Application of tinib compound in preparation of medicine for treating bovine nodular dermatosis and medicinal preparation

Abstract

The invention discloses application of a tinib compound in preparation of a medicine for treating bovine nodular dermatosis and a medicine preparation, and experiments prove that the tinib compound can inhibit viral proliferation of the bovine nodular dermatosis, so that the effect of treating or preventing the bovine nodular dermatosis is achieved. Based on the new properties of the tinib compound, the new application of the tinib compound in preparation of the medicine for treating the bovine nodular dermatosis is determined, the internal principle of the tinib compound participating in bovine nodular dermatosis treatment is disclosed, the clinical indications of the tinib compound are expanded, the effect is remarkable, and the tinib compound has a good popularization prospect.

Description

Technical Field

[0001] The invention relates to application of tinib compounds in preparing drugs for bovine nodular dermatosis and a drug preparation, belonging to the technical field of drug application. Background Art

[0002] Lumpy skin disease (LSD) is a subacute to acute infectious disease caused by the lumpy skin disease virus (LSDV), characterized by nodular lesions on the skin of cattle. LSDV belongs to the Poxviridae family, Goatpoxvirus genus. The mortality rate of cattle infected with LSDV is about 10%, and the morbidity rate is about 90%. Infected cattle show symptoms such as fever, weight loss, decreased milk production, and nodules all over the body, which seriously restricts the economic benefits brought by cattle breeding. Existing technologies mainly use strategies and measures that combine emergency immunization with attenuated vaccines and isolation and culling to prevent and control LSD. [9] . Currently, immunizing cattle with attenuated vaccines is the main method to prevent the disease; however, clinical results show that attenuated vaccines have certain side effects, and more and more studies have shown that the use of live attenuated vaccines carries the risk of strain recombination. There is currently no effective drug for the treatment of LSDV. In the case of vaccine immunity defects, there is an urgent need to develop drugs that effectively prevent or treat LSD as a technical reserve. Summary of the invention

[0003] The technical problem to be solved by the present invention is to overcome the defects of the prior art, disclose the application of tinib compounds in the preparation of drugs for bovine nodular dermatosis and pharmaceutical preparations, and effectively inhibit the activity of LSDV.

[0004] To solve the above technical problems, the present invention provides an application of a tinib compound in the preparation of a drug for bovine nodular dermatitis, wherein the tinib compound is any one or more of canertinib, gefitinib, afatinib, lapatinib and erlotinib.

[0005] Furthermore, the drug is a drug whose pharmacological action is to inhibit the proliferation of bovine nodular dermatitis virus.

[0006] Furthermore, the concentration range of the drug is 45.7 nM-100 μM.

[0007] Furthermore, the medicine is an oral, injectable or smearable preparation.

[0008] Furthermore, the drug is used for the treatment or prevention of bovine nodular dermatosis.

[0009] In a second aspect, the present invention further provides a pharmaceutical preparation comprising the above-mentioned tyrosine kinase compound and other pharmaceutically acceptable excipients.

[0010] In combination with the second aspect, further, the auxiliary materials include any one or more of diluents, fillers, adhesives, wetting agents, surfactants, lubricants, stabilizers, and absorption enhancers.

[0011] Furthermore, the pharmaceutical preparation is in the form of an injection, a lyophilized powder injection, a tablet, a granule or a gel.

