Gene for regulating soybean density-tolerant plant type and application thereof

Abstract

The invention provides a genome sequence for regulating density-tolerant plant types of isolated leguminous plants, preferably soybean, pea and chickpea plants, such as soybeans, peas, mung beans, broad beans, black beans and chickpeas, and application of the genome sequence, and the genome sequence is shown as SEQ ID NO: 3. The method has important application value for developing close planting soybeans, intercropping soybeans and the like, and has important value for optimizing soybean plant type architecture and improving theoretical and practical research related to soybean yield in unit area.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to genes for regulating the dense-planting tolerance of soybean and their uses. Background Art

[0002] Soybean can provide rich plant protein and oil for humans and is an important grain and oil cash crop. However, the situation that China has long relied on soybean imports has not changed, and the gap between soybean production and demand in China has been increasing year by year, and there is a large difference between the soybean yield per unit area and the international average level. Therefore, in the actual situation where the available cultivated land area in China is gradually decreasing, how to avoid competing for land with major food crops and meet the demand for plant protein in China's diet structure change and increase the soybean yield per unit area in China is an issue worthy of attention. By designing the ideal plant type of soybean and optimizing the soybean planting density per unit area to reduce the light loss in the field is the biological basis for solving this problem.

[0003] As early as in 1968, Donald proposed that the ideal plant type (ideotype) of crops guides breeding (Donald, 1968), that is, deeply understanding the molecular regulation mechanism of the traits of existing high-yield plants, and on this basis, achieving the optimal combination of various excellent traits to design crops with ideal plant types in order to obtain higher grain yields. In the "Green Revolution", by planting semi-dwarf wheat and rice and sacrificing the straw biomass, not only the grain yield was increased, but also excellent lodging resistance was shown (Peng et al., 1999). Rice IPA1 (Ideal Plant Architecture 1) can reduce the tiller number and increase the spikelet branch number, thereby increasing the yield (Jiao et al., 2010; Miura et al., 2010; Wang et al., 2018). Wheat TaCOL-B5 increases the spikelet branch number and spikelet node number, resulting in an 11.9% increase in yield (Zhang et al., 2022).

[0004] To achieve the green revolution in the soybean industry, the ideal soybean plant type has been proposed, which is suitable for high-density planting and has appropriate plant height, short internode length, more nodes, few or no branches, moderate number of pods per node, high pod-setting rate, high ratio of four-seed pods, moderate 100-seed weight, small petiole angle, short petiole, etc. (Liu et al., 2020). Previous studies on increasing soybean yield mainly focused on higher seed weight and more pods, which often led to a small "source" and an insufficient "sink", making it difficult to achieve a breakthrough increase. Therefore, how to ensure that under the balance of "source" and "sink", the lateral organs have a reasonable spatial position, optimize the plant type architecture, improve the overall light energy utilization efficiency of the plants in the field, and increase soybean yield as a whole, the design of the soybean branching plant type has become an excellent idea to solve this problem.

[0005] Therefore, to reduce light energy loss in the field and increase soybean planting density, the first thing to consider is the appropriate branching structure. Among the many traits affecting soybean yield, the branching traits, including the length, number, and angle with the main stem of the branches, affect the ventilation and light energy utilization of the soybean population, and are important factors in constructing the ideal soybean plant type and affecting soybean yield. Among them, the number of branches is an important agronomic trait affecting crop yield. In the gramineous plant rice, reducing the number of tillers and increasing the number of spikelet branches ultimately increases the yield. In the dicotyledonous plant soybean, the branching number trait, which belongs to the quantitative trait, is controlled by major and minor polygenes, and is also affected by environmental factors such as planting density and light conditions, which makes the study of the soybean branching number trait particularly complex. Currently, there is no report on the genes related to the shaping of the soybean dense-planting type. Summary of the Invention

[0006] Through the functional study of the soybean Ln gene, the present invention found that the natural variation ln of Ln significantly reduces the number of branches. The transgenic function verification found that ln can shorten the petiole, shorten the internode, reduce the plant height, and significantly reduce the number of branches to a single stem, which is a good dense-planting type. This not only lays a genetic foundation for the analysis of the molecular mechanism of soybean plant type shaping, but also provides gene resources for the subsequent improvement of soybean yield per unit area.

[0007] Specifically, the present invention provides the following technical solutions:

[0008] On the one hand, the present invention provides an isolated genomic sequence for regulating the dense-planting type of leguminous plants, preferably plants of the genus Glycine, Pisum, and Cicer, such as soybean, pea, mung bean, broad bean, black bean, and chickpea, characterized in that the genomic sequence is as shown in SEQ ID NO:3.

[0009] On the other hand, the present invention provides the use of ln in regulating the dense planting type tolerance of leguminous plants, preferably plants of the genus Glycine, Pisum, Cicer, such as soybean, pea, mung bean, broad bean, black bean, chickpea, characterized in that the coding sequence of the ln is as shown in SEQ ID NO: 1.

[0010] In some embodiments, the amino acid sequence of the ln is as shown in SEQ ID NO: 2.

[0011] In some embodiments, the genomic sequence of the ln is as shown in SEQ ID NO: 3.

