Application of ribavirin in preparation of medicine for treating bovine nodular dermatosis and pharmaceutical composition

Abstract

The invention discloses application of ribavirin in preparation of a medicine for treating bovine nodular dermatosis and a pharmaceutical composition, and experiments prove that ribavirin can play a role in treatment or prevention by inhibiting viral proliferation of bovine nodular dermatosis. Based on the new properties of ribavirin, the new application of ribavirin in preparation of the medicine for treating bovine nodular dermatosis is determined. Clinical indications of the ribavirin are expanded, the internal principle that the ribavirin participates in bovine nodular skin treatment is disclosed, the curative effect is remarkable, and the application has outstanding popularization prospects.

Description

Technical Field

[0001] The invention relates to application of ribavirin in preparing a drug for treating bovine nodular dermatosis and a drug composition, belonging to the technical field of drug application. Background Art

[0002] Lumpy skin disease (LSD) is a subacute to acute infectious disease caused by the Lumpy skin disease virus (LSDV), characterized by nodular lesions on the skin of cattle. LSDV belongs to the Poxviridae family and the genus Capripoxvirus. The mortality rate of cattle infected with LSDV is about 10%, and the morbidity rate is about 90%. The diseased cattle show symptoms such as fever, weight loss, decreased milk production, and nodules all over the body, which seriously restricts the economic benefits of cattle breeding. At present, LSD has not been effectively controlled. In the face of the epidemic threat, the existing technology mainly adopts strategies and measures combining emergency immunization with attenuated vaccines and isolation and killing to prevent and control LSD. Although the current vaccination has a good protective effect, clinical results show that attenuated vaccination has certain side effects, and more and more studies have shown that there is a risk of strain recombination when using attenuated live vaccines. There is currently no effective drug for the treatment of LSDV. In the case of defects in vaccine immunity, it is urgent to develop drugs that can effectively prevent or treat LSD as a technical reserve. Summary of the invention

[0003] The technical problem to be solved by the present invention is to overcome the defects of the prior art, disclose the application of ribavirin in the preparation of a drug for bovine nodular dermatitis and a pharmaceutical composition, and solve the technical problem that there is no effective drug for the prevention or treatment of LSDV.

[0004] In order to solve the above technical problems, the present invention provides the use of ribavirin in preparing a drug for bovine nodular dermatosis.

[0005] Furthermore, the drug is a drug whose pharmacological action is to inhibit the proliferation of bovine nodular dermatitis virus.

[0006] Furthermore, the concentration range of ribavirin in the drug is 1.23-100 μM.

[0007] Furthermore, the drug is administered orally, by application or by injection.

[0008] Furthermore, the drug is used for the treatment or prevention of bovine nodular dermatosis.

[0009] On the other hand, the present invention also provides a pharmaceutical composition comprising any of the above-mentioned ribavirins and other pharmaceutically acceptable excipients.

[0010] Furthermore, the auxiliary materials include any one or more of diluents, fillers, adhesives, wetting agents, absorption enhancers, surfactants, lubricants, and stabilizers.

[0011] Furthermore, the pharmaceutical composition is in the form of an injection, a lyophilized powder injection, a tablet, a granule or a gel.

[0012] The beneficial effects achieved by the present invention are: The present invention clarifies through experimental means that ribavirin inhibits the proliferation of LSDV, provides the use of ribavirin in the preparation of a drug for bovine nodular dermatitis and a pharmaceutical composition, which is used for the prevention or treatment of LSDV and avoids the side effects of attenuated vaccine vaccination or the risk of strain recombination. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The activity curve and cytotoxicity curve of ribavirin in inhibiting LSDV proliferation provided by the embodiment of the present invention; Figure 2 The fluorescence images of different concentrations of ribavirin inhibiting the proliferation of rLSDV in MDBK provided by the embodiment of the present invention; Figure 3 The fluorescence images of different concentrations of ribavirin inhibiting the proliferation of rLSDV in Vero provided by the embodiment of the present invention; Figure 4 When the ribavirin concentration is 20 μM, TCID 50 Detection of the inhibitory effect of ribavirin on LSDV; Figure 5 The diagram of the inhibitory effect of ribavirin on LSDV detected by qPCR when the ribavirin concentration is 20 μM provided in the embodiment of the present invention; Figure 6 The embodiment of the present invention provides a diagram of the inhibitory effect of ribavirin on LSDV with different MOIs detected by Western blot when the concentration of ribavirin is 20 μM; Figure 7 A diagram of a Time of addition experiment design model provided in an embodiment of the present invention; Figure 8 A diagram showing the inhibitory effect of mCherry-labeled ribavirin on rLSDV at different stages provided in an embodiment of the present invention; Fig. 9 The present invention provides an embodiment in which the inhibitory effect of ribavirin on rLSDV at different stages is analyzed by Luciferase when the ribavirin concentration is 20 μM. DETAILED DESCRIPTION

