FMRP and cancer treatment

Abstract

The present invention provides compositions and methods for down-regulating the expression and / or immunosuppressive activity of i) an FMRP protein, ii) mRNA encoding an FMRP protein, and / or iii) an FMR1 gene for the treatment and / or prevention of primary cancer and / or cancer metastasis in a subject in need thereof.

Description

[0001] This application is a divisional application of patent application 202080034104.8 (based on PCT application No. PCT / EP2020 / 062593) entitled “FMRP and Cancer Treatment” filed by the applicant on May 6, 2020.

[0002] Related Applications

[0003] This application claims the benefit of priority from European patent application serial number 19172927.6 filed on May 7, 2019, the contents of which are incorporated herein by reference in their entirety. Technical Field

[0004] The present invention provides compositions and methods for regulating the expression and / or activity of i) FMRP protein (hereinafter referred to as "FMRP"), ii) mRNA encoding FMRP and / or iii) FMR1 gene encoding FMRP, for treating and / or preventing cancer and / or cancer metastasis in subjects in need thereof. Background Art

[0005] The discovery of immune checkpoint receptors and the development of immunotherapy based on checkpoint blockade are among the most notable successes in basic cancer research and clinical treatment, as they have increased the possibility of curing certain malignancies. 1 Immunomodulatory agents targeting T cell co-inhibitory immune checkpoints such as programmed death 1 (PD-1) or its ligand (PD-L1) and cytotoxic T lymphocyte antigen 4 (CTLA-4) have been approved for the treatment of different types of malignancies. 1 .

[0006] However, across the range of human cancer types, a large proportion (40% to 90%) of patients with different forms of cancer experience little or no benefit from the well-known immunotherapies based on PD-1 or CTLA-4 blockade. 2 , especially those with pancreatic ductal adenocarcinoma (PDAC) 3,4 Therefore, additional immunotherapeutic strategies remain urgently needed. Summary of the invention

[0007] The present invention provides agents capable of downregulating the expression and / or immunosuppressive activity of i) FMRP protein, ii) mRNA encoding FMRP protein and / or iii) FMR1 gene encoding FMRP for use in treating and / or preventing primary cancer and / or cancer metastasis in a subject in need thereof.

[0008] Also provided is a plasmid or vector comprising one or more nucleic acids encoding the miRNA, siRNA, piRNA, hnRNA, snRNA, esiRNA, shRNA and / or antisense oligonucleotide of the invention.

[0009] Further provided is a host cell comprising a plasmid or vector of the invention or one or more nucleic acids encoding the miRNA, siRNA, piRNA, hnRNA, snRNA, esiRNA, shRNA and / or antisense oligonucleotide of the invention.

[0010] Also provided is a plasmid or vector comprising one or more nucleic acids encoding the peptide or analog thereof, the antibody or antigen-binding fragment of the antibody, or the antibody mimetic of the present invention.

[0011] A host cell is further provided, comprising a plasmid or vector of the invention, or one or more nucleic acids encoding a peptide or analog thereof, an antibody or antigen-binding fragment of said antibody, or an antibody mimetic of the invention.

[0012] Also provided is a pharmaceutical composition comprising:

[0013] i) a therapeutically effective amount of an agent capable of modulating the expression and / or activity of FMRP protein, mRNA encoding FMRP and / or FMR1 gene, or

[0014] ii) a plasmid or vector of the present invention, or

[0015] iii) a host cell according to the present invention,

[0016] and a pharmaceutically acceptable carrier or diluent.

[0017] Further provided is a pharmaceutical composition targeting FMRP for selective and efficient degradation, comprising an agent as disclosed herein, wherein the agent is chemically linked to an E3-ubiquitin ligase. The agent tightly binds to FMRP to form an FMRP-agent complex, and the E3-ubiquitin ligase directs the bound protein to the proteasome for degradation.

[0018] Also provided are methods of treating and / or preventing cancer and / or cancer metastasis in a subject in need thereof, comprising administering to the subject an agent of the invention.

[0019] Also provided are methods of treating and / or preventing cancer and / or cancer metastasis in a subject in need thereof, comprising administering to the subject a pharmaceutical composition of the present invention.

