Application of ammonium chloride in preparation of medicine for preventing and treating porcine reproductive and respiratory syndrome

Abstract

The invention relates to the technical field of cytobiology, virology and biological medicine, in particular to application of ammonium chloride to preparation of medicine for preventing and treating porcine reproductive and respiratory syndrome. Ammonium chloride with the concentration of 10 mmol / mL is added in the process that MARC-145 cells are infected with PRRSV-2 strains HN07-1 and BJ-4 in vitro, compared with a control group without ammonium chloride, the RNA content and the protein abundance of PRRSV in the treatment group added with ammonium chloride are remarkably reduced, and it is indicated that ammonium chloride can be used for inhibiting in-vitro infection of the porcine reproductive and respiratory syndrome virus.

Description

Technical Field

[0001] The invention relates to the fields of cell biology, virology and biomedicine technology, and in particular to the application of ammonium chloride in the preparation of drugs for preventing and treating porcine reproductive and respiratory syndrome. Background Art

[0002] Porcine reproductive and respiratory syndrome (PRRS), commonly known as "blue ear disease", mainly causes reproductive disorders in sows and respiratory diseases in pigs of all ages. Due to the high genetic diversity and recombination ability of PRRSV, the virus strains are diverse and complex; PRRSV infection can cause damage to the immune system of pigs, trigger immunosuppression and immune escape mechanisms, and increase the risk of concurrent infection and secondary infection; and PRRSV infection can cause antibody-dependent enhancement effect, further exacerbating the severity of infection; at the same time, PRRSV infection will induce delayed production of neutralizing antibodies, causing persistent infection, resulting in severe challenges in the prevention and control of PRRSV, causing serious economic losses to the global pig industry.

[0003] PRRSV is an enveloped, single-stranded, positive-strand ribonucleic acid (RNA) virus belonging to the order Nidovirales, family Arteriviridae, genus Betaarterivirus (https: / / talk.ictvonline.org). Currently, there is no specific drug for PRRS in clinical practice, and the prevention and control strategy mainly relies on vaccination with inactivated and attenuated vaccines to prevent infection. Therefore, there is an urgent need to develop safe and effective PRRSV antiviral drugs. Summary of the invention

[0004] In order to solve the above problems, the present invention provides the use of ammonium chloride in the preparation of a drug for preventing and treating porcine reproductive and respiratory syndrome. The ammonium chloride can inhibit the in vitro infection of porcine reproductive and respiratory syndrome virus, thereby preventing and treating porcine reproductive and respiratory syndrome.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The invention also provides the use of ammonium chloride in preparing a drug for preventing and treating porcine reproductive and respiratory syndrome.

[0007] The invention also provides the use of ammonium chloride in preparing a drug for inhibiting porcine reproductive and respiratory syndrome virus infection in vitro.

[0008] Preferably, the porcine reproductive and respiratory syndrome virus includes porcine reproductive and respiratory syndrome virus HN07-1 and / or BJ-4.

[0009] Preferably, the ammonium chloride inhibits the replication of porcine reproductive and respiratory syndrome virus RNA.

[0010] Preferably, the ammonium chloride inhibits the synthesis of porcine reproductive and respiratory syndrome virus protein.

[0011] Preferably, the ammonium chloride inhibits the synthesis of porcine reproductive and respiratory syndrome virus N protein.

[0012] The invention also provides a medicine for preventing and treating porcine reproductive and respiratory syndrome, wherein the medicine contains ammonium chloride.

[0013] The invention also provides a medicine for inhibiting porcine reproductive and respiratory syndrome virus infection in vitro, wherein the medicine contains ammonium chloride.

[0014] Preferably, the content of ammonium chloride in the drug is 10 mmol / L.

[0015] The invention also provides the use of ammonium chloride in preparing a drug for inhibiting the replication of porcine reproductive and respiratory syndrome virus.