[0014] The present invention is further described below in conjunction with the examples. The following examples are only used to more clearly illustrate the technical solutions of the present invention, and are not intended to limit the scope of protection of the present invention.

[0015] The present application provides an application of ribavirin in the preparation of a drug for preventing or treating LSD, providing a new antiviral drug for the prevention and treatment of LSD.

[0016] Ribavirin is a monomeric compound. CAS number: 36791-04-5; chemical formula: C 8 H 12 N 4 O 5 ; Its chemical structure is as follows:

[0017] The experimental materials used in this application are as follows: Ribavirin was purchased from MCE. RIPA protein lysis buffer was purchased from Yuanye. DNA extraction kit, CCK-8 kit, reverse transcription reagent and SYBR Green Master Mix were purchased from YEASEN. β-Tublin mouse monoclonal antibody, HRP-labeled goat anti-rabbit secondary antibody and HRP-labeled goat anti-mouse secondary antibody were purchased from Yase. Trypsin was purchased from Solebao. MDBK, Vero cell line, fetal bovine serum and DMEM were purchased from Nanjing Senbeijia. Lipofectamine 3000 transfection reagent. Freund's complete adjuvant and Freund's incomplete adjuvant were purchased from Merck.

[0018] LSDV rabbit polyclonal antibody was prepared and stored in our laboratory. The preparation method is as follows: LSDV virus was mixed with Freund's complete adjuvant in a ratio of 1:1 and emulsified as an immunogen. 6.2 TCID 50 New Zealand white rabbits were immunized by subcutaneous injection at multiple points; subsequently, the same dose of Freund's incomplete adjuvant was used for booster immunization once every 14 days, for a total of 3 immunizations; 14 days after the third immunization, serum was collected and stored at -20℃.

[0019] The LSDV XJ201901 strain was isolated, identified and preserved by the Chinese Center for Animal Health and Epidemiology, and its NCBI GeneBank accession number is OM984485. The specific preparation method of the recombinant rLSDV strain with mCherry and Luciferase expression cassettes is as follows: ORF50 and ORF51 of LSDV are two adjacent proteins. According to literature reports, inserting foreign genes between the genes encoding these two proteins will not affect the replication of the virus itself. Therefore, we used this region as the insertion site for mCherry and firefly luciferase reporter genes (Luciferase). First, a donor plasmid carrying mCherry and Luciferase was constructed. When constructing the recombinant virus, the MDBK cell line was infected with the LSDV XJ201901 strain, and the donor plasmid was transfected into the MDBK cell line 6 hours later. At this time, the viral DNA will be recombined by the homologous recombinase in the cell according to the homologous sequence of the donor plasmid, thereby recombining the DNA fragments corresponding to the donor plasmid into the ORF50 and ORF51 gene positions of the viral genome. Then, the recombinant strain emitting red fluorescence was purified through three consecutive rounds of plaque assays, and finally the rLSDV strain expressing both mCherry and Luciferase was obtained for subsequent experiments.

[0020] Embodiment 1:

[0021] In order to evaluate the cytotoxicity of the drug in vitro, the present application used different concentrations of ribavirin to treat MDBK and Vero cells, measured the activity of the cells by CCK-8, and drew the cytotoxicity curve of the drug.

[0022] The specific steps are as follows: 2 × 10 4 MDBK or Vero cell suspension (100 μL / well). Place the culture plate in an incubator for 24 h (37°C, 5% CO 2 ). Ribavirin was diluted 3-fold in a gradient manner using cell maintenance medium, and 8 dilutions were made, among which the maximum concentration of the drug was 100 μΜ. The cells were treated with the diluted drug solutions of various concentrations for 72 h, and an equal volume DMSO control group was set up for each concentration.