[0012] In some embodiments, the use is manifested as one or more of the following:

[0013] a. Reducing the number of branches;

[0014] b. Reducing the plant height;

[0015] c. Reducing the number of nodes;

[0016] d. Shortening the internode length;

[0017] e. Shortening the petiole length.

[0018] On the other hand, the present invention provides an expression vector, characterized in that the expression vector contains the genomic sequence as described above.

[0019] In some embodiments, the expression vector has an antibiotic marker and / or an anti-chemical reagent marker.

[0020] On the other hand, the present invention provides a host cell, characterized in that the host cell contains the genomic sequence or the expression vector as described above.

[0021] On the other hand, the present invention provides a method for regulating the dense planting type tolerance of leguminous plants, preferably plants of the genus Glycine, Pisum, Cicer, such as soybean, pea, mung bean, broad bean, black bean, chickpea, characterized in that the method comprises the step of introducing the expression vector or the host cell as described above into leguminous plants, preferably plants of the genus Glycine, Pisum, Cicer, such as soybean, pea, mung bean, broad bean, black bean, chickpea plants or cells or tissues.

[0022] In some embodiments, the dense planting type tolerance is manifested as one or more of the following: compared with the wild type or control plants, a. reduced number of branches; b. reduced plant height; c. reduced number of nodes; d. shortened internode length; e. shortened petiole length, and still grows well under high-density planting.

[0023] Definition

[0024] High-density planting: Defining 80 - 120 plants per square meter of Dongnong 50 as high-density planting. For example, the planting density is a plant spacing of 5 cm and a row spacing of 50 cm.

[0025] Low-density planting: Defining 26 - 40 plants per square meter of Dongnong 50 as low-density planting. For example, the planting density is a plant spacing of 15 cm and a row spacing of 50 cm.

[0026] Beneficial effects

[0027] The soybean plant type shaping-related protein, the coding nucleic acid sequence, and its genomic nucleic acid sequence (including the promoter) provided by the present invention were all first discovered by the applicant, and phenotypic analysis and verification of transgenic plants and wild-type plants showed that expressing the plant type shaping protein of the present invention can significantly affect the soybean plant type.

[0028] The present invention will have great theoretical and practical value for the construction of the ideal soybean plant type, the breeding and creation of density-tolerant varieties, and their related basic and applied research. Description of the drawings

[0029] Figure 1 It shows that the ln plant type is compact under low density, indicating that ln can shape the density-tolerant soybean plant type. Among them, A shows that ln makes the plant type compact; B shows that ln significantly reduces the number of branches, plant height, and internode distance; C shows that ln shortens the petiole; D shows the relative expression level of the ln overexpression line in the leaves.

[0030] Figure 2 It shows the performance of transgenic materials under different planting densities. Among them, A shows the performance of DN50 planted at low density (plant spacing of 15 cm; row spacing of 50 cm); B shows the performance of DN50 planted at high density (plant spacing of 5 cm; row spacing of 50 cm); C shows the performance of the ln line planted at low density (plant spacing of 15 cm; row spacing of 50 cm); D shows the performance of the ln line planted at high density (plant spacing of 5 cm; row spacing of 50 cm).

[0031] Figure 3 It shows the construction map of the ln genomic expression vector.

[0032] Figure 4 It shows the statistical results of plant height (n≥30), number of branches, number of nodes, petiole length, and internode length between the ln transgenic material and the wild-type Dongnong 50 material under low density. It includes the sample size, sample mean, sample standard deviation, sample extreme values, and the significance level of the difference between the ln transgenic material and the wild-type Dongnong 50 material. The significance test uses a one-tailed T-test, P < 0.01, n = 30.

[0033] Figure 5Shows the yield tests of ln transgenic materials and wild-type Dongnong 50 materials at different planting densities (LD: low density, 15 cm plant spacing, 50 cm row spacing; HD: high density, 5 cm plant spacing, 50 cm row spacing). Among them, A shows the yield per plant at different planting densities (n = 30); B shows the yield per mu of the plot at different planting densities (n = 3). One-way ANOVA and Tukey's multiple comparisons were used, with P < 0.05 or P < 0.01. Detailed implementation mode

[0034] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the following further details the present invention in combination with specific embodiments and with reference to the accompanying drawings.

[0035] The following embodiments are for better understanding of the present invention, but are not intended to limit the present invention. In the following quantitative tests of the embodiments, three repeated experiments are set, and the results are averaged, which are statistically significant.

[0036] In the following embodiments, the transformation receptor is Dongnong 50 (DN50, Heilongjiang Crop Variety Approval No. 2007022), which can be purchased from the market. The vector pTF101.1 and the Agrobacterium strain EHA101 are purchased from the China Center for Plasmid Vector Strain Cell Gene Preservation (Biovector Science Lab, Inc).