[0016] Beneficial effects of the present invention:

[0017] The present invention screened from the natural compound library preserved in this laboratory and found that ammonium chloride can significantly inhibit PRRSV infection in vitro. First, the cytotoxicity of commercial ammonium chloride was detected using the cell proliferation and toxicity detection method (CCK-8), and the inhibitory effect of non-cytotoxic ammonium chloride on PRRSV infection in vitro was identified by fluorescence quantitative PCR (RT-qPCR), immunoblotting (IB), indirect immunofluorescence (IFA) experiments, etc., and it was found that it can significantly inhibit the viral RNA content and protein abundance during PRRSV infection in vitro.

[0018] Ammonium chloride can significantly inhibit the in vitro infection of PRRSV. When 10mmol / L ammonium chloride was added to the MARC-145 cells during PRRSV infection, the PRRSV RNA content and protein abundance in the group treated with ammonium chloride were significantly reduced compared with the group without inhibitor. The experiment proved that ammonium chloride can be used to prepare drugs for the prevention and treatment of porcine reproductive and respiratory syndrome. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0020] Figure 1 is a bar graph of the cytotoxicity of ammonium chloride to MARC-145 cells;

[0021] Figure 2 The figure is an immunoblot of the abundance of PRRSV viral proteins in MARC-145 cells infected with PRRSV;

[0022] Figure 3 It is a bar graph of the relative content of PRRSV viral RNA in MARC-145 cells infected with PRRSV;

[0023] Figure 4 This is an immunofluorescence image of the abundance of PRRSV viral proteins in MARC-145 cells infected with PRRSV. DETAILED DESCRIPTION

[0024] The present invention provides the use of ammonium chloride in the preparation of a drug for preventing and treating porcine reproductive and respiratory syndrome. The present invention has no special limitation on the dosage form of the drug, and any pharmaceutically acceptable dosage form of ammonium chloride can be used.

[0025] The present invention also provides the use of ammonium chloride in the preparation of a drug for inhibiting porcine reproductive and respiratory syndrome virus infection in vitro. The present invention does not specifically limit the dosage form of the drug, and ammonium chloride can be used in a pharmaceutically acceptable dosage form. In the present invention, the porcine reproductive and respiratory syndrome virus preferably includes porcine reproductive and respiratory syndrome virus HN07-1 and / or BJ-4. In the present invention, the ammonium chloride preferably inhibits the replication of porcine reproductive and respiratory syndrome virus RNA. In the present invention, the ammonium chloride preferably inhibits the synthesis of porcine reproductive and respiratory syndrome virus protein. In the present invention, the ammonium chloride inhibits the synthesis of porcine reproductive and respiratory syndrome virus N protein.

[0026] The present invention also provides a drug for preventing and treating porcine reproductive and respiratory syndrome, wherein the drug contains ammonium chloride. In the present invention, the content of ammonium chloride in the drug is preferably 10 mmol / L. The present invention has no special limitation on the dosage form of the drug, and any pharmaceutically acceptable dosage form of ammonium chloride can be used.

[0027] The present invention also provides a drug for inhibiting porcine reproductive and respiratory syndrome virus infection in vitro, wherein the drug contains ammonium chloride. In the present invention, the content of ammonium chloride in the drug is preferably 10 mmol / L. The present invention has no special limitation on the dosage form of the drug, and any pharmaceutically acceptable dosage form of ammonium chloride can be used.

[0028] The present invention also provides the use of ammonium chloride in the preparation of a drug for inhibiting porcine reproductive and respiratory syndrome virus replication. The present invention has no special limitation on the dosage form of the drug, and any pharmaceutically acceptable dosage form of ammonium chloride can be used.

