells and after being activated, although the level of molecule 2 cells and molecule 3 cells expressing IL-21 increases, the level of molecule 3 cells expressing IL-21 increases significantly more (Figure 10 D). When not incubated together with target cells, molecule 2 cells and molecule 3 cells can express IL-15, and the two express the level of IL-15 close, but when incubated together with Huh-7 target cells and after being activated, although the level of molecule 2 cells and molecule 3 cells expressing IL-15 increases, the level of molecule 3 cells expressing IL-15 increases significantly more (Figure 10 E).

[0550] Example 11 Comparison of in vivo tumor inhibition effects of engineered immune cells

[0551] Furthermore, the in vivo tumor-suppressing abilities of the Molecule 2 cells and the Molecule 3 cells described in Example 10 were compared.

[0552] NCG mice (purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were subcutaneously injected with 1×10 7 HepG-2 cells (purchased from PharmaLegacy, Shanghai) were used to establish a subcutaneous tumor mouse model.

[0553] After about 14 days, the tumor grew to about 100 mm 3 The volume of 1x10 8 100 μl of CAR molecule 2 cells were injected into the tail vein at a concentration of 1x10 / mL, and these mice were called the CAR molecule 2 cell treatment group. The other 3 mice were injected with 1x10 8 100 μl of molecule 3 cells were injected into the tail vein at a concentration of / mL, and these mice were referred to as the CAR molecule 3 cell treatment group. The results are shown in Figures 11A and 11B (fitting data lines for each group for each cell). It can be seen that the CAR molecule 2 cell treatment group and the CAR molecule 3 cell treatment group had comparable in vivo inhibitory effects on tumors.

[0554] Example 12 In vivo tumor suppression effect under the regulation of exogenous promoter

[0555] Using the same plasmid backbone and homology arms as plasmid molecules 2 and 3, construct plasmids containing the following exogenous protein coding genes:

[0556] BCMA CAR-2A-IL15 (SEQ ID NO: 27);

[0557] BCMA CAR-2A-IL15-2A-IL21 (SEQ ID NO: 28);

[0558] PGK-BCMA CAR-2A-IL15-2A-IL21 (SEQ ID NO: 29);

[0559] PGK-GPC3 CAR-2A-IL15-2A-IL21 (SEQ ID NO: 30);

[0560] GPC3 CAR-2A-IL15-2A-IL21,

[0561] Among them, BCMA CAR is a chimeric antigen receptor targeting BCMA; PGK is an exogenous PGK promoter (SEQ ID NO: 26), and other elements are as defined above.

[0562] The plasmids were transfected into T cells by electroporation using the experimental method described above to prepare the corresponding CAR-T cells. The in vivo tumor inhibition experimental method was the same as in Example 11, and the inhibitory effect of each CAR-T on RPMI-8226 multiple myeloma and HepG2 liver cancer was tested respectively.

[0563] As shown in Figures 13A and 13B.In the in vivo tumor suppression experiment for RPMI-8226 multiple myeloma, CAR-T cells (PGK-BCMA CAR-2A-IL15-2A-IL21) expressing IL-15 and IL-21 by exogenous PGK promoter showed the best tumor killing effect, and the tumor suppression effect was better than that by endogenous promoter regulation expressing only IL15 or simultaneously expressing IL15 and IL21 CART cells.In the in vivo tumor suppression experiment for HepG2 liver cancer, CAR-T cells (PGK-GPC3 CAR-2A-IL15-2A-IL21) expressing GPC3 CAR, IL-15 and IL-21 by exogenous PGK promoter regulation showed substantially the same tumor killing effect as that when regulated by endogenous promoter.The results suggest that exogenous promoters can be used to express the nucleic acid molecules of the present invention.

[0564] The foregoing detailed description is provided by way of explanation and example and is not intended to limit the scope of the appended claims. Various changes to the embodiments listed in the present application are obvious to those skilled in the art and are intended to fall within the scope of the appended claims and their equivalents.

Claims

1. An isolated nucleic acid molecule comprising: a nucleic acid sequence encoding a chimeric antigen receptor (CAR); a nucleic acid sequence encoding IL-15 or a functionally active fragment thereof; and a nucleic acid sequence encoding IL-21 or a functionally active fragment thereof.

2. The nucleic acid molecule according to claim 1, wherein The nucleic acid molecule further comprises a nucleic acid sequence encoding an additional exogenous protein selected from the group consisting of IL2 or a functionally active fragment thereof, IL7 or a functionally active fragment thereof, a cytokine, a BiTE, an additional chimeric antigen receptor, or a combination thereof.