[0037] Consumables such as homologous recombination kits are purchased from Novoprotein Scientific Inc. and Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0038] Example 1 Discovery of ln protein and its encoding gene

[0039] The research group previously identified the gene ln (Fang et al., 2013) that controls soybean acuminate leaf and four-seeded pod traits by map-based cloning. Its CDS sequence is shown in SEQ ID NO: 1, and the encoded amino acid sequence is shown in SEQ ID NO: 2. To further study the gene function of ln, we amplified the full-length ln gene of about 8 kb (SEQ ID NO: 3) from the soybean cultivar DN50 (ln / ln), including 2.6 kb of the upstream promoter, 1.8 kb of the ln genomic DNA sequence, and 3.2 kb downstream of ln (the present invention selects to introduce the existing genomic DNA sequence itself, which can be relatively closer to the real transcription and translation status in vivo), and transferred it into DN50, and found that it significantly improved the soybean plant architecture. Its compact plant type, shorter petioles, no branches, and shortened internodes imply its suitability for close planting and contribute to increasing the yield per unit area.

[0040] Example 2 Functional verification of ln protein

[0041] I. Construction of recombinant plasmid

[0042] Genomic DNA was extracted from Dongnong 50 (DN50), and the ln gene was amplified by KOD high-fidelity PCR using this genomic DNA as a template. Then, it was homologously recombined into the pTF101.1 vector to obtain the recombinant plasmid pTF101.1-pGmln-gGmln. The specific operations are as follows:

[0043] 1. Extract the leaf DNA of soybean variety DN50.

[0044] 2. Using the total DNA obtained in step 1 as a template, perform PCR amplification with the primer pair consisting of F1 and R1 to obtain a PCR amplification product.

[0045] F1:

[0046] 5’-ATGTTGACCTGCAGGCATGCAAGCTTGGCGTCAAACTTTACCGAT-3’(SEQ ID NO:4)

[0047] R1:

[0048] 5’-AACAGCTATGACATGATTACGAATTCACTTTTAAGCACACCTGACC-3’(SEQ ID NO:5)

[0049] 3. Double-digest the pTF101.1 vector (purchased from the China Center for Conservation of Plasmid Vector Strains and Cell Genes) with the restriction endonucleases Hind III and EcoR I, perform 1% agarose gel electrophoresis, and recover the linearized vector of approximately 8 kb from the gel.

[0050] 4. Ligate the PCR product in step 2 and the vector backbone in step 3 using homologous recombination to obtain the recombinant plasmid pTF101.1-pGmln-gGmln (its map is shown in Figure 3 ).

[0051] II. Obtaining of ln overexpression transgenic plants

[0052] 1. Introduce the recombinant plasmid pTF101.1-pGmln-gGmln into the Agrobacterium tumefaciens strain EHA101 (purchased from the China Center for Conservation of Plasmid Vector Strains and Cell Genes) to obtain recombinant Agrobacterium.

[0053] 2. Use the recombinant Agrobacterium obtained in step 1 to perform soybean genetic transformation (Li et al., 2017) on the cotyledon node by Agrobacterium-mediated transformation, and transform the recipient plant DN50.

[0054] (1) Sterilization of soybean seeds: Select plump soybean seeds with large grains, smooth surfaces without disease spots, and no scratches on the seed coats. Divide and place them into petri dishes. Open the lids of the petri dishes and put them into a desiccator. For seed disinfection, use the chlorine fumigation sterilization method. Place a small beaker in the desiccator, add 100 mL of sodium hypochlorite, then add 5 mL of concentrated hydrochloric acid. Quickly cover the lid and sterilize for 10 - 14 h. After sterilization, take out the soybeans from the desiccator and blow them in a laminar flow hood for more than 30 min to remove the excess chlorine.

[0055] (2) Imbibition and germination of soybean seeds: Place the sterilized seeds with the hilum facing down and insert them into the germination medium. Incubate at 23 °C in the dark for 16 - 18 h.

[0056] (3) Preparation of Agrobacterium: Take out the bacteria stored at -80 °C and add them to 5 mL of YEB medium containing rifampicin and kanamycin resistance. Culture at 28 °C and 250 rmp for 24 h to recover. Then, pipette 200 μL of the recovered bacterial solution into 200 mL of YEB medium containing rifampicin and kanamycin resistance. Culture at 28 °C and 250 rmp until OD 600 = 0.6 and collect the bacterial solution. Centrifuge at 22 °C and 5,000 rmp for 10 min, and then resuspend the bacterial cells in the liquid infection medium to OD 600 = 0.5. Culture at 22 °C and 70 rmp for 0.5 h for standby.

[0057] (4) Preparation of explants: Remove the seed coats of the imbibed seeds, use a scalpel to cut off the part of the hypocotyl far from the cotyledons, so that the remaining hypocotyl is about 2 - 3 mm. Then, cut the soybean seeds in half and use a small wire brush to remove the germ. The prepared explants are ready.

[0058] (5) Infection of explants: Place the prepared explants into the Agrobacterium suspension, make the resuspension cover the explants, and gently shake for 0.5 h.

[0059] (6) Co-culture of explants and Agrobacterium: Blot the excess bacterial solution from the infected explants on sterile filter paper. Place a sterile filter paper on the co-culture medium, and place the blotted explants on the medium. Incubate at 23 °C in the dark for 3 - 5 d.

[0060] (7) Inductive culture of callus: After the co-culture of explants and Agrobacterium is completed, transfer the explants to the callus induction medium. At this time, place the explants at a 45-degree angle and gently insert the bottom into the medium. Incubate at 23 °C with a 16 h light / 8 h dark cycle for 14 d.