[0012] The beneficial effects achieved by the present invention are: The present invention clarifies through experimental means that tinib compounds inhibit LSDV proliferation, provides the use of tinib compounds in the preparation of bovine nodular dermatitis drugs, which are used for the prevention or treatment of LSDV, and effectively avoids the side effects of attenuated vaccination and the risk of strain recombination. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The activity curve and cytotoxicity curve of canertinib in inhibiting LSDV proliferation provided by the embodiment of the present invention; Figure 2 Fluorescence images of different concentrations of canertinib inhibiting the proliferation of rLSDV in MDBK provided by the embodiment of the present invention; Figure 3 Fluorescence images of different concentrations of canertinib inhibiting the proliferation of rLSDV in Vero provided by the embodiment of the present invention; Figure 4 The activity curve and cytotoxicity curve of afatinib in inhibiting LSDV proliferation provided by the embodiment of the present invention; Figure 5 The activity curve and cytotoxicity curve of gefitinib inhibiting LSDV proliferation provided by the embodiment of the present invention; Figure 6 The activity curve and cytotoxicity curve of erlotinib in inhibiting LSDV proliferation provided by the embodiment of the present invention; Figure 7 The activity curve and cytotoxicity curve of lapatinib in inhibiting LSDV proliferation provided by the embodiment of the present invention; Figure 8 Fluorescence images of the inhibition of rLSDV proliferation in MDBK by several tinib compounds of different concentrations provided in the embodiments of the present invention; Fig. 9 When the canertinib provided in the embodiment of the present invention is used at a concentration of 1 μM, the TCID 50 Detection of the inhibitory effect of canertinib on LSDV; Fig.10This is a graph showing the inhibitory effect of canertinib on LSDV detected by qPCR when the canertinib provided in the embodiment of the present invention is used at a concentration of 1 μM; Fig.11 A diagram showing the inhibitory effect of canertinib on LSDV at different MOIs when the concentration is 1 μM as detected by Western blot in an embodiment of the present invention; Fig.12 A diagram of a Time of addition experiment design model provided in an embodiment of the present invention; Fig.13 The fluorescence effect diagram of the inhibition of rLSDV at different stages by canertinib labeled with mCherry provided in the embodiment of the present invention; Fig.14 A diagram showing the inhibitory effect of canertinib on rLSDV at different stages by Luciferase analysis provided in an embodiment of the present invention; Fig.15 A diagram showing the inhibitory effect of canertinib on rLSDVDNA synthesis by labeling newly synthesized viral DNA with EdU provided in an embodiment of the present invention; Fig.16 This is a diagram showing the inhibitory effect of canertinib on rLSDV RNA synthesis analyzed by EU-labeling of newly synthesized viral RNA provided in an embodiment of the present invention. DETAILED DESCRIPTION

[0014] The present invention is further described below in conjunction with the embodiments and the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and cannot be used to limit the protection scope of the present invention.

[0015] The present invention provides the use of tinib compounds in the preparation of drugs for bovine nodular dermatosis, and specifically relates to the use of canertinib, afatinib, lapatinib and erlotinib in the preparation of drugs for preventing or treating LSD, providing a new antiviral drug for the prevention and treatment of LSD.

[0016] Canertinib, afatinib, lapatinib and erlotinib are a class of monomeric compounds. The chemical formula of canertinib is C24H25ClFN5O3, and the CAS number is 267243-28-7; the chemical formula of afatinib is C24H25ClFN5O3, and the CAS number is 850140-72-6; the chemical formula of gefitinib is C22H24ClFN4O3, and the CAS number is 184475-35-2; the chemical formula of lapatinib is C29H26ClFN4O4S, and the CAS number is 231277-92-2; the chemical formula of erlotinib is C22H23N3O4, and the CAS number is 183321-74-6; and the chemical structural formulas of the above five compounds are as follows:

[0017] The experimental materials used in the present invention include: Canertinib, gefitinib, afatinib, lapatinib, and erlotinib were purchased from MCE. RIPA protein lysis buffer was purchased from Yuanye. DNA extraction kit, CCK-8 kit, reverse transcription reagent, and SYBR Green Master Mix were purchased from YEASEN. β-Tublin mouse monoclonal antibody, HRP-labeled goat anti-rabbit secondary antibody, and HRP-labeled goat anti-mouse secondary antibody were purchased from Yase. Trypsin was purchased from Solebao. MDBK, Vero cell line, fetal bovine serum, and DMEM were purchased from Nanjing Senbeijia. Lipofectamine 3000 transfection reagent and Alexa Fluor™ 594-labeled goat anti-rabbit secondary antibody were purchased from Thermo Fisher Scientific. BeyoClick™ EdU-488 cell proliferation detection kit and BeyoClick™ EU-488 RNA synthesis detection kit were purchased from Beyotime, and Freund's complete adjuvant and Freund's incomplete adjuvant were purchased from Merck.