[0029] In order to further illustrate the present invention, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0030] The cells, viruses and main reagents that may be used in the present invention are as follows:

[0031] 1. DMEM culture medium (containing 100 U / mL penicillin and 100 μg / mL streptomycin, Beijing Solebow Technology Co., Ltd., catalog number 12100);

[0032] 2. Fetal bovine serum (Moregate, Australia, product number FSBF-500);

[0033] 3. Ammonium chloride (Sigma, USA, product number 12125-02-9);

[0034] 4. CellTiter 96 Aqueous One Solution reagent (Promega, USA, catalog number G3582);

[0035] 5. PRRSV-2HN07-1 strain (GenBank No. KX766378.1), PRRSV-2BJ-4 strain (GenBank No. AF331831.1);

[0036] 6. Extraction reagent RNAiso Plus (Dalian Takara Company, Cat. No. 9108);

[0037] 7. PrimeScriptTM Reverse Transcription Kit (Dalian TaKaRa Company, Cat. No. RR036A);

[0038] 8.2×ChamQ Universal SYBR qPCR Master Mix (Nanjing Novozyme Biotechnology Co., Ltd., catalog number Q711-02);

[0039] 9.RIPA lysis buffer (Shanghai Bio-Tech Company, catalog number P0013B);

[0040] 10. Protein loading buffer (Beijing Solebow Technology Co., Ltd., Cat. No. P1040);

[0041] 11. Rabbit anti-PRRSV nucleocapsid protein (N) monoclonal antibody (1:1,000; Genetex, USA, catalog number GTX637947);

[0042] 12. Mouse anti-β-actin monoclonal antibody (1:1,000; Cell Signaling Technology, USA, Cat. No. 3700);

[0043] 13. Horseradish peroxidase (HRP)-labeled goat anti-rabbit secondary antibody (1:1,000; Wuhan Yacoin Biotechnology Co., Ltd., Cat. No. A21020);

[0044] 14. Horseradish peroxidase (HRP)-labeled goat anti-mouse secondary antibody (1:1,000; Wuhan Yacoin Biotechnology Co., Ltd., A21010).

[0045] Example 1

[0046] Identification of the toxicity of ammonium chloride to MARC-145 cells

[0047] MARC-145 cells were cultured at 2.5×10 5 The cells were plated at a density of 100 μL / mL in a 96-well cell culture plate, and 100 μL of DMEM medium containing 10% (v / v) heat-inactivated fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin was added to each well. The plates were placed at 37°C and 5% CO. 2 The cells were cultured in a cell culture incubator for 12 h. When the cell confluence reached 70%-80%, the upper cell culture medium was discarded. Four groups were set up in the experiment, including treatment groups with 1, 5, 25, 100 μmol / L, 1, 5, 10, 15, 20, 25, 100 mmol / L ammonium chloride and a control group without ammonium chloride. The treatment groups were added with DMEM culture medium containing corresponding concentrations of ammonium chloride. All four groups were cultured in a cell culture incubator for 48 h. 20 μL Cell Titer 96A Queous One Solution reagent was added to each well and incubated at 37°C, 5% CO 2 The cells were incubated for 2 h, and the cytotoxicity was determined according to the instructions. Statistical analysis was performed using GraphPad software with unpaired, two-tailed Student t test; ns means no significant difference.

[0048] The results are as follows Figure 1 As shown in the figure, compared with the cell activity of the control group without ammonium chloride (0 μmol / L) (cell activity is 100%), the addition of 1, 5, 25, 100 μmol / L, 1, 5, 10 mmol / L ammonium chloride (NH 4 The treatment groups of 4% ammonium chloride (Cl) had no significant effect on cell activity (ns), indicating that the corresponding concentrations of ammonium chloride were non-cytotoxic and could be used in subsequent examples.

[0049] Example 2

[0050] Effect of ammonium chloride on the abundance of PRRSV proteins in MARC-145 cells infected with PRRSV (IB)

[0051] In order to further confirm that ammonium chloride inhibits the infection of PRRSV in MARC-145 cells, immunoblotting (IB) was used to detect the inhibitory effect of ammonium chloride on the expression of nucleocapsid protein (N), the main structural protein of PRRSV.