[0061] (8) Bud induction culture: Cut the induced callus from the explants and place it into the bud induction medium. Incubate at 23 °C with a 16 h light / 8 h dark cycle for 14 d, and transfer it to a new bud induction medium every 14 d;

[0062] (9) Bud elongation culture: Transfer the explants with induced new buds into the bud elongation medium, and transfer them to a new bud elongation medium every 2 weeks until the buds grow to more than 3 cm.

[0063] (10) Rooting culture: Cut the elongated buds and insert them into the rooting medium until the roots grow more than 3 cm, then harden the seedlings and transplant them to the greenhouse at 24 °C with a 16 h light / 8 h dark cycle until maturity. During this period, spray Basta and identify positive plant lines by PCR.

[0064] Table 1 Formulation of 1 L germination medium

[0065]

[0066] Table 2 Formulation of 1 L YEB medium

[0067]

[0068]

[0069] Table 3 Formulation of 1 L infection solution

[0070]

[0071] Table 4 Formulation of 1 L co-culture medium

[0072]

[0073]

[0074] Table 5 Formulation of 1 L callus induction medium

[0075]

[0076] Table 6 Formulation of 1 L bud induction medium

[0077]

[0078] Table 7 Formulation of 1 L bud elongation medium

[0079]

[0080]

[0081] Table 8 Formulation of 1 L rooting medium

[0082]

[0083] Soybean leaves were smeared with 0.1% Basta herbicide (Glufosinate, CB2471-100mL). After 3 days, those without chlorosis reaction were transgenic positive plants. T0 generation seeds were harvested. Subsequently, T1 generation and subsequent transgenic lines were screened by spraying 0.1% Basta herbicide. After all were resistant to Basta, successful overexpression transgenic plants were obtained, including 3 transgenic lines ln-1, ln-2, and ln-3( Figure 1 ).

[0084] Total RNA was extracted and reverse transcribed into cDNA, and the expression level of ln transcription was detected by fluorescence quantitative PCR. The RT-qPCR primers were designed as follows:

[0085] ln gene

[0086] F2: 5’-GTGTTTGCCTCACATCATTTTTCC-3’ (SEQ ID NO:6)

[0087] R2: 5’-TTGTGCAGCAATGTTATGATCACA-3’ (SEQ ID NO:7)

[0088] Reference gene ACTIN

[0089] F3: 5’-CGGTGGTTCTATCTTGGCATC-3’ (SEQ ID NO:8)

[0090] R3: 5’-GTCTTTCGCTTCAATAACCCTA-3’ (SEQ ID NO:9)

[0091] The instrument model was Roche Light Cycler 480, and the reagent was 480 SYBR Green IMaster. The reaction system was as follows (20μL):

[0092] Table 9 RT-qPCR reaction system

[0093]

[0094] The RT-qPCR parameters were set as follows:

[0095] Hot start at 95℃ for 5 min; denaturation at 95℃ for 10 s, annealing at 59℃ for 10 s, extension at 72℃ for 7 s, for 45 cycles; after the amplification cycle, a melting curve was made: denaturation at 95℃ for 5 s, 65℃ for 1 min, rising from 65℃ to 97℃ at a rate of 0.11℃ / s.

[0096] Each amplification reaction had at least 3 technical replicates. The 2 -ΔΔCt method was used to calculate the relative expression level.

[0097] The results showed that in the overexpression lines, the expression level of ln increased by a hundredfold, and the expression was significantly upregulated (see Figure 1 D).

[0098] Example 3 Statistical analysis of the transgenic phenotypes of ln

[0099] In this example, transgenic plants overexpressing the ln gene under the DN50 background were verified. The plant type was compact, the number of branches was significantly reduced, and it was a single-stem plant; the plant height was significantly shorter (the plant height was reduced to 56.8%, 49.24%, and 46.04% of the original); the number of nodes was reduced by 7.01%, 11.06%, and 11.37%; the internode length was significantly shortened (the internode length was reduced to 39.94%, 38.84%, and 37.71% of the original); the petiole length was significantly shortened (the petiole length was reduced to 13.3%, 10.35%, and 6.75% of the original) ( Figure 1 A - C, Figure 4 ). Moreover, compared with the low-density planting condition (plant spacing of 15 cm; row spacing of 50 cm), in the high-density sowing method (plant spacing of 5 cm; row spacing of 50 cm), the ln transgenic plants still performed well (see Figure 2 ). This example demonstrated that overexpression of the ln gene could significantly improve the plant type, make the plant architecture more compact, and play an important role in dense planting tolerance.

[0100] Therefore, we further compared the yields under different densities. The results showed that high-density planting reduced the yield per plant of DN50 by 68.2%, while the yield per plant of ln transgenic plants only decreased by 22.9% ( Figure 5 A), suggesting that ln transgenic plants could increase the overall yield by increasing the number of plants per unit area. Furthermore, we identified the plot yields under different planting densities. By comparing the yields per mu, it was found that ln transgenic plants could significantly increase the yield per mu. Under high-density planting conditions, ln transgenic plants had a 38.5% higher yield than DN50, and under low-density planting conditions, they had a 27.9% higher yield than DN50 ( Figure 5 B). This result once again confirmed that ln transgenic plants could increase the soybean yield per unit by increasing the planting density, reducing the light loss in the field, and increasing the light energy utilization per unit area.