[0023] Add 10 μL of CCK-8 solution to each well, avoiding the formation of bubbles. Incubate the culture plate in the incubator for 2 hours. Measure the absorbance at 450 nm using a microplate reader. Calculate cell viability according to the following formula: Among them, cell viability = [OD (drug group) - OD (blank group)] / [OD (control group) - OD (blank group)] × 100%.

[0024] Experimental groups: OD values ​​of wells with cells, CCK-8 solution, and drug solution.

[0025] Blank group: OD value of wells with maintenance medium and CCK-8 solution but no cells.

[0026] Control group: OD values ​​of wells having cells, CCK-8 solution and DMSO solution.

[0027] Finally, GraphPad was used to plot the CC of the drugs 50 Curves, such as Figure 1 As shown, in which a is the activity curve and cytotoxicity curve of ribavirin in inhibiting LSDV proliferation in MDBK cell line; b is the activity curve and cytotoxicity curve of ribavirin in inhibiting LSDV proliferation in Vero cell line. The results show that CC of ribavirin in MDBK cell line and Vero cell line 50 All were greater than 100 μM.

[0028] Embodiment 2: In order to evaluate the antiviral activity of the drug in vitro, in this example, during the process of rLSDV infection of MDBK and Vero cells, the cells were treated with different concentrations of the drug, and the distribution of the virus in the cells was marked by the mCherry protein expressed by the virus. The steps are as follows: 2 × 10 4 MDBK or Vero cell suspension (100 μL / well). Place the culture plate in an incubator for 20 h. Use cell maintenance medium to make a 3-fold gradient dilution of the drug to obtain a drug dilution solution, with a total of 8 dilutions, of which the maximum drug concentration is 100 μΜ.

[0029] Take 30 μL of drug dilution and add a multiplicity of infection (MOI) of 0.01 (200 TCID 50 , MOI = TCID at the time of exposure 50 The rLSDV virus solution of (mg / cell number) was added to obtain a mixed solution of drug and virus.

[0030] The mixed solution of drug and virus was incubated at 37℃ for 30 min. Then the cell culture medium was discarded, 30 μL of the mixed solution of drug and virus after incubation was added and incubated at 37℃ for 2 h, then the mixed solution of drug and virus was discarded, carefully washed once with PBS, 200 μL of drug dilution was added to the wells, and the cells were cultured for 72 h. At the same time, an equal volume DMSO control group and an untreated blank group were set up. The luminescence of the cells was recorded under a fluorescence microscope.

[0031] like Figure 2 , 3As shown, they are fluorescence images of different concentrations of ribavirin in this example inhibiting the proliferation of rLSDV in MDBK and Vero. It can be seen from the figure that the effect of ribavirin in inhibiting the proliferation of rLSDV in MDBK and Vero is dose-dependent with the concentration of canertinib used. When the concentration range of ribavirin is 1.23-100 μM, it can effectively inhibit the proliferation of bovine nodular dermatitis virus.

[0032] Then, aspirate the cell culture medium, add 100 μL of cell lysis solution to each well, incubate on ice for 5 min to fully lyse the cells. Take 20 μL of lysis solution and add it to the black ELISA plate. Dilute the firefly luciferase substrate (50×) and the sea renilla luciferase substrate (50×) to 1× working solution with the corresponding buffer. Incubate to room temperature. Add 100 μL of firefly luciferase reaction solution to each well, shake the plate to mix, and immediately detect the activity of firefly luciferase (completed within 30 min).

[0033] The data is calculated according to the following formula: Inhibition rate = 1-(experimental group value / control group value) × 100%.

[0034] Among them, blank group: cells from the same batch as the experimental group, without any drug or virus treatment; Experimental group: cells were treated with a mixed solution of drug and virus; Control group: cells were treated with a mixed solution of DMSO and virus.

[0035] The experimental group value = experimental group reading value - blank group reading value; the control group value = control group reading value - blank group reading value. Finally, use GraphPad to draw the IC value of the drug 50 curve.

[0036] like Figure 1 As shown, this example plots the curve of drug inhibition of LSDV replication in two cells by detecting the Luciferase activity expressed by the virus. Figure 1 It can be seen that the IC of ribavirin in the MDBK cell line 50 The IC of ribavirin in Vero cell line is 1.80 μM. 50 is 10.70 μM.