3. The nucleic acid molecule according to claim 1 or 2, wherein The nucleic acid molecule comprises a tandem expression unit comprising: (E1) a first expression unit for expressing the chimeric antigen receptor; (E2) a second expression unit for expressing the IL-15, or a functionally active fragment thereof, or a fusion protein thereof; (E3) a third expression unit for expressing the IL-21, or a functionally active fragment thereof, or a fusion protein thereof; and (E4) optionally a fourth expression unit for expressing an additional foreign protein, The positions of the first, second, third and fourth expression units can be interchanged arbitrarily.

4. The nucleic acid molecule according to claim 3, wherein Each independent expression unit is driven by an exogenous promoter or endogenous promoter operably linked thereto, or driven by a promoter further upstream and having a cleavable nucleic acid sequence at its 5' end (eg, 2A nucleic acid sequence, IRES nucleic acid sequence).

5. The nucleic acid molecule according to claim 3, wherein The number of the first expression unit, the second expression unit and the third expression unit is independently 1, 2 or 3.

6. The nucleic acid molecule according to claim 3, wherein The number of the fourth expression units is 0, 1, 2, 3, 4, or 5.

7. The nucleic acid molecule according to claim 3, wherein The nucleic acid molecule encodes 1, 2, or 3 identical or different CAR molecules.

8. The nucleic acid molecule according to any one of claims 1 to 7, wherein The nucleic acid molecule has the following structure: ARM5—P1—CAR1—P2 / L1—Z1—P3 / L2—Z2—(P4 / L3—Z3)m——ARM3 (I) Among various ARM5 is none or 5′ homology arm; ARM3 is none or 3′ homology arm; P1 is a promoterless, splicing acceptor, or the first exogenous promoter; CAR1 is a nucleic acid sequence encoding the first chimeric antigen receptor (CAR); P2 / L1 is the second exogenous promoter P2 or the nucleic acid sequence L1 encoding the cleavable part; One of Z1 and Z2 is a nucleic acid sequence encoding IL-15, or a functionally active fragment thereof, or a fusion protein thereof, and the other is a nucleic acid sequence encoding IL-21, or a functionally active fragment thereof, or a fusion protein thereof; L2 is the nucleic acid sequence L2 encoding the cleavable portion; P3 is the third exogenous promoter; P4 / L3 are each independently a fourth exogenous promoter P4 or a nucleic acid sequence L3 encoding a cleavable portion; Z3 is a nucleic acid sequence encoding an additional exogenous protein; m is 0, 1, 2, 3, 4 or 5.

9. The nucleic acid molecule according to claim 8, wherein the nucleic acid molecule has the following structure: ARM5-P1-CAR1-L1-Z1-L2-Z2-ARM3 (II) Wherein, ARM5, P1, CAR1, L1, Z1, L2, Z2, ARM3 and P2 are as defined above.

10. The nucleic acid molecule according to claim 8 or 9, wherein P1 is an exogenous promoter, such as PGK promoter; and / or P2 is PGK promoter.

11. The nucleic acid molecule according to any one of claims 8 to 10, wherein The 5' homology arm and the 3' homology arm are homologous to the target region in the immune cell genome, so that the nucleic acid sequence between the homology arms is positioned and knocked into the predetermined site.

12. The nucleic acid molecule of any one of claims 1-11, wherein the CAR comprises a target binding domain targeting a tumor-associated antigen, a target binding domain targeting a viral antigen, a target binding domain targeting an immune-associated antigen, or a combination thereof.

13. The nucleic acid molecule according to claim 12, wherein the tumor-associated antigen is selected from the group consisting of: GPC3, CD19, BCMA, GCC (GUCY2C), Her2, Claudin18.2 and Mesothelin; and the viral antigen is selected from the group consisting of: EBV-gp350 and HBV s protein.

14. A vector comprising the nucleic acid molecule according to any one of claims 1 to 13. The vector according to claim 14 , which is a plasmid.

16. The vector according to claim 14, wherein the plasmid is derived from a microorganism and the content of the microbial DNA in the plasmid is <10 wt% of the total DNA, preferably ≤5 wt%, and more preferably ≤1 wt%.

17. A method for preparing modified immune cells, comprising transfecting the immune cells to be modified with the nucleic acid molecule of any one of claims 1-13, or the vector of any one of claims 14-16, wherein the method is an electroporation method based on a donor plasmid combined with a localized nuclease, or an electroporation method based on a donor plasmid.