[0101] Sequence

[0102] SEQ ID NO:1 CDS sequence of ln protein

[0103] ATGAGACCAGAACGAAACCCCTTACATCTTAACAATTTGCCCGATGAGTACTCTAGAGATGGCAAACAAGTCCTCGAAGACCATACCTCTTCATCCGGTTGCAGGAAAAAGAAAAGCGGCGGGAAGGATGGAAAAGACGAGTGTGGGAAGGTCTACGAGTGTAGATTTTGTTCCCTCAAGTTCTGCAAGTCTCAGGCTCTTGGGGGACACATGAACCGCCACCGCCAAGAGAGGGAAACGGAGACGCTGAACCAGGCTCGTCAACTGGTCTTTCGTTGTGATCATAACATTGCTGCACAAGGTGCCCCTCACTTAGGATGCTGCCAAACAATAGGAACGGGGGGTTATCATCCCTCAGGAGACCCAACAGTGCCTCTAAGATTCCCAAGATACTTCTCAGGTTCATCCTCAACTCACATGCCACCATCCCCGCCACCGCCGCCGCCACCGCAACGACCATACCTATACCCTTCACCTACGAGGCCAGTGTCATTTGGGTCATCACACTTCCCTCTCCAGCATGCAGTGAACGATTACTATGTGGGCCACGTGATGAGTGGTGGCAGCCACGGACACTATGTTGGAGGAGAGAGCACAAGGAGTTACACGTGCATTGGTGCACCGGTGGGGCAAGGTGGCGGATTCGCTGGTGGTAAGGAGGGGTCTGCAGTGCAGGAGGAAGGGTTGAGTACTTGGGGAAGGGGCTATTCAGGTGCACAGGATCGTTTGGATCCTCCCTCAGCGATCAATCGGTTTCAAGATGGTTTCTAA

[0104] SEQ ID NO:2 ln protein amino acid sequence

[0105] MRPERNPLHLNNLPDEYSRDGKQVLEDHTSSSGCRKKKSGGKDGKDECGKVYECRFCSLKFCKSQALGGHMNRHRQERETETLNQARQLVFRCDHNIAAQGAPHLGCCQTIGTGGYHPSGDPTVPLRFPRYFSGSSSTHMPPSPPPPPPPQRPYLYPSPTRPVSFGSSHFPLQHAVNDYYVGHVMSGGSHGHYVGGESTRSYTCIGAPVGQGGGFAGGKEGSAVQEEGLSTWGRGYSGAQDRLDPPSAINRFQDGF

[0106] SEQ ID NO:3ln genomic sequence (including promoter and 5'-UTR (underlined part), exon, intron, 3'-UTR sequence, downstream sequence)