[0037] The Selectivity Index (SI) is an important indicator for evaluating the efficacy and safety of drugs, which is defined as the CC 50 With IC 50 The ratio of SI = CC 50 / IC 50The selection index of ribavirin in MDBK cell line was calculated to be greater than 55.5, and the selection index of ribavirin in Vero cell line was greater than 9.34, indicating that ribavirin has a large safety range in inhibiting the proliferation of LSDV.

[0038] Embodiment three: In order to evaluate the antiviral activity of the drug in vitro, this example infected MDBK and Vero cells with 0.01 MOI and 0.1 MOI of LSDV, respectively, and treated the cells with 20 μM ribavirin. Whole cell lysates were collected at 72 hpi for Western blot experiments. The steps are as follows: 1 × 10 5 MDBK or Vero cell suspension (500 μL / well). The culture plate was placed in an incubator for 20 h. The cell culture medium was then discarded and 200 μL of 0.01 MOI (1000 TCID 50 ) and 0.1 MOI (10000 TCID 50 ) LSDV and drug maintenance solution were incubated at 37°C for 2 h, then the liquid was discarded, the wells were carefully washed once with PBS, 1000 μL of drug-containing maintenance solution was added to the wells, and the cells were cultured for a further 72 h.

[0039] Discard the cell culture medium in the culture dish, wash the cells twice with pre-cooled 1× PBS, add RIPA lysis buffer and lyse the cells on ice for 10 min, transfer the lysed mixture to a 1.5 mL EP tube and centrifuge at 12000 g at 4°C for 10 min, take 80 μL of supernatant, add 20 μL 5× Loading Buffer, mix well and heat at 95°C for 5 min, and then centrifuge for instantaneous detection.

[0040] Add an equal volume of the sample to be tested to the PAGE gel and perform SDS-PAGE electrophoresis at a constant voltage of 80V. When bromophenol blue moves to the bottom of the gel, use a semi-dry transfer instrument for transfer and soak the transfer filter paper with pre-cooled transfer buffer. Place the filter paper, NC membrane, gel and filter paper in order from bottom to top, and be careful to remove bubbles. The program is: constant current 0.3 A, limit voltage 25 V, time 33 min. After the end, block with TBST containing 5% skim milk at room temperature for 2 h. After the blocking, wash with TBST at room temperature for 3 times, 5 min each time, add the corresponding primary antibody and incubate at 4℃ for 12 h, wash with TBST 3 times, 5 min each time, add the corresponding HRP-labeled secondary antibody and incubate at room temperature for 1 h. Wash with TBST 3 times, 5 min each time, and finally treat with ECL luminescent liquid and expose in the exposure instrument.

[0041] The results are as follows Figure 6 As shown, when the concentration of ribavirin was 20 μM, Western blot was used to detect the inhibitory effect of ribavirin on different MOIs of LSDV, where c is the inhibitory effect of ribavirin (20 μM) on different MOIs of LSDV in the MDBK cell line; d is the inhibitory effect of ribavirin (20 μM) on different MOIs of LSDV in the Vero cell line; these results indicate that 20 μM ribavirin has a good inhibitory effect on different MOIs of LSDV.

[0042] Embodiment 4: In order to evaluate the antiviral activity of the drug in vitro, in this example, during the process of wild-type LSDV infecting MDBK and Vero cells, the cells were treated with 20 μM ribavirin. The inhibitory effect of the drug on LSDV was evaluated by detecting the relative content of the LSDV gene in the cell samples. The steps are as follows: Sample preparation: 1 × 10 5 MDBK cell suspension (500 μL / well). The culture plate was placed in an incubator for 20 h. The cell culture medium was then discarded and 200 μL of 0.01 MOI (1000 TCID 50 ) LSDV and drug maintenance solution were incubated at 37°C for 2 h, then the liquid was discarded, carefully washed once with PBS, 1000 μL of drug-containing maintenance solution was added to the wells, and the cells were cultured for another 72 h.