[0020] Not wishing to be bound by any particular theory, it is believed that the engineered upregulation of the FMR1 gene in cells or tissues (endogenous or by gene therapy) to produce levels of FMRP protein similar to those in many tumors, or the delivery of FMRP protein or FMR1 mRNA, may be a strategy to improve autoimmune diseases such as type 1 diabetes, in which CD8 (cytotoxic) T cells with a pathological role are present in chronic or other inappropriate infiltrates. Similarly, the success of cell therapies involving stem cell and other cell transplantation may be enhanced if these cells are engineered to stably (by lentiviral transduction or CRISPR / Cas9 genome editing) or transiently overexpress FMRP by AAV. Brief Description of the Drawings

[0021] Figures 1A-1J. Loss of FMRP in mouse PDAC cancer cells significantly prolonged overall survival and severely impaired tumor growth and metastasis in immunocompetent but non-immunodeficient mice. (A) Representative images and quantification of FMRP expression in mouse normal pancreas, precancerous PanIN lesions, and PDAC tumor tissues in the P48-cre;LSL-KrasG12D;P53R172H / +PDAC mouse model in the FVBN background. n = 3 mice per group. Student's T test was used. Scale bar, 100 μm. Immunostaining of human PDAC tissue microarrays (not shown) confirmed the results in mouse PDAC. (B) Western blot using two different FMRP antibodies (Abcam, ab191411; Cell signaling, 4317s) that recognize different epitopes of the FMRP protein revealed the expression of FMRP in the 'wild-type (WT)' mouse PDAC cell line (4361.12) and its absence in the derived FMRP-deficient cells ('KO'), which were generated by transient transfection of a Cas9 / SgRNA vector targeting the mouse FMR1 gene encoding FMRP. Three independent experiments. (C) Colony formation of cultured 4361.12WT2 and FMRP KO2 cells. The indicated number of cancer cells was inoculated into one well of a six-well plate. Ten days later, the cells were fixed and stained with crystal violet. Three independent experiments; (D) Schematic diagram of the in vivo lung metastasis assay. Briefly, 2X10^5 cells were injected into the tail vein of immunocompetent FVBN or immunodeficient SCID / Beige mice to inoculate cancer cells in the lungs. Mice were monitored twice a week and were sacrificed when veterinary endpoints were reached. (EF) Overall survival of immunocompetent FVBn or immunodeficient SCID / Beige mice injected with syngeneic PDAC WT2 or FMRP KO2 cells, n = 5 mice per group, using Kaplan-Meier test. (G) Expression of FMRP in mouse PDAC cell line 4361.12WT cells and its absence in another FMRP KO cell line (KO8) revealed by Western blot, which was also generated by transient transfection of Cas9 / SgRNA vector targeting mouse FMR1 gene. Three independent experiments. (H) Schematic diagram of in vivo subcutaneous (sc) primary tumor growth model. In brief, 5X10^5 cells were injected sc into the subcutaneous of FVBN or NSG mice. Tumor-bearing mice were monitored twice a week and sacrificed on day 25 after injection, when the WT tumor volume reached 1000mm^3. (IJ) Tumor weights on day 28 in FVBn (I) or immunodeficient NSG (J) mice injected with murine PDAC WT (2 independent clones WT2 and WT3) or FMRP KO (2 independent clones KO2 and KO8) cells, n = 4 to 10 mice per group, using unpaired T test.

[0022] Figures 2A-2H . Loss of FMRP in mouse PDAC cancer cells triggers a strong antitumor immune response in the form of infiltrating CD8+ (cytotoxic) T lymphocytes. (A) Immunochemical staining and quantification of CD8+ (cytotoxic) T lymphocytes in primary tumors formed by mouse PDAC WT and KO cells, scale bar, 100 μm, n = 3 mice per group; (B) IF staining and quantification of CD45+ immune cells in primary tumors formed by mouse PDAC WT2 and KO2 cells, scale bar, 100 μm, n = 3 mice per group; (CG) FACS analysis was used to determine the frequency of CD45+ immune cells, CD3+CD8+ T cells, and activated GRZb+, IFNγ+ and TNFα+, CD8 T cells in PDAC WT and FMRP KO tumors grown in immunocompetent mice. n = 4 to 5 mice per group, two independent experiments. Unpaired T test was used. (H) Representative double immunostaining images of FMRP and CD8 expression in the center and periphery of mouse PDAC tissue from the P48-cre;LSL-KrasG12D;P53R172H / + PDAC mouse model in the FVBN background. n = 8 mouse PDAC samples. Paired T test was used. Scale bar, 100 μm. The data support the interpretation that FMRP blocks the influx of CD8 T cells seen in KO tumors (Figure A). Immunostaining of human PDAC tissue microarrays for CD8 and FMRP (not shown) showed a negative correlation between the density of infiltrating CD8 T cells and the expression of FMRP, which is consistent with the results in mouse PDAC.