[0107] TGGCGTCAAACTTTACCGATAAAAGAAGAAACTTTTGAATTGTTTATAAATAGTTAACTATACAATTAT AGACAGGGTAATTCGGTTTGGTTTCAAAGAATGATTTGATTTAATTTGGTTTGAAAGTTTTGCTAGTGGTATATTTA CTGTTGGTTCCCCGCCTCATGTATGTTTAGAGTTGAAAGTCGAAACCTCTTGAGATTGCATCATTTAAGCGCTTACA GTACCCCTCGGCTCAAATGAATTTGTCAGGAAACTTTTTTCCTCTAATACATATCACCATAATCTGATTTGTAGTAC CACGATCTGGAACAGATATTCTCCTCCCCACGTTTTTATCAATAGAATCCAACACTCCTTGTAAATTTGAAATATGA AAGTTTTAATACTTGATGTTATTTTGGTATTTCTCATGGTCTAAAACTCGATCTCATGTAATTTACAATCTTTGGCT TTGTTTGTTTCATTTCTTTGCCTAAAATATAATTAATTGACGGGTTTGATTTCATGCACTTTCTGTCACAAGGAAAG GTAACATTTAAAAGTTTTCAATTTTAAATTTTGACTGCTTGAAGGGAAGCTAGGTAGGAAGGCAACATGATGATGAA GACAATTTCCTCTACTGGTTTGTAAGTTTGCCTTGCTAGAGTTCTGAACATGGAAGAAATGTTTGTTGGATTTACTG CTTAAATTCGTGAAGGACCACTTGAAAAGTAATGATATATATACACACACTTGCAAGAAAAATTTCAGATAGGTGGG GCGCGGTCATTGCATGAATCTTTGGGTCTAGGTTTTGAAAATATCGAATGTGTCTCATATCATTTCCTTCATAATAC CAACCAGCTAGTCAAGGCCAGCTGCAGTAGTGTGGTCCATGAATATCACCTGATTTTAATGCCTAGCTAGCCCTCTT ATTAGGTTGTGTCTTCTTTCTCCTTTATATCCATTTCAGGTGTGTGGTGGGGGAAGCACTGATCAGCTTGTGGACAA CATCAGCCCCTCTAACTATTGTTTCTTTTTGCCATTTACACATATATGCTGCTCCAAATCAAGACCCAGCCCTTAAT TACCAAGTAATTAAAACAGCTGGTAATTATTATTATTATTATTATTATTTCAACCGTTAAAGCTAGCTAGCTTTTTG ACCTGTACTAGTAGTATGTATATATACTTTTCTCTCAGCTTTAAACTAGATAGTAATCAATAACCCCCACCACTATT TTTTAAAAAAAAAATGTAAAACAGTTAATTGCTTCTGCATATTAATTTGGAGAACACTTTGTTTTACCTAGCTAACT AGTTAACTATCTTATAAAGGAATCACTCATTAGAGATGGAGCTATAGTGTTTGGATTCAAAGAAAACGCATCTAAAG CCAACAGAGAATATAATGATGAATGTGAGACATACATTAAGAAAATTCAAGTTCATATATTTCTCCACTTTTTTCAT GAAAAGGACTATGTATATGTAATCTATGAGATATAGCAACTTTCAAAGAATAAAACAACAAGTGGGGGGTCGAGTCT ATCTCAGCTTAGATTGCAAAAAACCCTAATGATAGATACTGATAGCAACCCTTCCTTGATGCAAGTCTAAGTCCCCT GGGTAGAATTTTACCCCCAGAAGGAGGCATTGAGCTATTGTGGACCATACACGAACTGTTCTCAAACATGCCCCCCC TCTTTAAGCACAATAACCACGCAAAATGTCTACGTACCCTATGCCTTGTCTTGCTTTCTTTCTGGTATAAATGTCAT CTTTCATTCTTAGGGCAACCTTTAATGCTCAAAGATTTGTACTGTACATTTGATGGACATCCTTTGTTGGTAAAGAT TTTCTTTTGAGATATTAATTAATTATTTTTTTCAGTGTATTTGACTGATATTGTTTGAATATTTTTGGACCCTTTGT TGATAGCTCTAGCTAGGGCAAAACAAAAAAAAACTAGATGCAGAAGTATCATATATCTATGCAACATCATATTTTTG CAATAAAATTATATAATAACTAGCATAAATGAAATAGTCATTTTTTTTTATATATCTCTTCATCATATAATTCACTT TATCACATGTTTCTTTTTATCTCTTATTTGTTGTATATATTTATTATATTAATATAAATTCTCTATAGATTACTAAA TAGGAATAATTAATACAAAAGCAACATGTTTCCGAATCACATATCTTTGCCCTTTTCTAATTCTGTCCTATCATTTC CCAAGTCTCAACCAAACTAGATTAAGTTAAGCCCCCCCCCCGCCCCCCCCCTCCACACTCACTCTCACACTCTCTTT TTTTAAAGTCACGAGACCCACTGTCCAATTATTCATTCAATTTTTGTGTGGGGGGGCGGGGGGAGATAAGAGAGAGA GAGAGAGTGGCAGAGGAACTGATAGAGAACTTTCAAAGCTCTTTATCTTCTACCATCACTCAACCAGCCTCTATATT GCAGTCTCAAACTGAAAGTCTAAAATTTTTTGTAAAAAGCTTTAGTTTTATCCCTACCCCCACCCCATCTGAAAGAA AGAGTGTTTGCCTCACATCATTTTTCCCCTTTCTGTCTCTCTCTCTGTCGGTACC