[0018] The LSDV rabbit polyclonal antibody used in the experiment was prepared and stored by our laboratory. The preparation method is as follows: LSDV virus was mixed with Freund's complete adjuvant in a ratio of 1:1 and emulsified as an immunogen. 6.2 TCID 50 New Zealand white rabbits were immunized by subcutaneous injection at multiple points; subsequently, the same dose of Freund's incomplete adjuvant was used for booster immunization once every 14 days, for a total of 3 immunizations; 14 days after the third immunization, serum was collected and stored at -20℃.

[0019] The LSDV XJ201901 strain was isolated, identified and preserved by the Chinese Center for Animal Health and Epidemiology, and its NCBI GeneBank accession number is OM984485. The specific preparation method of the recombinant rLSDV strain with mCherry and Luciferase expression cassettes is as follows: ORF50 and ORF51 of LSDV are two adjacent proteins. This region was used as the insertion site for the red fluorescent protein (mCherry) and the firefly luciferase reporter gene (Luciferase) to construct a donor plasmid carrying mCherry and Luciferase. When constructing the recombinant virus, the MDBK cell line was infected with the LSDV XJ201901 strain, and the donor plasmid was transfected into the MDBK cell line 6 hours later. At this time, the viral DNA would be recombined by the homologous recombinase in the cell according to the homologous sequence of the donor plasmid, thereby recombining the DNA fragments corresponding to the donor plasmid into the ORF50 and ORF51 gene positions of the viral genome. Then, the recombinant strain emitting red fluorescence was purified through three consecutive rounds of plaque assays, and finally the rLSDV strain expressing both mCherry and Luciferase was obtained for subsequent experiments.

[0020] Embodiment 1: In order to evaluate the cytotoxicity of drugs in vitro, this example treated MDBK and Vero cells with different concentrations of drugs, measured the activity of cells by CCK-8, and drew the cytotoxicity curve of the drugs. The specific process includes: 2 × 10 4 MDBK or Vero cell suspension (100 μL / well). Place the culture plate in an incubator for 24 h (37°C, 5% CO 2 The drug was diluted 3-fold in a gradient manner using the cell maintenance medium, and 8 dilutions were made (the maximum drug concentration was 100 μΜ). The cells were treated with the diluted drug solutions of various concentrations for 72 h, and an equal volume DMSO control group was set up for each concentration.

[0021] Add 10 μL of CCK-8 solution to each well, avoiding the formation of bubbles. Incubate the culture plate in the incubator for 2 h. Measure the absorbance at 450 nm using a microplate reader. Calculate cell activity according to the following formula: Among them, cell viability = [OD (drug group) - OD (blank group)] / [OD (control group) - OD (blank group)] × 100%.

[0022] Experimental groups: OD values ​​of wells with cells, CCK-8 solution, and drug solution.

[0023] Blank group: OD value of wells with maintenance medium and CCK-8 solution but no cells.

[0024] Control group: OD values ​​of wells having cells, CCK-8 solution and DMSO solution.

[0025] Finally, GraphPad was used to plot the CC of the drugs 50 Curve. Figure 1 As shown in Figure a, the activity curve and cytotoxicity curve of canertinib in inhibiting LSDV proliferation in MDBK cell line, CC of canertinib in MDBK cell line 50 is 11.75 μM; Figure b is the activity curve and cytotoxicity curve of canertinib in inhibiting LSDV proliferation in Vero cell line. 50 is 27.65 μM.

[0026] Similarly, this example also determined the CC of gefitinib, afatinib, lapatinib and erlotinib on the MDBK cell line according to the above process. 50 ,like Figure 4-Figure 7 As shown, the CC of gefitinib on MDBK cell line 50 The CC of afatinib in MDBK cell line was 15.39 μM. 50 The CC of lapatinib in MDBK cell line was 20.12 μM. 50 The CC of erlotinib in MDBK cell line was 29.5 μM. 50 Greater than 100 μM.

[0027] The experiment confirmed that the drug concentration range of this example for inhibiting the proliferation of bovine nodular dermatitis virus is 45.7 nM-100 μM.

