318 results about "Field pea" patented technology

The invention discloses a method for determining influence of exogenous dsRNA on toxicity of ladybugs. The method comprises the following specific steps: uniformly mixing the exogenous dsRNA into a sucrose solution, directly feeding the ladybugs for 2-3 days and then feeding with pea aphids; then detecting and analyzing the expression changes of target genes in the ladybugs, and observing the biological changes of the ladybugs so as to evaluate the toxicity of the exogenous dsRNA to the ladybugs, wherein the ladybugs include harmonia axyridis, coccinella septempunctata or henosepilachna pusillanima. By the method, direct influence of the exogenous dsRNA on the toxicity of the harmonia axyridis, the coccinella septempunctata or the henosepilachna pusillanima or other ladybugs can be effectively determined; in addition, the method is simple, feasible and high in effectiveness and sensitivity, and has a great significance and an application prospect in study on functions of related genesas well as environmental risk assessment on related RNAi transgenic crops.

The invention discloses a protective garlic cultivation method, which includes: preforming no tillage for moisture sides of soil with preceding crop straw clipped, and digging an irrigation and drainage ditch between two moisture sides. Garlic serves as the main crop, broad bean or pea serves as the auxiliary crop, a main crop area is 160cm in breadth, an auxiliary crop area is 40cm in breadth, the two areas are 20cm away from each other, a no-tillage garlic hill-drop planter is used to drill holes for planting garlic, spacing in rows and spacing between rows of garlic are 5cmX5cm, spacing inrows and spacing between rows of the auxiliary crop are 10cmX10cm, organic fertilizer, phosphate fertilizer and nitrogenous fertilizer serve as base fertilizer for the main crop, organic fertilizer and phosphate fertilizer serve as the base fertilizer for the auxiliary crop, the surface of the soil is covered with straws after seeding, and the main crop is topdressed with nitrogenous fertilizer and potash fertilizer. By the method, garlic yield is increased greatly by 15%, microbial activity and organic content of the soil are increased by 15% and 12% respectively, income is increased by 26%,nitrate nitrogen in penetrating water of the soil is reduced by 66%, accumulation of nitrate nitrogen in the soil is reduced by 22%, and loss of total nitrogen is reduced by 77%.

The invention discloses an artificial reproduction technological process and a method of application of aphidoletes aphidimyza. An aphidoletes aphidimyza mass reproduction technology and an application technology are characterized in that pea aphids, pea repaired tail aphids and aphis craccivora koch are reproduced massively by adopting broad beans, and the aphidoletes aphidimyza is reproduced by utilizing the pea aphids, the pea repaired tail aphids and the aphis craccivora koch. The aphidoletes aphidimyza mass reproduction technology and the application technology comprise the following processes: net seedlings are planted, aphids are raised, the aphidoletes aphidimyza is raised, old larvae are collected, and the larvae are saved in the pupal period. Adults are applied to field application and expanding reproduction after eclosion. An efficient and superior method technological process for reproducing aphidoletes aphidimyza is developed so as to solve the to-be-solved problems, and the method that the aphidoletes aphidimyza is used to prevent and control aphids can play a proper role in safe production of vegetables.

The invention provides a ginseng ferment and a preparation process thereof. The ginseng ferment comprises the following components by weight ratio: 8 parts of fresh ginsengs, 38 parts of apples, 16 parts of carrots, 3 parts of rhodiola rosea, 5 parts of burdock, 2 parts of gingers, 2.5 parts of mung bean sprouts, 3 parts of mushrooms, 7 parts of cabbages, 5 parts of pea sprouts, 4 parts of wolfberry fruits, 1 part of kelp, 1.5 parts of alfalfa and 4 parts of cucumbers. The ginseng ferment is scientific and reasonable in formula and capable of remaining the activity and the function of an effective constituent to the maximum extent by using a green preparation process and has the functions of ginseng in greatly restoring vitality, tonifying spleen and lung, nourishing fluid and relieving thirst, smoothing the nerves and benefitting intelligence, resisting fatigue and boosting immunity; the ginseng ferment regulates blood fat and blood sugar due to the exertion of the synergistic effect of the ginseng, the rhodiola rosea, the burdock and the wolfberry fruits, and plays effects of cell activation, digestion promotion and comprehensive detoxification and has good prevention and inhibition functions for cancers so as to be a good irreplaceable food therapy product for patients with radiotherapy and chemotheraphy; and in addition, the ginseng ferment can be used for neutralizing redundant radicals in a human body and has the effects of resisting oxidation as well as maintaining beauty and keeping young so as to be a good health care product.