[0108] GTATGCACCCATTACTTCCATGCAGCGATTCTCTTCCTATTTCTTCTTC

[0109] TTGTTCAACATTTATATATTTCATTTCTCAAATACTTGTTTTTCTGTGGG

[0110] TTCTTTAGCGTTTGTTAACGTTGTTTTTTCAAGGTATAACACATAATAT

[0111] TTGGGTACTCAGCATGACACTGTTTGATACTGCGATTTATTTGTGATA

[0112] ATATTCAATTCAGATGCTGCCAAACAATAGGAACGGGGGGTTATCATC

[0113] CCTCAGGAGACCCAACAGTGCCTCTAAGATTCCCAAGATACTTCTCA

[0114] GGTTCATCCTCAACTCACATGCCACCATCCCCGCCACCGCCGCCGCC

[0115] ACCGCAACGACCATACCTATACCCTTCACCTACGAGGCCAGTGTCAT

[0116] TTGGGTCATCACACTTCCCTCTCCAGCATGCAGTGAACGATTACTATG

[0117] TGGGCCACGTGATGAGTGGTGGCAGCCACGGACACTATGTTGGAGG

[0118] AGAGAGCACAAGGAGTTACACGTGCATTGGTGCACCGGTGGGGCAA

[0119] GGTGGCGGATTCGCTGGTGGTAAGGAGGGGTCTGCAGTGCAGGAGG

[0120] AAGGGTTGAGTACTTGGGGAAGGGGCTATTCAGGTGCACAGGATCG

[0121] TTTGGATCCTCCCTCAGCGATCAATCGGTTTCAAGATGGTTTCTAAAG

[0122] AGATGAGAGATTCTTTGTTTGAGTGGTTTTTGGTTTGTGTTATGTTTC

[0123] TGTTATGTTATGTGGTATCATCATAAAGACACGCAATCCAGAGAGAGA

[0124] GAGAGGTGGTTTTTGGTTTATCTACAGTAACCAGGGACAGCTTTTGA

[0125] GCTCATGGACACGCTCAGCTACTTTGGCTTGGAGTTGTGGGTGGGAT

[0126] TTCTTCTCAACATCGCCTTTTGTATTGGTAGCTAGCTAGCTAGCTTGG

[0127] ACAACCAGTTAGATTTGAACTGAAACTTTCCAAACTCCTTTTCCTTT

[0128] GCATGCCAAATTACAACCATTTTCCTTCTCAGTAATTTGTTCTTTCAAT

[0129] ATCCTTCTATTATATTACACTAGTAACTAGTAAGTAATATCTATCTCTGT

[0130] TACTATTTTATATATACATCCTTCTATTTTATATATGCCTGTTTTTGTGTT

[0131] TAATTTGCTATTCCAAAATCTCTAAAACCCCCCGTCACTCTCGATCGC

[0132] TCTCACTCTCTCTATCCAAACCAAAATTGGGATCTTCTAGTTTCTTGA

[0133] AATGTTTTATGGTCTCACTGTCACACTATGCTAGCACAATTAGGGTAA

[0134] TGACACAGAATTTTTGGAGTCCTCTTGCGAAAAAACCATCTTGCTGA

[0135] ATTAATGCTTCCGGAATAGGATATTCAAACAATCAAATTTGCCAAAAT

[0136] ATCTAATTTCTTCTTAAAGAAAAGCTTTATCCTCCCTCCCTATTTCTAC

[0137] GATATTGTAAATAATTATTTTAAAATGTTAAAATACAGATCGAGATTAT

[0138] TTTTAGCAGCAGACAGTGAATGCAGCTATATTTAATTTGCTTGGTACA

[0139] TACCGAACATAACTACTATCTAAGGAATAAAAACACTCTTGCTGTCA

[0140] GCTCCAAGAGCTTCTACCAAATGCAGCAGCTTAGAGAAATATATACA

[0141] CAGCCATAACTAGCTCATGATCGTTCTTGAAACAGTAAAACACGTGT

[0142] AAATAATGAAATAATGAAACCACATTATTAGCATGATTTTTCTTTTCTT

[0143] TTCTCTTGTTTTCAATACTTTTATTTACCGACTAGTTCTCTCCTCTCTG

[0144] TTGGAAATGGATATATTTTTCTTTGTATATAGGTTGTGCTTCCTTTACG

[0145] CACAGTAAGTGAGGATTTTATTATAAGTAAATTATCCTCATAAAAAATA

[0146] TTTTAAAAAGGTATATTCTGGCTTGGCTTCTACTATTCCTATATATTTTT

[0147] GGTTCGTGTTATATAGTTTAGTTCGTGTTTTCACTCAAGGAGCATTAA

[0148] TTCCTTGACTCAACAAAGGCAAATCTGCTAAACCATTAATAAGTGAT

[0149] GAAATTTATTTTTTCTAGGGATGGTAAAAATGGTTTGTATCGTATGAA

[0150] AAGGAAAGGCGATGATTAGTGACTTAGTGGCAGTGTTTATGGTAGAT

[0151] CCAAATATTCAATGGCAATAGCAACATTGGCTGATGCGGCACGAATT

[0152] CAGTGGCATGGTGATGATGGCAAGTAGTGACATCAGCAATTAAAGAT

[0153] GAAGATGGAAGAAGGTGGTGGTAGTAAATGGCTGCAATAACAATTG

[0154] CTATACAGCAAAAGAATGTACGTAAATAATTTTTTTTAATAGAATACAT

[0155] GTATTCTTTTCATTATATAATTATGCAAGAGTGATAATTATTATGGGCGA

[0156] TATATTTTTTCTTTAAAACAATTATATATAAGTTGATTTACAAGTTTAGG

[0157] AGAAGAATATAATGAGTACTTAGAATTTAATTAGGATTGATTTATGAA

[0158] AAATAGGTGTCTAAATTAGAATTATTTGTCAAGAGTGAAATTTGAATT

[0159] TACATTTTGGCTTGGCTGGTAAAAGTAAAAAAGACACTACAAATTTT

[0160] GAATTTAACTCATTTAGTTTATTATATGACTTAATTGTATTTTAATGTTT

[0161] AATTTCTATTTAAATAATTTTTTATATTATAAATTCAATATATTTAACAA

[0162] ATTCATGTTTGAAGAATAAAGTGAAATAGTGCCACAAGACCTATGGT

[0163] TCAGCATCTTTCTTTTCACTTGATCCATCTCGCTTTAATTAGAGTCATA

[0164] ATATATCTCTTCTGATCTTCTACTGCCTGCGGTACAAGTCAACACATA

[0165] GTTCAATAATTGTCATCTTAATGTTGGTTGACAAGTGAAGCATATATAT

[0166] GTCGAAATAGTTGGACTTATATTTTGCATAAGATCACAGCTTGTGGGA

[0167]