[0028] Embodiment 2: In order to evaluate the antiviral activity of the drug in vitro, in this example, during the process of rLSDV infection of MDBK and Vero cells, the cells were treated with different concentrations of the drug, and the distribution of the virus in the cells was marked by the mCherry protein expressed by the virus. The steps are as follows: 2 × 10 4 MDBK or Vero cell suspension (100 μL / well). Place the culture plate in an incubator for 20 h. Use cell maintenance medium to make a 3-fold gradient dilution of the drug to obtain a drug dilution solution, with a total of 8 dilutions (the maximum drug concentration is 100 μΜ).

[0029] Take 30 μL of drug dilution and add a multiplicity of infection (MOI) of 0.01 (200 TCID 50 , MOI = TCID at the time of exposure 50The rLSDV virus solution (volume / cell number) was added to obtain a mixed solution of drug and virus. Then the cell culture medium was discarded, 30 μL of the mixed solution of drug and virus after incubation was added and incubated at 37°C for 2 h, and then the mixed solution of drug and virus was discarded, carefully washed once with PBS, 200 μL of drug dilution was added to the wells, and the cells were cultured for another 72 h.

[0030] At the same time, an equal volume DMSO control group and an untreated blank group were set up, and the luminescence of the cells was recorded under a fluorescence microscope.

[0031] like Figure 2 , 3 As shown, they are fluorescence images of different concentrations of canertinib provided in this example inhibiting the proliferation of rLSDV in MDBK and Vero. It can be seen that the effect of canertinib in inhibiting the proliferation of rLSDV in MDBK and Vero is dose-dependent with the concentration of canertinib used. The effects of gefitinib, afatinib, lapatinib and erlotinib in inhibiting the proliferation of rLSDV in the MDBK cell line are dose-dependent with the concentration used.

[0032] Then, aspirate the cell culture medium, add 100 μL of cell lysis solution to each well, incubate on ice for 5 min, and fully lyse the cells. Take 20 μL of lysis solution and add it to the black ELISA plate. Dilute the firefly luciferase substrate (50×) and the sea renilla luciferase substrate (50×) to 1× working solution with the corresponding buffer. And incubate to room temperature. Add 100 μL of firefly luciferase reaction solution to each well, shake the plate to mix, and immediately detect the activity of firefly luciferase (completed within 30 min). Calculate the data according to the following formula: Inhibition rate = 1-(experimental group value / control group value) × 100%.

[0033] Among them, blank group: cells from the same batch as the experimental group, without any drug or virus treatment; Experimental group: cells were treated with a mixed solution of drug and virus; Control group: cells were treated with a mixed solution of DMSO and virus.

[0034] The experimental group value = experimental group reading value - blank group reading value; the control group value = control group reading value - blank group reading value. Finally, use GraphPad to draw the IC value of the drug 50 Curve. Figure 1 Shown: IC of canertinib in MDBK cell line 50 The IC of canertinib in Vero cell line is less than 0.05 μM. 50Less than 0.05 μM. Similarly, in this example, the IC of gefitinib, afatinib, lapatinib, and erlotinib on the MDBK cell line was also measured according to the above process. 50 , such as Figure 4-Figure 7 shown, the IC of gefitinib, afatinib, lapatinib, and erlotinib on the MDBK cell line 50 was all less than 0.05 μM.

[0035] As shown in Table 3, it is a compound selectivity index table. The compound selectivity index (SI) is an important indicator for evaluating drug efficacy and safety, defined as the ratio of the CC of the drug 50 to the IC 50 , that is, SI = CC 50 / IC 50 . The selectivity indexes of canertinib in the MDBK and Vero cell lines were both greater than 100; the selectivity indexes of gefitinib, afatinib, lapatinib, and erlotinib in the MDBK cell line were all greater than 100; indicating that canertinib, gefitinib, afatinib, lapatinib, and erlotinib have a large safety margin in inhibiting LSDV proliferation.

[0036]

[0037] Example 3: To evaluate the antiviral activity of the drug in vitro, in this example, MDBK and Vero cells were infected with 0.01 MOI and 0.1 MOI of LSDV, and the cells were treated with 1 μM of the drug. Whole cell lysates were collected at 72 hpi for Western blot.