[0052] MARC-145 cells were cultured at 1.0×10 6 The cells were plated at a density of 100 / mL in a 24-well cell culture plate, 500 μL of DMEM medium was added to each well, and the plates were placed at 37°C and 5% CO. 2The cells were incubated in a cell culture incubator for 12 h; when the cell confluence reached 70%-80%, the upper cell culture medium was discarded, and PRRSV-2HN07-1, BJ-4 strains and DMEM medium with a virus infection multiplicity (MOI) of 1 were inoculated into MARC-145 cells, and the MARC-145 cells were infected at 37°C for 1 h, the cell supernatant was discarded, and the cells were repeatedly washed three times with PBS buffer to remove free virus particles that did not invade the cells; 6 groups were set up in the experiment, HN07-1, BJ-4 strains and DMEM medium were treated with 10 mmol / L ammonium chloride and a control group without ammonium chloride, and 500 μL DMEM medium containing ammonium chloride of the corresponding concentration was added to the control group, and the three groups of ammonium chloride treatment groups and the control group without ammonium chloride were placed at 37°C for 24 h, the cell supernatant was discarded, the cells were repeatedly washed three times with PBS buffer, and 150 μL was added to each well. RIPA lysis buffer, followed by immunoblotting (IB): protein lysis samples were placed on ice for 30 min, centrifuged at 12,000 rpm for 10 min at 4°C, and the supernatant was harvested; protein loading buffer was added to the supernatant and boiled for 10 min; protein samples were added to 12% SDS-PAGE gel for electrophoresis, and the protein gel was transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, USA, Cat. No. 3010040001); the membrane was blocked with 5% skim milk powder in phosphate-tween-20 buffer (PBST) at room temperature for 1 h, and the membrane was repeatedly washed three times with PBST on a shaker; rabbit anti-PRRSV N protein monoclonal antibody (1:1,000; Genetex, USA, Cat. No. GTX637947) and mouse anti-β-actin monoclonal antibody (1:1,000; CellSignaling, USA) were used respectively. Technology Company, Catalog No. 3700) was incubated at room temperature for 1 h, and the membrane was repeatedly washed three times with PBST on a shaker; horseradish peroxidase (HRP)-labeled goat anti-rabbit and HRP-labeled goat anti-mouse secondary antibodies (1:1,000; Wuhan Yacoin Biotechnology Co., Ltd., Catalog No. A21020 and A21010) were incubated at room temperature for 1 h, and the membrane was repeatedly washed three times with PBST on a shaker; a high-sensitivity chemiluminescence detection kit (Suzhou Xinsaimei Biotechnology Co., Ltd., Catalog No. P2200) was used to develop the color in a protein luminescence colorimeter according to the operating instructions.

[0053] The results are as follows Figure 2As shown, compared with the control group without ammonium chloride (0 μmol / L), the abundance of PRRSV N protein in the group treated with 10 mmol / L ammonium chloride was significantly reduced, especially according to the gray value in the protein luminescence colorimeter, the abundance of PRRSV N protein in the group treated with 10 mmol / L ammonium chloride was reduced by >99%, indicating that ammonium chloride can significantly inhibit the synthesis of PRRSV protein in MARC-145 cells infected with PRRSV.

[0054] Example 3

[0055] Effect of ammonium chloride on the RNA content of PRRSV in MARC-145 cells infected with