[0168] SEQ ID NO: 4 ln primer amplification sequence F1

[0169] ATGTTGACCTGCAGGCATGCAAGCTTGGCGTCAAACTTTACCGAT

[0170] SEQ ID NO: 5 ln primer amplification sequence R1

[0171] AACAGCTATGACATGATTACGAATTCACTTTTAAGCACACCTGACC

[0172] SEQ ID NO: 6 ln fluorescence quantitative PCR primer F2

[0173] GTGTTTGCCTCACATCATTTTTCC

[0174] SEQ ID NO: 7 ln fluorescence quantitative PCR primer R2

[0175] TTGTGCAGCAATGTTATGATCACA

[0176] SEQ ID NO: 8 reference gene ACTIN fluorescence quantitative PCR primer F3

[0177] CGGTGGTTCTATCTTGGCATC

[0178] SEQ ID NO: 9 reference gene ACTIN fluorescence quantitative PCR primer R3

[0179] GTCTTTCGCTTCAATAACCCTA

[0180] References

[0181] Donald CM(1968)The breeding of crop ideotypes.Euphytica 17:385 - 403.

[0182] Fang C,Li WY,Li GQ,Wang Z,Zhou ZK,Ma YM,Shen YT,Li CC,Wu YS,Zhu BG,etal.(2013)Cloning of Ln gene through combined approach of map - based cloningand

[0183] association study in soybean.J Genet Genomics 40:93-96.

[0184] Jiao YQ,Wang YH,Xue DW,Wang J,Yan MX,Liu GF,Dong GJ,Zeng DL,Lu ZF,ZhuXD,et al.(2010)Regulation of OsSPL14 by OsmiR156 defines ideal plant

[0185] architecture in rice.Nat Genet 42:541-544.

[0186] Li SX,Cong YH,Liu YP,Wang TT,Shuai Q,Chen NN,Gai JY,Li Y(2017).Optimization of Agrobacterium-mediated transformation in soybean.Front PlantSci 8:246.Liu SL,Zhang M,Feng F,Tian ZX(2020)Toward a“green revolution”forsoybean.Mol

[0187] Plant 13:688-697.

[0188] Miura K,Ikeda M,Matsubara A,Song XJ,Ito M,Asano K,Matsuoka M,KitanoH,Ashikari M(2010)OsSPL14 promotes panicle branching and higher grainproductivity in rice.Nat Genet 42:545-549.

[0189] Peng J, Richards DE, Hartley NM, Murphy GP, Devos KM, et al. (1999) ‘Green revolution’ genes encode mutant gibberellin response modulators. Nature 400:256-261. Wang J, Zhou L, Shi H, Chern M, Yu H, Yi H, He M, Yin JJ, Zhu XB, Li Y, et al. (2018) A single transcription factor promotes both yield and immunity in rice. Science 361:1026-1028.

[0190] Zhang XY, Jia HY, Li T, Wu JZ, Nagarajan R, Lei L, Powers C, Kan CC, Hua W, Liu

[0191] Z, et al. (2022) TaCol-B5 modifies spike architecture and enhances grain yield in wheat.

[0192] Science 376:180-183.

[0193] The specific embodiments described above further elaborate on the objectives, technical solutions, and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. An isolated genome sequence regulating the dense plant type of a leguminous plant, preferably a plant of the genus Glycine max, the genus Pisum, or the genus Garbanzo, such as soybean, pea, mung bean, broad bean, black bean, or chickpea, characterized in that: The genome sequence is shown in SEQ ID NO:

3.

2. Use of ln in regulating the dense plant type of leguminous plants, preferably plants of the genus Glycine max, genus Pisum, and genus Garbanzo, such as soybean, pea, mung bean, broad bean, black bean, and chickpea, characterized in that: The coding sequence of ln is shown in SEQ ID NO:

1.

3. The use according to claim 2, characterized in that: The amino acid sequence of ln is shown in SEQ ID NO:

2.

4. The use according to claim 2, characterized in that: The genomic sequence of ln is shown in SEQ ID NO:

3.

5. The use according to any one of claims 2 to 4, characterized in that: The use is manifested as one or more of the following: a. Reduce the number of branches; b. Reduce plant height; c. Reduce the number of sections; d. Shorten internode length; e. Shorten the length of petiole.

6. An expression vector, characterized in that The expression vector comprises the genomic sequence according to claim 1.

7. The expression vector according to claim 6, characterized in that The expression vector has an antibiotic marker and / or a chemical resistance marker.

8. A host cell, characterized in that The host cell comprises the genome sequence according to claim 1 or the expression vector according to claim 6 or 7.

9. A method for regulating the dense plant type of leguminous plants, preferably plants of the genus Glycine max, genus Pisum, and genus Garbanzo, such as soybean, pea, mung bean, broad bean, black bean, and chickpea, characterized in that: The method comprises the step of introducing the expression vector according to claim 6 or 7 or the host cell according to claim 8 into a plant of the Leguminosae family, preferably a plant of the genus Glycine max, the genus Pisum, or the genus Garbanzo, such as soybean, pea, mung bean, broad bean, black bean, or chickpea plant or cell or tissue.

10. The method according to claim 9, characterized in that The dense-tolerant plant type is manifested as one or more of the following: relative to the control or wild-type plants: a. a reduction in the number of branches; b. a reduction in plant height; c. a reduction in the number of nodes; d. a reduction in internode length; e. a reduction in petiole length.

Images