[0038] The specific process is as follows: Inoculate 1×10 5 MDBK or Vero cell suspension (500 μL / well) in a 24-well plate. Place the culture plate in an incubator and culture for 20 h. Then discard the cell culture medium, and add 200 μL of maintenance fluid containing 0.01 MOI (1000 TCID 50 ) and 0.1 MOI (10000 TCID 50 ) of LSDV and the drug, and incubate at 37°C for 2 h. Then discard all the liquid, carefully wash once with PBS, add 1000 μL of maintenance fluid containing 1 μM of the drug to the wells, and continue to culture the cells for 72 h.

[0039] Discard the cell culture medium in the culture dish, wash the cells twice with pre-cooled 1× PBS, add RIPA lysis buffer and lyse the cells on ice for 10 min, transfer the lysed mixture to a 1.5 mL EP tube and centrifuge at 12000 g at 4°C for 10 min, take 80 μL of supernatant, add 20 μL 5× Loading Buffer, mix well and heat at 95°C for 5 min, and then centrifuge for instantaneous detection.

[0040] Add an equal volume of the sample to be tested to the PAGE gel and perform SDS-PAGE electrophoresis at a constant voltage of 80 V. When bromophenol blue moves to the bottom of the gel, use a semi-dry transfer instrument for transfer and soak the transfer filter paper with pre-cooled transfer buffer. Place the filter paper, NC membrane, gel and filter paper in order from bottom to top, and pay attention to remove bubbles. The program is: constant current 0.3 A, limit voltage 25 V, time 33 min. After the end, block with TBST containing 5% skim milk at room temperature for 2 h. After the blocking, wash with TBST at room temperature for 3 times, 5 min each time, add the corresponding primary antibody and incubate at 4℃ for 12 h, wash with TBST 3 times, 5 min each time, add the corresponding HRP-labeled secondary antibody and incubate at room temperature for 1 h. Wash with TBST 3 times, 5 min each time, and finally treat with ECL luminescent liquid and expose in the exposure instrument.

[0041] Fig.11 The present invention provides a graph of the inhibitory effect of canertinib on LSDV at different MOIs detected by Western blot at a concentration of 1 μM, wherein Figure c is a graph of the inhibitory effect of canertinib (1 μM) on LSDV at different MOIs in the MDBK cell line; Figure d is a graph of the inhibitory effect of canertinib (1 μM) on LSDV at different MOIs in the Vero cell line; these results indicate that 1 μM canertinib has a good inhibitory effect on LSDV at different MOIs.

[0042] Embodiment 4: In order to evaluate the antiviral activity of the drug in vitro, in this example, during the process of wild-type LSDV infection of MDBK and Vero cells, the cells were treated with 1 μM canertinib. The inhibitory effect of the drug on LSDV was evaluated by detecting the relative content of the LSDV gene in the cell samples. The specific process is as follows: Sample preparation: 1 × 10 5 MDBK cell suspension (500 μL / well). The culture plate was placed in an incubator for 20 h. The cell culture medium was then discarded and 200 μL of 0.01 MOI (1000 TCID 50) LSDV and drug maintenance solution were incubated at 37°C for 2 h, then the liquid was discarded, carefully washed once with PBS, 1000 μL of maintenance solution containing 1 μM canertinib was added to the wells, and the cells were cultured for another 72 h.

[0043] DNA extraction: Add 10 µL of Proteinase K to 400 µL of lysis buffer LB and mix well to obtain DNA lysis buffer. Discard the supernatant of the cell culture medium and wash twice with PBS. Discard all PBS and add 410 µL of DNA lysis buffer. Let stand for 30 s, pipette repeatedly 20 times, and transfer the cell lysate to a 1.5 mL EP tube. Place in a 55℃ warm bath for 10 min, shake and mix well, and place at room temperature for 5 min. Take out the EP tube and cool to room temperature, then shake and mix gently. Add 300 µL of protein removal solution PL and 300 µL of binding solution BD in turn, shake well. Centrifuge at 12,000 rpm for 5 min. The solution is separated into layers, the upper layer is the blue extraction layer, and the lower layer is the transparent aqueous phase. There may be a partial precipitation layer between the two layers of solution, and the DNA is in the lower aqueous phase. Carefully aspirate the lower layer solution for column purification. Place DNA adsorption column T1 in a 2 mL collection tube, add 200 μL buffer AC to DNA adsorption column T1, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid. Add the lower layer solution of the above sample pretreatment to DNA adsorption column T1, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid. Put DNA adsorption column T1 back into the collection tube, add 500 μL rinse solution W (add anhydrous ethanol according to the instructions before use), centrifuge at 12,000 rpm for 30 s, and discard the waste liquid. Repeat the washing with rinse solution W. Put DNA adsorption column T1 back into the collection tube, centrifuge the empty column at 12,000 rpm at room temperature for 2 min to remove the residual rinse solution W. Put DNA adsorption column T1 into a new 1.5 mL centrifuge tube, add 25 μL of 65℃ preheated elution solution in the center of the adsorption column, and let it stand at room temperature for 2 min. Then centrifuge at 12,000 rpm for 1 min. Collect the filtrate. Add 25 µL of new elution buffer preheated at 65°C and repeat the elution once to obtain a total of about 50 µL DNA solution.