Disclosed is a method to prepare a myceliated high-protein food product, which includes culturing a fungi an aqueous media which has a high level of plant protein, for example at least 20 g protein per 100 g dry weight with excipients, on a dry weight basis. The plant protein can include pea, rice and / or chickpea. The fungi can include comprises Lentinula spp., Agaricus spp., Pleurotus spp., Boletus spp., or Laetiporus spp. After culturing, the material is harvested by obtaining the myceliated high-protein food product via drying or concentrating. The resultant myceliated high-protein food product may have its taste, flavor, or aroma modulated, such as by increasing desirable flavors or tastes such as meaty, savory, umami, popcorn and / or by decreasing undesirable flavors such as bitterness, astringency or beaniness. Deflavoring and / or deodorizing as compared to non-myceliated control materials can also be observed. Also disclosed are myceliated high-protein food products.

The invention discloses a planting method of intercropping green manure for potatoes. The method includes the following steps that in earlier stage of planting the potatoes on ridges, leguminous green manure is planted in field ditches, the leguminous green manure is longwan 2 needle leaf pea or Turkmen vicia villosa, and after the leguminous green manure is harvested, stubbles are harvested or totally overturned and pressed to serve as green manure. According to the planting method of intercropping the green manure for the potatoes, the yield is increased and fertilizers are saved without affecting the yield of the potatoes.

The invention provides a hydrophilic modified plant fiber cat litter material and a preparation method thereof. The preparation method comprises the following steps of (1) pretreatment, wherein a plant fiber base material is crushed, the crushed plant fiber base material is extruded and puffed, and alkalization treatment is performed by spraying alkali liquor or soaking with the alkali liquor; (2)hydrophilic modification, wherein water, an initiator, acrylic acid and a cross-linking agent are sequentially added into the pretreated plant fiber base material under the conditions of heating andstirring, heating and stirring are continued, and a reaction is performed to obtain a reaction product; and (3) post-treatment, wherein the reaction product is extruded and filtered to remove excessive moisture, and then drying and crushing are performed to obtain hydrophilic modified plant fibers. The selected plant fiber base material is subjected to hydrophilic modification through physical andchemical methods, the water absorption performance of the material is improved, and therefore the novel plant fiber cat litter material with the water absorption performance superior to that of pea dregs and soybean dregs is prepared.

The invention discloses caragana korshinskii dehydrin and gene thereof. The dehydrin consists of 243 amino acid residues, and comprises two Y stricture regions and a K structure region; and compared with the other dehydrin, the dehydrin is abundant in histidine (H) and glycocoll (G). The whole length of the gene of the dehydrin is 1165bp, the dehydrin is a 731bp opened reading frame from 5'end to 106-837 position, and the dehydrin has intense express under the condition that the plant is stressed by the drought and the cold, so that the dehydrin reduces the damage to plant cells, improves the anti-drought and cold-resistant capability, and is the key element of the anti-drought mechanism of the plant. The similarity between the amino acid sequence of the gene of the caragana korshinskii dehydrin and that of the gene of the pea dehydrin is 34%, and the gene of the dehydrin is a new gene. If the plant expression vector of the gene is built, and the anti-drought gene is leaded into various plants, the anti-drought and cold-resistant capability of the plant can be improved.

Disclosed is a composition comprising a combination of: Polygonum fagopyrum seed extract, Chlorella vulgaris extract, palmitoyl wheat protein hydrolysate, algae extract, and tripeptide. The composition may further comprise one or more of the following: Citrus unshiu peel extract, Sphacelaria scoparia extract, Bambusa vulgaris extract, Pisum sativum (pea) extract, Evodia rutaecarpa fruit extract, and dipalmitoylhydroxy proline. Such compositions are useful in methods for aiding in improving skin firmness, lifting the skin, preventing or decreasing skin sagging, and preventing or decreasing visible signs of aging resulting from internal and external causes such as environmental stresses.