[0043] DNA extraction: Add 10 µL of Proteinase K to 400 µL of lysis buffer LB, mix well, and obtain DNA lysis buffer. Discard the supernatant of the cell culture medium and wash twice with PBS. Discard all PBS and add 410 µL of DNA lysis buffer. Let stand for 30 s, pipette repeatedly 20 times, and transfer the cell lysate to a 1.5 mL EP tube. Place in a 55℃ warm bath for 10 min, shake and mix, and place at room temperature for 5 min. Take out the EP tube and cool to room temperature, then shake gently to mix. Add 300 µL of protein removal solution PL and 300 µL of binding solution BD in turn, and shake vigorously. Centrifuge at 12000 rpm for 5 min. The solution is separated into layers, the upper layer is the blue extraction layer, and the lower layer is the transparent aqueous phase. There may be a partial precipitation layer between the two layers of solution, and the DNA is in the lower aqueous phase. Carefully aspirate the lower layer solution for column purification. Place DNA adsorption column T1 in a 2 mL collection tube, add 200 μL buffer AC to DNA adsorption column T1, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid. Add the lower layer solution of the sample pretreatment to DNA adsorption column T1, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid. Place DNA adsorption column T1 back in the collection tube, add 500 μL rinse solution W, centrifuge at 12000 rpm for 30 s, and discard the waste liquid. Repeat the washing with rinse solution W. Place DNA adsorption column T1 back in the collection tube, centrifuge the empty column at 12,000 rpm at room temperature for 2 min to remove the residual rinse solution W. Place DNA adsorption column T1 in a new 1.5 mL centrifuge tube, add 25 μL of 65℃ preheated elution solution in the center of the adsorption column, and leave it at room temperature for 2 min. Then centrifuge at 12000 rpm for 1 min. Collect the filtrate. Add 25 µL of new elution buffer preheated at 65°C and repeat the elution once to obtain a total of about 50 µL DNA solution.

[0044] After the concentration and quality of the DNA solution were determined using Nano drop, it was stored at -20°C for future use. The primer sequences F: AGGGTGATGGGAAGGGTGTT, R: ACTTGCCCGTATCCATCCAC were designed for LSDVORF72, and the qPCR reaction system was prepared according to the dosage in Table 1. The reaction procedure shown in Table 2 was used to detect the gene abundance of the sample.

[0045]

[0046]

[0047] like Figure 5 As shown, after ribavirin in the MDBK cell line, the relative expression level of the viral ORF72 gene in the cells was significantly reduced.

[0048] Embodiment five: In order to evaluate the antiviral activity of the drug in vitro, in this example, during the infection of MDBK cells with wild-type LSDV XJ201901, cells were treated with 20 μM ribavirin. 50 The inhibitory effect of the drug on LSDV was evaluated. The steps are as follows: The sample preparation was the same as that of qPCR in Example 4.

[0049] TCID 50 Assay: 2 × 10 cells / well were seeded in a 96-well plate using growth medium. 4 MDBK cell suspension (100 μL / well). The culture plate was placed in an incubator for 24 h (37°C, 5% CO 2 The virus solution was diluted 10-fold with maintenance medium (DMEM containing 2% FBS), and 8 replicate wells were made for each gradient. 100 μL of the diluted virus solution was added to the wells to maintain the cultured cells for 5 days. Finally, the number of diseased wells was observed and counted under a microscope, and the TCID of the virus solution was calculated according to the Reed-Muench method. 50 .

[0050] like Figure 4 As shown, the TCID of the virus in the MDBK cell line after ribavirin 50 The content was significantly reduced.

[0051] Embodiment six: The process of virus infection of host cells can be divided into the stage before the virus contacts the cell, the stage when the virus binds to the host receptor and adsorbs on the surface of the host cell, the stage when the virus enters the cell by endocytosis, and the stage of virus replication after entering the cell. In order to determine at which stage the drug exerts an antiviral effect in LSDV infection of MDBK cells, in this example, during the process of rLSDV infection of MDBK cells, cells or viruses were treated with 20 μM ribavirin, and the virus replication level was evaluated by the mCherry and Luciferase proteins expressed by the virus. Figure 7 The time of addition experiment design pattern diagram provided in the embodiment of the present invention has the following steps: 2 × 10 4 MDBK cell suspension (100 μL / well). The culture plate was placed in an incubator for 24 h. Four groups of experiments were set up according to the different drug treatment time periods.