[0044] After the concentration and quality of the DNA solution were determined using Nano drop, it was stored at -20°C for future use. The primer sequences F: AGGGTGATGGGAAGGGTGTT, R: ACTTGCCCGTATCCATCCAC were designed for LSDVORF72, and the qPCR reaction system was prepared according to the dosage in Table 1. The reaction procedure shown in Table 2 was used to detect the gene abundance of the sample.

[0045]

[0046]

[0047] like Fig.10 As shown, after the MDBK cell line was treated with canertinib, the relative expression level of the viral ORF72 gene in the cells was significantly reduced.

[0048] Embodiment five:

[0049] In order to evaluate the antiviral activity of the drug in vitro, in this example, cells were treated with canertinib during the infection of MDBK cells with wild-type LSDV XJ201901.

[0050] By detecting the TCID of LSDV in cell samples 50 The content of LSDV was evaluated by the drug. Specifically, Sample preparation: the same as qPCR in Example 4.

[0051] TCID 50 Assay: 2 × 10 cells / well were seeded in a 96-well plate using growth medium. 4 MDBK cell suspension (100 μL / well). The culture plate was placed in an incubator for 24 h (37°C, 5% CO 2 The virus solution was diluted 10-fold with maintenance medium (DMEM containing 2% FBS), and 8 duplicate wells were made for each gradient. 100 μL of the diluted virus solution was added to the wells to maintain the cultured cells for 5 days. Finally, the number of diseased wells was observed and counted under a microscope, and the TCID of the virus solution was calculated according to the Reed-Muench method. 50 .

[0052] like Fig. 9 As shown, the TCID of the virus in the MDBK cell line after canertinib treatment 50 The content was significantly reduced.

[0053] Embodiment six: The process of virus infection of host cells can be divided into the stage before the virus contacts the cell, the stage when the virus binds to the host receptor and adsorbs on the surface of the host cell, the stage when the virus enters the cell by endocytosis, and the stage of replication after the virus enters the cell. In order to determine at which stage the drug exerts an antiviral effect in LSDV infection of MDBK cells, in this example, during the process of rLSDV infection of MDBK cells, cells or viruses were treated with 1 μM canertinib, and the replication level of the virus was evaluated by the mCherry and Luciferase proteins expressed by the virus.

[0054] Fig.12 The time of addition experiment design pattern diagram provided for this embodiment has the following steps: 2 × 10 4 MDBK cell suspension (100 μL / well). The culture plate was placed in an incubator for 24 h. Four groups of experiments were set up according to the different drug treatment time periods.

[0055] Group 1 (neutralization stage): To determine whether the drug has a neutralizing effect on the virus before the virus contacts the cells, the drug was diluted into a 2× drug concentration working solution using the maintenance solution, and 50 μL of the 2× drug concentration working solution was mixed with an equal volume of 200 TCID 50 rLSDV was mixed to obtain 200 TCID 50 The 1× drug concentration working solution of rLSDV was prepared and placed at 37°C for 1 h. The incubated liquid was then inoculated into the cells and incubated with MDBK cells for 2 h. The liquid was discarded and the cells were washed twice with 1× PBS. After the liquid was discarded, 200 μL of maintenance solution was added and the culture was continued for 72 h.