The invention relates to an Indel mark InDel111-120 co-separated with a powdery mildew resistance allele er1-7 of peas and application thereof, and belongs to the field of plant pathology and crop disease resistance genetics and breeding. A primer for amplifying the Indel mark has the following nucleotide sequence of InDe1111-120-F:GGAGTTAAGGAACGAACTTTGG, InDel111-120-R:CCATGTCTGCGTCTGTATCTTT; a characteristic strip of the Indel mark which is amplified by the primer and co-separated with the powdery mildew resistance allele erl-7 adopts 183bp, and the nucleotide sequence is shown as Seq ID No.3. The invention further provides a kit for screening a pea genetic resource containing the er1-7 gene on the basis of the Indel mark. By adopting the Indel mark or the kit, the pea resource containing the resistance allete er1-7 can be rapidly and precisely distinguished out, so that the mark or the kit can be effectively applied to molecular assisted selection of the powdery mildew resistance of the peas, high efficiency, precision, convenience and rapidness are achieved, the breeding cycle is greatly shortened, and the breeding process is sped up.

The invention relates to a high throughput bean quarantine plant pathogenic bacteria detection method and a locking type probe. According to the detection method, the locking type probe can perform rolling circle amplification simultaneously on pea bacterial phytophthora and kidney bean dizzy phytophthora and then performs high throughput detection on the two kinds of important bean quarantine plant pathogenic bacteria. The detection method is high in specificity and sensitivity, can shorten the detection time of the bean quarantine plant pathogenic bacteria, quicken the pass speed of cargoes imported and exported in China ports, reduces enterprise costs, meanwhile can improve import bean product epidemic situation intercept rate, increase the capability of preventing foreign pest from invading, has important technicality and practicability and can generate obvious economic and social benefits.

The invention provides seed and plants of the pea line designated 08250838. The invention thus relates to the plants, seeds and tissue cultures of pea line 08250838, and to methods for producing a pea plant produced by crossing a plant of pea line 08250838 with itself or with another pea plant, such as a plant of another line. The invention further relates to seeds and plants produced by such crossing. The invention further relates to parts of a plant of pea line 08250838, including the seed, pod, and gametes of such plants.

The invention discloses an EST-SSR marker primer combination, which includes 12 pairs of EST-SSR available primers. A screening method of the EST-SSR marker primer combination comprises the steps of SSR locus screening in an EST sequence obtained through sequencing of a transcriptome of pea, primer design, PCR amplification, capillary electrophoresis detection to a product and marker screening. The EST-SSR marker primer combination is applied in germplasm genetic diversity analysis of dwarf type and sprawl type of peas. The EST-SSR marker primer combination can be used for quickly and accurately distinguishing different germplasm materials of peas and analyzing the genetic relationship, thereby providing a basis of oriented seed breeding of the varieties.

A ryegrass and legume mixing sowing method includes (1), cleaning ground sundries before sowing, turning up the soil and applying base fertilizers after leveling the soil; (2), sowing the ryegrass and the legume in a mixing manner; (3), planting and cutting; (4), cutting the ryegrass first in the early stage of the growing period; and (5), reserving stubbles with height of 50cm after cutting peas in production so as to guarantee regeneration conditions of the peas. Problems of fresh grass underproduction in withered grass periods in animal husbandry or nutritive value unbalance of single-sowing of the ryegrass can be well solved by utilizing southern winter vacant fields.