[0052] Group 1 (neutralization stage): To determine whether the drug has a neutralizing effect on the virus before the virus contacts the cells, the drug was diluted into a 2× drug concentration working solution using the maintenance solution, and 50 μL of the 2× drug concentration working solution was mixed with an equal volume of 200 TCID 50 rLSDV was mixed to obtain 200 TCID 50 The 1× drug concentration working solution of rLSDV was prepared and placed at 37°C for 1 h. The incubated liquid was then inoculated into the cells and incubated with MDBK cells for 2 h. The liquid was discarded and the cells were washed twice with 1× PBS. After the liquid was discarded, 200 μL of maintenance solution was added and the culture was continued for 72 h.

[0053] Group 2 (blocking stage): To determine whether the drug has a competitive binding effect on host cell receptors during virus adsorption to cells, the drug was diluted into a 1× drug concentration working solution using maintenance solution, 100 μL of 1× drug concentration working solution was added to the cells, incubated at 37°C for 1 h, the liquid was discarded, and the cells were washed twice with 1× PBS. After the liquid was discarded, 200 TCID 50 100 μL of rLSDV was added and incubated with MDBK cells for 2 h, the liquid was discarded, and the cells were washed twice with 1× PBS. After the liquid was discarded, 200 μL of maintenance solution was added and the culture was continued for 72 h.

[0054] Group 3 (entry stage): To determine whether the drug has the effect of preventing virus entry into cells, the drug was diluted into a 2× drug concentration working solution using maintenance solution, and 50 μL of 2× drug concentration working solution was mixed with an equal volume of 200 TCID 50 rLSDV was mixed to obtain 200 TCID 50 1× drug concentration working solution of rLSDV was used, 100 μL of the mixed liquid was inoculated into MDBK cells, incubated with MDBK cells for 2 h, the liquid was discarded, and the cells were washed twice with 1× PBS. After the liquid was discarded, 200 μL of maintenance solution was added and the culture was continued for 72 h.

[0055] Group 4 (replication stage): To determine whether the drug has the effect of preventing viral replication after the virus enters the host cell, the drug was diluted into a 1× drug concentration working solution using the maintenance solution. After discarding the liquid, add 200 TCID 50 100 μL of rLSDV was added and incubated with MDBK cells for 2 h, the liquid was discarded, and the cells were washed twice with 1× PBS. After the liquid was discarded, 200 μL of 1× drug concentration working solution of the drug to be tested was added and the cells were cultured at 37°C for 72 h.

[0056] DMSO was set as the control group for the above four groups. At 72 hpi, samples were collected for testing to detect the Luciferase activity produced by the virus. Figure 8 This is a diagram showing the inhibitory effect of mCherry-labeled ribavirin on rLSDV at different stages provided in this embodiment; Fig. 9 This is a diagram showing the inhibitory effect of ribavirin on rLSDV at different stages by Luciferase analysis when the concentration of ribavirin is 20 μM. Figure 8 , 9 It can be seen that ribavirin mainly exerts an inhibitory effect at the LSDV replication stage.

[0057] Embodiment seven: This embodiment provides a pharmaceutical composition comprising ribavirin and other pharmaceutically acceptable excipients.

[0058] The auxiliary materials include any one or more of diluents, fillers, adhesives, wetting agents, absorption promoters, surfactants, lubricants, and stabilizers.

[0059] The pharmaceutical composition is in the form of an injection, a lyophilized powder injection, a tablet, a granule or a gel.

[0060] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of ribavirin in the preparation of drugs for bovine nodular dermatosis.

2. The use according to claim 1, characterized in that: The drug is a drug whose pharmacological action is to inhibit the proliferation of bovine nodular dermatosis virus.

3. The use according to claim 1, characterized in that: The concentration of ribavirin in the drug is in the range of 1.23-100 μM.

4. The use according to claim 1, characterized in that: The drug is administered orally, applied or injected.

5. The use according to claim 1, characterized in that: The medicine is used for treating or preventing bovine nodular dermatosis.

6. A pharmaceutical composition, characterized in that The invention comprises the ribavirin as claimed in claim 1, and other pharmaceutically acceptable excipients.

7. The pharmaceutical composition according to claim 6, characterized in that The auxiliary materials include any one or more of diluents, fillers, adhesives, wetting agents, absorption promoters, surfactants, lubricants, and stabilizers.

8. The pharmaceutical composition according to claim 6, characterized in that The pharmaceutical composition is in the form of an injection, a lyophilized powder injection, a tablet, a granule or a gel.

Images