18. The method according to claim 17, comprising: (a) providing a donor plasmid, wherein the donor plasmid contains the nucleic acid molecule of claim 1, wherein the plasmid is derived from a microorganism and the content of the microbial DNA in the plasmid is less than 10 wt% (preferably ≤ 5 wt%, more preferably ≤ 1 wt%) of the total DNA; and (b) transfecting the immune cells to be modified with the plasmid, so that the cells contain and / or express the nucleic acid molecule.

19. The method according to claim 18, wherein in step (b), the transfection comprises electrofection.

20. The method according to claim 18, wherein in step (b), transfection is performed in the presence of a gene editing system, so that the nucleic acid molecule is integrated into a specific location of the cell genome.

21. The method of claim 20, wherein the gene editing system comprises a targeting nuclease and a guide RNA.

22. The method according to claim 21, wherein the positioning nuclease comprises a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), a transposase, an integrase and a Cas protein, preferably a Cas 9 protein.

23. The method of claim 22, wherein the transposase comprises PiggyBac (PB) transposase, and / or Sleeping Beauty (SB) transposase.

24. The method according to claim 20, wherein the gene editing system comprises a ribonucleoprotein complex RNP, and the RNP comprises the Cas protein and the guide RNA.

25. The method of claim 17, comprising: The immune cell to be modified is transfected with a transfection composition comprising the nucleic acid molecule of any one of claims 1 to 13, or the vector of any one of claims 14 to 16, so that the cell comprises and / or expresses the nucleic acid molecule, wherein at least part of the nucleic acid molecule or the vector is obtained from a host cell; and in the nucleic acid molecule portion or the vector portion obtained from the host cell, the content of the genomic DNA of the host cell is about 10% (w / w) (preferably ≤5wt%, more preferably ≤1wt%) or less.

26. The method of claim 25, wherein the immune cells comprise T lymphocytes, B lymphocytes, NK cells, macrophages, dendritic cells, monocytes, granulocytes and / or mast cells.

27. The method of claim 25 or 26, wherein the immune cells comprise peripheral blood lymphocytes.

28. The method of any one of claims 25-27, wherein the immune cells are primary cells.

29. The method of any one of claims 25-28, wherein the host cell has a genomic DNA content of about 1% (w / w) or less.

30. The method according to any one of claims 25 to 29, wherein the content of genomic DNA in the host cell is determined by qPCR.

31. A transfection composition comprising the nucleic acid molecule of any one of claims 1-13, or the vector of any one of claims 14-16, wherein at least a portion of the nucleic acid molecule or the vector is obtained from a host cell; and in the nucleic acid molecule portion or the vector portion obtained from the host cell, the content of genomic DNA of the host cell is about 10% (w / w) or less.

32. The transfection composition of claim 31, wherein the content of genomic DNA of the host cell is less than about 1% (w / w).

33. The transfection composition of claim 31, wherein the content of genomic DNA in the host cell is less than about 9‰ (w / w).

34. An immune cell prepared by the method of any one of claims 17-30.

35. A modified immune cell comprising or expressing the nucleic acid molecule of any one of claims 1-13, or the vector of any one of claims 14-16.

36. The immune cell of claim 35, wherein one or more additional genes are knocked down or knocked out.

37. The immune cell of claim 36, wherein the additional gene is different from the target gene into which the nucleic acid molecule or functionally active fragment thereof is integrated.

38. The immune cell of claim 36 or 37, wherein the one or more additional genes comprise immune checkpoint genes.

39. The immune cell of any one of claims 36-38, wherein the one or more additional genes include PD-1, CD95, and / or CD52.

40. A pharmaceutical composition comprising the nucleic acid molecule of any one of claims 1-13, the vector of any one of claims 14-16, and / or the cell of any one of claims 34-39.

41. Use of the nucleic acid molecule according to any one of claims 1 to 13, the vector according to any one of claims 14 to 16, the cell according to any one of claims 34 to 39, and / or the pharmaceutical composition according to claim 40 for the preparation of a medicament.

42. The use according to claim 41, wherein the medicament is for preventing, treating and / or alleviating cancer.

43. A method for preventing, treating and / or alleviating a disease or condition in a subject, the method comprising administering to the subject an effective amount of the nucleic acid molecule of any one of claims 1-13, the vector of any one of claims 14-16, the cell of any one of claims 34-39, and / or the pharmaceutical composition of claim 40.

44. The method of claim 43, wherein the disease or condition is cancer or a viral infection.

45. The nucleic acid molecule according to any one of claims 1-13, the vector according to any one of claims 14-16, the cell according to any one of claims 34-39, and / or the pharmaceutical composition according to claim 40, for use in preventing, treating and / or alleviating a disease or condition in a subject.

Images