The invention belongs to the field of traditional Chinese medicines and healthcare foods, and particularly relates to a ganoderma lucidum anti-alcohol composition and ointment and a preparation method and application thereof. The composition consists of ganoderma lucidum, flos puerariae, hericium erinaceus, folium llicis latifoliae, phyllanthus emblica, fructus citri sarcodactylis, radix puerariae, poria cocos, endothelium corneum gigeriae galli, fructus crataegi, fructus hordei germinatus, semen raphani, hovenia dulcis thunb, rhizoma imperatae, lophatherum gracile, herba taraxaci, folium mori, liquorice and stevia rebaudian. The invention also provides a ganoderma lucidum anti-alcohol ointment which is prepared by adopting the following steps: adding water into the active ingredients according to a conventional method and decocting; combining the water decoction and concentrating to obtain final extraction liquid; adding 1 / 4 of the extraction liquid into pea starch, and uniformly stirring; adding the remaining 3 / 4 extraction liquid into honey, boiling and stirring uniformly; uniformly mixing the liquids obtained twice; pouring the mixture into a mould and cooling and forming; and slicing and drying. The ointment can be directly chewed or repeatedly brewed with hot boiled water, and realizes the effects of invigorating spleen to promote digestion and dispelling the effects of alcohol to protect liver.

The invention discloses a pea and tobacco intercropping method. According to the method, based on the technical background of tobacco monoculture in the southwestern tobacco-growing area, pea seeds are sown on two sides of a tobacco ridge after laminas on the lower middle portion of tobacco are harvested or after harvest is completed, and a plastic net is hung on a tobacco stem as the climbing support of a pea, and then pea and tobacco intercropping is achieved. The pea and tobacco intercropping method has the advantages that the multiple crop index of land is improved; fertilization is not needed for pea planting, a large quantity of nitrogenous fertilizer and potash fertilizer left in tobacco land can be utilized, and the economical benefit of tobacco farmers is increased by 1000-1200 yuan / mu; the tobacco stem is used as the climbing carrier of the pea, and cost of 200-400 yuan / mu for building a support for the pea is saved; and due to the fact that the height of the tobacco stem can not meet climbing requirements of the pea, the plastic net is laid on the top of the tobacco stem by the applier to enable the pea to continue to climb after reaching to the top of the tobacco stem, and technical prejudice of technicians in the field is overcome.

The invention discloses a pea seedling cultivation technology which includes site and framework selection, site and framework disinfection, seedling-raising disk disinfection, seed selection, seed soaking, seeding and management. Site and framework selection includes selecting a greenhouse or idle house with fine ventilation and light transmission performances, and selecting a multi-storey three-dimensional framework. Site and framework disinfection includes disinfecting the site and the framework once to twice with environment-friendly disinfectants every month. Seedling-raising disk disinfection includes firstly cleaning impurities in a disk, soaking the disk in the disinfectants for two hours and then drying the disk when using the seedling-raising disk once. Seed selection includes preferably selecting green peas or spotted colored peas. Seed soaking includes soaking seeds for 10-16 hours in summer, and soaking the seeds in warm water at the temperature of 65 DEG C for 20-24 hours in winter. Seeding includes sowing 300-350 grams of dry seeds in each disk, padding a moisturizing disk and spraying clear water once to twice every day. Management includes managing the temperature, illumination, humidity and watering.

The invention provides a bacteriostatic and deodorant cat litter, which comprises the following materials in parts by weight: 15 to 30 percent of pea fiber, 10 to 20 percent of soybean fiber, 10 to 25percent of corn starch, 10 to 20 percent of sweet potato residue, 2 to 6 percent of tea residue, 5 to 10 percent of corn straw powder, 1 to 5 percent of an adhesive, 1 to 3 percent of a decomposing agent and 2 to 8 percent of a bacteriostatic deodorant. The bacteriostatic and deodorant cat litter prepared by the invention mainly adopts plant raw material, is low in cost and wide in source, addedsodium diacetate, ferrous sulfate, zinc acetate and urease inhibitor can obviously improve the deodorization performance of the cat litter and improve the living environment of cat farmers, the process is simple, the requirement on equipment is low, and the cat litter can be industrially produced.

A process for extracting and separating the active polypeptide from pea includes such steps as preparing coarse pea protein, separating by chromatography with ion exchange resin, and purifying by reverse-phase HPLC chromatography. Its amino acid sequence is also disclosed.