[0056] Group 2 (blocking stage): To determine whether the drug has a competitive binding effect on host cell receptors during virus adsorption to cells, the drug was diluted into a 1× drug concentration working solution using maintenance solution, 100 μL of 1× drug concentration working solution was added to the cells, incubated at 37°C for 1 h, the liquid was discarded, and the cells were washed twice with 1× PBS. After the liquid was discarded, 200 TCID 50 100 μL of rLSDV was added and incubated with MDBK cells for 2 h, the liquid was discarded, and the cells were washed twice with 1× PBS. After the liquid was discarded, 200 μL of maintenance solution was added and the culture was continued for 72 h.

[0057] Group 3 (entry stage): To determine whether the drug has the effect of preventing virus entry into cells, the drug was diluted into a 2× drug concentration working solution using maintenance solution, and 50 μL of 2× drug concentration working solution was mixed with an equal volume of 200 TCID 50 rLSDV was mixed to obtain 200 TCID 50 1× drug concentration working solution of rLSDV was used, 100 μL of the mixed liquid was inoculated into MDBK cells, incubated with MDBK cells for 2 h, the liquid was discarded, and the cells were washed twice with 1× PBS. After the liquid was discarded, 200 μL of maintenance solution was added and the culture was continued for 72 h.

[0058] Group 4 (replication stage): To determine whether the drug has the effect of preventing viral replication after the virus enters the host cell, the drug was diluted into a 1× drug concentration working solution using the maintenance solution. After discarding the liquid, add 200 TCID 50100 μL of rLSDV was added and incubated with MDBK cells for 2 h, the liquid was discarded, and the cells were washed twice with 1× PBS. After the liquid was discarded, 200 μL of 1× drug concentration working solution of the drug to be tested was added and the cells were cultured at 37°C for 72 h.

[0059] DMSO was set as a control group for the above four groups. At 72 hpi, samples were collected for testing to detect the Luciferase activity produced by the virus. When the concentration of canertinib was 1 μM, the fluorescence effect of canertinib on rLSDV at different stages was analyzed by mCherry labeling, and the inhibition effect of canertinib on rLSDV at different stages was analyzed by Luciferase, as shown in the figure. Fig.13 and Fig.14 As shown, both the mCherry fluorescence image and the Luciferase activity detection results showed that canertinib mainly exerted an inhibitory effect in the LSDV replication stage.

[0060] Embodiment seven: DNA replication and RNA transcription are necessary biological processes in the proliferation of LSDV after it enters the host cell. In order to determine whether canertinib has an effect on the DNA and RNA synthesis of LSDV during the replication phase, in this example, during the process of LSDV infection of MDBK cells, cells were treated with 5 μM canertinib. Newly synthesized DNA was labeled with EdU.

[0061] EdU is a thymidine deoxynucleoside analog. During the DNA synthesis process, EdU can be incorporated into the newly synthesized DNA as a raw material, and through the subsequent click reaction, EdU is labeled with Alexa Fluor488, so the newly synthesized DNA will emit green fluorescence under a fluorescence microscope.