[0056] MARC-145 cells were cultured at 1.0×10 6 The cells were plated at a density of 100 / mL in a 24-well cell culture plate, 500 μL of DMEM medium was added to each well, and the plates were placed at 37°C and 5% CO. 2 The cells were cultured in a cell culture incubator for 12 h; when the cell confluence reached 70%-80%, the upper cell culture medium was discarded, and 500 μL of PRRSV-2HN07-1 strain and PRRSV-2BJ-4 strain with a virus infection multiplicity (MOI) of 1 and a DMEM control group without virus solution were added to each well and inoculated into MARC-145 cells, and the MARC-145 cells were infected and incubated at 37°C for 1 h; the cell supernatant was discarded, and 500 μL of phosphate buffered saline (PBS) was added to each well to repeatedly wash the cells three times to remove free virus particles that did not invade the cells; experimental setting Five groups were set up, namely, a PRRSV-2HN07-1 strain and PRRSV-2BJ-4 strain treatment group with 10mmol / L ammonium chloride added, a PRRSV-2HN07-1 strain and PRRSV-2BJ-4 strain treatment group without ammonium chloride added, and a control group without ammonium chloride and PRRSV strain added. 500μL DMEM culture medium containing corresponding concentrations of ammonium chloride was added to the treatment groups. The five groups were all placed at 37°C for 12, 24, 36, and 48h, the cell supernatant was discarded, and the cells were repeatedly washed three times with PBS buffer; 300μL of RNA extraction reagent RNAiso Plus (Dalian Takara Company, Catalog No. 9108) was used to extract total RNA from cells according to the operating instructions; complementary DNA (cDNA) was generated as a template using the PrimeScriptTM reverse transcription kit (Dalian TaKaRa Company, Catalog No. RR036A); the relative content of PRRSV ORF7 RNA was measured by RT-qPCR to represent the viral RNA content of infected cells; 3-phosphoglyceraldehyde dehydrogenase (GAPDH) was used as the cellular internal reference gene, and viral RNA was standardized with GAPDH mRNA, and the expression of 2 -△△CTMethods: Relative quantification of RNA expression levels was performed; the primer sequences are shown in Table 1, the PRRSV ORF7 and GAPDH reaction systems are shown in Table 2 and Table 3, respectively, and the reaction program used the Fast program of the ABI fluorescent quantitative PCR instrument (Applied Biosystems, USA).

[0057] The experiment was performed three times independently with three replicates each time. The experimental data are expressed as group mean and standard deviation (SD). Statistical analysis was performed using GraphPad software with unpaired, two-tailed Student t test. ** indicates p<0.0001.

[0058] The results are as follows Figure 2 As shown, compared with the control group without ammonium chloride (0 μmol / L), the PRRSV RNA content in the treatment group with 10 mmol / L ammonium chloride was significantly reduced by >99%, indicating that ammonium chloride can significantly inhibit the replication of PRRSV RNA in MARC-145 cells infected with ammonium chloride.

[0059] Table 1 Fluorescence quantitative PCR primers

[0060] Primer name Sequence (5'—3') PRRSV-ORF7 forward primer AAACCAGTCCAGAGGCAAGG(SEQ ID No.1) PRRSV-ORF7 reverse primer GCAAACTAAACTCCACAGTGTAA(SEQ ID No.2) GAPDH forward primer CCTTCCGTGTCCCTACTGCCAAC(SEQ ID No.3) GAPDH reverse primer GACGCCTGCTTCACCACCTTCT(SEQ ID No.4)

[0061] Table 2 Relative fluorescence quantitative PCR reaction system

[0062] Reagents Usage 2×ChamQ Universal SYBR qPCR Master Mix 10μL PRRSV-ORF7 forward primer (10 μmol / L) 0.4μL PRRSV-ORF7 reverse primer (10 μmol / L) 0.4μL cDNA (50ng) 2μL <![CDATA[ddH 2 The]]> Make up to 20 μL

[0063] Table 3 Relative fluorescence quantitative PCR reaction system

[0064] Reagents Usage 2×ChamQ Universal SYBR qPCR Master Mix 10μL GAPDH forward primer (10 μmol / L) 0.4μL GAPDH reverse primer (10 μmol / L) 0.4μL cDNA (50ng) 2μL <![CDATA[ddH 2 The]]> Make up to 20 μL

[0065] Example 4

[0066] Effect of ammonium chloride on the abundance of PRRSV viral proteins in MARC-145 cells infected with PRRSV (IFA)

[0067] In order to further confirm that ammonium chloride inhibits the infection amount of PRRSV in MARC-145 cells, indirect immunofluorescence (IFA) was used to detect the inhibitory effect of ammonium chloride on the expression of N protein, the main structural protein of PRRSV.