The invention discloses a microelement culture solution and a method for increasing microelements of pea sprouts with the same. The microelement culture solution is a solution containing one or more of 0.3-0.6 mg / L of zinc sulfate, 300-500 mg / L of organic selenium and 200-400 mg / L of germanium dioxide. The method for increasing the microelements of the pea sprouts comprises steps as follows: firstly, pea seeds are soaked in the microelement culture solution and then cultured, and the microelement culture solution is sprayed once every 12-24 h during culture. Compared with the prior art, the microelement culture solution and the method have the advantages as follows: the microelements of the cultured pea sprouts are high in enrichment degree, the microelement culture solution can also promote growth of the pea sprouts, production is not limited by seasons, the production cycle is short, the cost is low, the benefit is high, and the pea sprouts are natural and pollution-free.

The invention discloses a coconut-fragrance five-bean puffed flour. The flour is prepared from the following raw materials by weight: 80 to 100 parts of oat kernel, 20 to 30 parts of soybean, 10 to 15 parts of red bean, 15 to 20 parts of mung bean, 10 to 15 parts of black soya bean, 8 to 12 parts of pea, 20 to 30 parts of white gourd, 5 to 8 parts of honey, 2 to 3 parts of balloonflower root, 2 to 3 parts of fragrant solomonseal rhizome, 1 to 2 parts of mango stone, 2 to 3 parts of tree peony bark, 3 to 5 parts of dwarf lilyturf tuber, 1 to 2 parts of Tupidanthus calyptratus, 1 to 2 parts of China rose, 1 to 2 parts of root of Chinese Hibiscus, 2 to 4 parts of a nutrition additive and a proper amount of coconut milk. According to the invention, the oat kernel and the five beans are soaked in the coconut milk and then puffed, so the flour is more puffy and can be easily digested and adsorbed; the white gourd processed with honey is subjected to freeze drying, so nutritional ingredients in the white gourd are utmostly retained; the finished flour has the health care effects of spleen strengthening, vital qi benefiting, heat clearing, detoxifying, urination promotion, detumescence, phlegm elimination, pus expelling, skin moistening, beauty fostering, etc.

The invention provides a method of four-season crop rotation of rice, broad bean and pea, in particular to two-season rice, one-season broad bean and one-season pea, totally four-season crop rotation; in the two-season rice, the first-season rice is a nascent rice and the second-season rice is a retooning rice; and the broad bean and the pea adopt an interplanting way to be planted after the retooning rice is harvested. The invention leads the land resources to be furthest utilized, not only is the rice yield increased by one season, but also the selected variety of the broad bean and the pea has high yield and good benefits and the two have good complementarity, thus not only saving fertilizer, pesticide, labor and lands, and simultaneously being capable of playing the role of preventing frozen injury caused by frost season of winter solstice.

The invention discloses a bean vermicelli processing method, which is formed by that plant starch is subjected to dough kneading, curing by extrusion, aging, freeing and unfreezing to obtain powder; during dough kneading, sodium polyacrylate accounting for 0.1-0.2wt% of the plant starch is added into the plant starch; and the plant starch comprises one or several of sweet potato, potato, rice, corn, pea, broad bean, kudzuvine root and fern root starch. According to the bean vermicelli processing method disclosed by the invention, sodium polyacrylate is used for replacing white alum, the original function of the white alum is kept, the toughness of a product is further improved, and the broken bar rate is reduced by more than 20% if being compared with the situation that the white alum is used. The bean vermicelli prepared with the bean vermicelli processing method has the advantages of no brittle bar, attractive appearance and no toxic and side effects.

The invention discloses a high-protein cattle forage and a preparation method thereof. The high-protein cattle forage is composed of the following raw materials, by weight, 50-60 parts of rice straw, 20-30 parts of Paspalum natatu, 20-25 parts of soybean leaf, 15-25 parts of pea skin, 10-15 parts of flour, 5-10 parts of sunflower receptacle, 10-20 parts of vinasse, 1-2 parts of a starter, 40-50 parts of corn flour, 25-35 parts of soybean meal, 15-20 parts of wheat bran, 5-8 parts of a soft sweet additive, 3-5 parts of rice bran, 5-8 parts of zeolite, 4-6 parts of pumpkin seed oil, 2-4 parts of sodium alginate, 2-3 parts of calcium hydrogen phosphate, 1-2 parts of ammonium bicarbonate and 0.3-0.5 parts of salt. The forage contains all nutrition required by the growth of cattle, guarantees the healthy production of the cattle, provides healthcare values, and raises the growth speed of the cattle.