[0062] Press 1×10 6 MDBK were plated in 6 cm2 cell culture dishes at a density of 100 cells / dish. After 24 h, 0.1 MOI of LSDV was inoculated. A blank control group was set up. At 72 hpi, the cells were washed twice with PBS and then digested with trypsin. 5 μL PBS was added to each well of a 24-well plate, and the cell slides were plated in the 24-well plate. 5×10 4After 12 hours, prepare the drug solution with cell maintenance solution (2% FBS in DMEM), and treat the cells with the prepared drug solution for 30 minutes. Then prepare another portion of EdU labeling solution (containing cell maintenance solution, drug and a mixture of EdU with a final concentration of 10 μM), mix well, replace the original drug solution in the well with EdU labeling solution, and continue to culture the cells for 60 minutes. After EdU labeling of cells, remove the culture medium, add 1 mL of 4% paraformaldehyde fixative, and fix at room temperature for 15 minutes. Remove the fixative, wash the cells 3 times with 1 mL PBS per well, 5 minutes each time. Remove PBS, incubate each well with 1 mL permeabilization solution (PBS containing 0.3% Triton X-100) at room temperature for 15 minutes. Remove the permeabilization solution, wash the cells 2 times with 1 mL PBS per well, 5 minutes each time. Remove the washing solution, and block each well with IFA blocking solution (3% BSA in PBS) at room temperature for 1 hour. Discard the blocking solution, do not wash, incubate with LSDV rabbit polyclonal antibody (1:1000) at room temperature for 1 h, wash 3 times with PBS, 5 min each time. Incubate with Alexa Fluor594-conjugated goat anti-rabbit IgG (Thermo Fisher, USA) at room temperature for 1 h, wash 3 times with PBS, 5 min each time. Prepare the click reaction working solution according to the system of Click Reaction Buffer 860 μL, CuSO4 40 μL, Azide 488 2 μL, ClickAdditive Solution 100 μL, and the total volume is 1 mL. Add the click reaction working solution to the wells of the 24-well plate at a volume of 100 μL / well. Incubate at room temperature in the dark for 30 min. Discard the click reaction working solution, wash 3 times with PBS, and finally add 100 μL of 1 × Hoechst33342 solution to each well and incubate at room temperature in the dark for 10 min to label the total DNA. The 1× Hoechst33342 solution was removed by aspiration, and the cells were washed three times with PBS, each time for 5 min. The fluorescence was then observed using a confocal microscope (Nikon A1 plus, Japan).

[0063] Similar to the principle of EdU labeling DNA, EU is a uridine nucleoside analog. During RNA synthesis, EU can be incorporated into newly synthesized RNA as a raw material, and through the subsequent click reaction, EU is labeled with Alexa Fluor 488, so the newly synthesized RNA will emit green fluorescence under a fluorescence microscope. The experimental operation steps for detecting the effect of drugs on LSDV RNA synthesis are basically the same as those for studying the effect of drugs on DNA synthesis, except that the final concentration of EU is 100 μM, which is different from EdU.

[0064] When canertinib was used at a concentration of 5 μM, the inhibitory effect of canertinib on rLSDV DNA synthesis was analyzed by EdU labeling of newly synthesized viral DNA. Fig.15 As shown, canertinib was able to inhibit DNA synthesis of LSDV during the replication phase.

[0065] Similarly, in this example, EU was used to label the newly synthesized RNA. When the concentration of canertinib was 5 μM, the inhibitory effect of canertinib on rLSDV RNA synthesis was analyzed by labeling the newly synthesized viral RNA with EU. Fig.16 As shown, canertinib can also inhibit the RNA synthesis of LSDV during the replication stage. Overall, canertinib can exert its antiviral effect by inhibiting the nucleic acid synthesis of LSDV.

[0066] Embodiment eight: This embodiment provides a pharmaceutical preparation, comprising the tyrosine kinase compound described in Example 1, and other pharmaceutically acceptable excipients.

[0067] The auxiliary materials include any one or more of diluents, fillers, adhesives, wetting agents, absorption enhancers, surfactants, lubricants, and stabilizers. The pharmaceutical preparations include injections, lyophilized powder injections, tablets, granules, or gels, and the administration method is oral, injection, or application.

[0068] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a tinib compound in the preparation of a drug for bovine nodular dermatosis, wherein the tinib compound is any one or more of canertinib, gefitinib, afatinib, lapatinib and erlotinib.

2. The use according to claim 1, characterized in that: The drug is a drug whose pharmacological action is to inhibit the proliferation of bovine nodular dermatosis virus.

3. The use according to claim 1, characterized in that: The concentration range of the drug was 45.7 nM-100 μM.

4. The use according to claim 1, characterized in that: The medicine is an oral, injectable or smearable preparation.

5. The use according to claim 1, characterized in that: The medicine is used for treating or preventing bovine nodular dermatosis.

6. A pharmaceutical preparation, characterized in that The invention comprises the tyrosine kinase compound according to claim 1, and other pharmaceutically acceptable excipients.

7. The pharmaceutical preparation according to claim 6, characterized in that The auxiliary materials include any one or more of diluents, fillers, adhesives, wetting agents, absorption promoters, surfactants, lubricants, and stabilizers.

8. The pharmaceutical preparation according to claim 6, characterized in that The pharmaceutical preparation is in the form of an injection, a lyophilized powder injection, a tablet, a granule or a gel.

Images