[0068] MARC-145 cells were cultured at 1.0×10 6 The cells were plated at a density of 100 / mL in a 24-well cell culture plate, 500 μL of DMEM medium was added to each well, and the plates were placed at 37°C and 5% CO. 2The cells were cultured in a cell culture incubator for 12 h. When the cell confluence reached 70%-80%, the upper cell culture medium was discarded, and the PRRSV-2HN07-1 and BJ-4 strains with a virus infection multiplicity (MOI) of 1 and DMEM culture medium were inoculated into MARC-145 cells. The MARC-145 cells were infected at 37°C for 1 h, the cell supernatant was discarded, and the cells were repeatedly washed three times with PBS buffer to remove free virus particles that did not invade the cells. Five groups were set up in the experiment, respectively, adding 10 mmol / L The HN07-1 strain and PRRSV-2BJ-4 strain treated with ammonium chloride, the HN07-1 strain and PRRSV-2BJ-4 strain treated without ammonium chloride, and the control group without ammonium chloride and PRRSV strain were added. 500 μL DMEM medium containing the corresponding concentration of ammonium chloride was added to the treatment group. The five groups were cultured at 37°C for 12, 24, 36, and 48 h, the cell supernatant was discarded, and the cells were repeatedly washed three times with PBS buffer, followed by IFA: 150 μL of DMEM medium was added to the cell sample. The cells were fixed with 4% paraformaldehyde fixative for 8 min, the fixative was discarded, and the cells were repeatedly washed three times with PBS buffer; 0.1% Triton X100 was added for permeabilization for 15 min, and the cells were repeatedly washed three times with PBS buffer; 4% BSA was added for blocking for 1 h, and the cells were repeatedly washed three times with PBS buffer; rabbit anti-PRRSV N protein monoclonal antibody (1:1,000; Genetex, USA) was added for incubation at 4°C for 1 h, and the cells were repeatedly washed three times with PBS buffer; rabbit anti-PRRSV N protein monoclonal antibody (1:1,000; Genetex, USA) was added for incubation overnight at 4°C, and the cells were repeatedly washed three times with PBS buffer; Alexa Fluor 488-goat anti-rabbit IgG H&L (1:1,000; Abcam, UK, (ab150077)) was added for incubation at room temperature for 1 h, and the cells were repeatedly washed three times with PBS buffer; DAPI was added for staining for 8 min, and the cells were repeatedly washed three times with PBS buffer; imaging was performed using an LSM880 confocal laser scanning microscope using ZEN2 software.

[0069] The results are as follows Figure 4 As shown, compared with the control group without ammonium chloride (0 μmol / L), the abundance of PRRSV N protein in the group treated with 10 mmol / L ammonium chloride decreased by >99%, indicating that ammonium chloride can significantly inhibit the synthesis of PRRSV protein in MARC-145 cells infected with ammonium chloride.

[0070] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of ammonium chloride in the preparation of drugs for the prevention and treatment of porcine reproductive and respiratory syndrome.

2. Application of ammonium chloride in the preparation of drugs for inhibiting porcine reproductive and respiratory syndrome virus infection in vitro.

3. The use according to claim 2, characterized in that: The porcine reproductive and respiratory syndrome virus includes porcine reproductive and respiratory syndrome virus HN07-1 and / or BJ-4.

4. The use according to claim 2, characterized in that: The ammonium chloride inhibits the replication of porcine reproductive and respiratory syndrome virus RNA.

5. The use according to claim 2, characterized in that: The ammonium chloride inhibits the synthesis of porcine reproductive and respiratory syndrome virus protein.

6. The use according to claim 2, characterized in that: The ammonium chloride inhibits the synthesis of porcine reproductive and respiratory syndrome virus N protein.

7. A drug for preventing and treating porcine reproductive and respiratory syndrome, characterized in that: The medicine contains ammonium chloride.

8. A drug for inhibiting porcine reproductive and respiratory syndrome virus infection in vitro, characterized in that: The medicine contains ammonium chloride.

9. The use according to claim 7 or 8, characterized in that: The content of ammonium chloride in the medicine is 10 mmol / L.

10. The use of ammonium chloride in the preparation of drugs for inhibiting the replication of porcine reproductive and respiratory syndrome virus.

Images