Belonging to the field of agriculture, the invention discloses an egg-laying breeding pigeon forage. The forage is prepared from an unprocessed grain material and a granular material in a weight ratio of 100:45-55. The unprocessed grain material comprises, by weight, 40-45 parts of corn, 20-25 parts of pea, 10-15 parts of wheat, 10-15 parts of sorghum, 4-8 parts of hemp seed, and 4-8 parts of Zanthoxylum seed. The granular material comprises, by weight, 55-65 parts of corn, 10-15 parts of wheat, 20-25 parts of puffed soybean meal, 1.5-3 parts of hemp seed, and 2-6 parts of a core material. The compound forage provided by the invention can fully guarantee the nutrient requirements of egg-laying breeding pigeons in the growth process.

The invention provides a Baijiu brewing formula and a Baijiu brewing process. In the Baijiu brewing formula, the following components in parts by weight are included: 30-50 parts of sorghum, 10-20 parts of rice, 5-15 parts of sticky rice, 5-15 parts of wheats, 5-15 parts of mung beans, 5-15 parts of oats and 1-10 parts of peas. The brewing process comprises the following steps: preparing the raw materials according to the formula; crushing, mixing and steam-cooking the raw materials; carrying out diastatic fermentation on the steam-cooked raw materials; distilling fermented grains to obtain the Baijiu. The brewing process is simple, short in brewing time, easy to control in various brewing parameters and strong in operability. The brewed Baijiu is outstanding in sauce flavor, good in sensory index, mellow and soft in taste, and does not cause stomach hurt, headache and drunkenness.

The invention provides a molecular marker subjected to co-segregation with a pea powdery mildew resistance allele er1-6. The molecular marker is located on a VI linkage group of a pea genetic map, and the genetic distance between the molecular marker and the allele er1-6 is 0cM. According to the single base difference (at the position of 1121, T-C) between a disease-resistant variety G0001778 containing the resistance allele er1-6 and an er1 candidate gene PsMLO1cDNA sequence of infected variety pea number 6, primers are designed on the two sides of an SNP mutation site, a high resolution melting curve analysis technology is used for developing the molecular marker subjected to co-segregation with the pea powdery mildew resistance allele er1-6, the marker is subjected to group detection of F2 and F3 which are derived by the disease-resistant variety G0001778 and the infected variety pea number 6 in a hybridization mode, and it is verified that the marker is a co-dominance functional marker subjected to co-segregation with the gene er1-6. Afterwards, the effectiveness is verified in pea powdery mildew resistance resource identification through the marker, the functional marker can be used for molecular marker-assisted selection breeding of the pea powdery mildew resistance, and therefore the breeding process is accelerated.

The invention provides pea cold resistance correlated SSR primer compositions and application thereof and belongs to the technical field of crop molecule assisted breeding. 35 pairs of SSR primer compositions correlated with pea cold resistance are provided, nucleotide sequences of the SSR primer compositions are respectively shown as SEQ ID NO.70, cold-resistant or non-cold-resistant peas are identified by utilizing a PCR amplification technique and non-denaturing polyacrylamide gel electrophoresis, the pea cold resistance characteristic identification work can be completed within short time, and the pea cold resistance correlated SSR primer compositions have the advantages of being efficient, accurate and convenient to operate, making identification results not prone to environment and season influence and the like. The method discloses the heritable variation and genetic relationship of cold-resistant or non-cold-resistant pea varieties at DNA level, a technical support is provided for reasonable utilization of excellent varieties in the pea variety breeding process, the pea cold resistance correlated SSR primer compositions can be applied to cold resistance identification and molecular assisted breeding of pea genetic resources or varieties in the agricultural field and have a good application prospect.