[0023] Figures 3A-3D . FMRP KO in cancer cells sensitizes PDAC tumors that were originally resistant to immunotherapy involving anti-PD1 antibody treatment. (A, B) FMRP loss does not inhibit PD-L1 expression in mouse PDAC cells in vitro or in vivo. (A) WB analysis of PD-L1 expression in mouse PDAC WT and FMRP KO cells, three independent experiments. (B) Immunostaining to detect PD-L1 expression in tumors formed by mouse PDAC WT and FMRP KO cells, scale bar, 100 μm, n=3 mice per group. (C, D) PDAC WT2 and KO2 tumor growth curves without or with anti-PD-1 antibody treatment (IP, 200ug per mouse, twice a week), all in FVBn mice. n=7 to 11 mice per group, unpaired T test used. (C) The results indicate that PDAC tumors generated by this mouse PDAC cancer cell line are insensitive to anti-PD-1 treatment. (D) In ​​stark contrast, FMRP KO severely impaired PDAC tumor growth, which was associated with an increased influx of CD8 T cells (Figure ​Figure4C). Figure 1G -I, 2A, and 4D), suggesting that FMRP inhibitors may have therapeutic efficacy in tumors resistant to anti-PD1 / PD-L1 therapy.

[0024] Figures 4A-4D . Combined deletion of genes encoding FMRP and the RNA A-to-I editing protein ADAR1 in mouse PDAC further extends survival. (A) FMRP and ADAR1 interact in PDAC cancer cells, as determined by co-immunoprecipitation experiments in mouse PDAC4361.12WT2 cells. FMRP and ADAR1 were visualized in western blots of total cell lysates before and after immunoprecipitation with rabbit anti-FMRP antibody (Abcam, ab191411). Normal rIgG antibody was used as control. Three independent experiments. (B) The FMRP-ADAR1 interaction was also validated by reverse co-immunoprecipitation experiments, in which FMRP and ADAR1 were visualized by immunostaining western blots of total cell lysates before and after immunoprecipitation with mouse anti-ADAR1 antibody (Santa Cruz, sc73408). Normal mIgG antibody was used as control. Three independent experiments. (C) Western blot validation of FMRP and ADAR1 expression in WT2, FMRP KO, ADAR1 KO, and FMRP / ADAR1 double KO cells, which were generated by transient transfection of Cas9 / SgRNA vectors targeting mouse FMR1 and ADAR1 genes. Three independent experiments. (D) Overall survival of FVBn mice injected with WT2, FMRP KO, ADAR1KO, and FMRP / ADAR1 double KO cells; using Kaplan-Meier test. In brief, 5X10^5 cells were injected sc into the flank of FVBN mice. Mice were monitored twice a week and sacrificed when tumor volume reached 1000mm^3.

[0025] Figures 5A-5I Deletion of FMRP in cancer cells of another tumor type, colon cancer, similarly impaired tumor growth in immunocompetent but not immunodeficient mice. (A) AKP (ApcΔ / Δ; Kras G12D / +Representative images and quantification of immunohistochemical staining of FMRP expression in normal colon and adenoma tissues of mice from (ApcΔ / Δ; CDX2 CreERT2) or APC (ApcΔ / Δ; CDX2 Cre ERT2) mouse models. n = 3 mice per group. Student T test was used. Scale bar, 100 μm. Immunostaining of human colon cancer tissue microarrays (not shown) confirmed the mouse data. (B) Western blot validation of FMRP expression in FMRP KO and CT26 WT subclones generated by transient transfection of Cas9 / SgRNA vectors targeting the mouse FMR1 gene. The absence of FMRP in CT26 cells was validated by two independent antibodies (Abcam, ab191411; Cell Signaling Technology, CST, #4317) that recognize different epitopes of the FMRP protein. Three independent experiments. (C) Colony formation analysis of CT26WT17# and KO12# cells. 1250 cancer cells were inoculated in one well of a six-well plate. After 10 days, the cells were fixed and stained with crystal violet; three independent experiments. (D) Schematic diagram of the in vivo subcutaneous (sc) primary tumor growth model. Briefly, 5X10^5 cells were injected subcutaneously into immunocompetent Balb / c or immunodeficient NSG mice. Mice were monitored twice a week and sacrificed on day 25 or day 18 after injection, when the WT tumor volume reached 1000mm^3. (E) Tumor growth curves of Balb / c mice injected with CT26 WT17# or FMRP KO12# cells until day 25 after subcutaneous injection. n=10 mice per group, using unpaired T test. (F) Representative images and tumor weights of Balb / c mice injected with CT26 WT17# or FMRP KO12# cells on day 25, n=10 mice per group, using unpaired T test. (G) Immunochemical staining of CD8 and FMRP in primary tumors formed by CT26 WT17# or FMRP KO12# cells, scale bar, 100 μm, n = 3 mice per group (left panel); Quantification of CD8+ T cells in primary tumors formed by CT26 WT17# or FMRP KO12# cells (right panel); n = 3 mice per group. Student T test was used. Scale bar, 100 μm. (H) Tumor growth curves of NSG mice injected with CT26 WT12# or FMRP KO12# cells until day 14 after subcutaneous injection. n = 5 mice per group, unpaired T test was used. (I) Representative images and tumor weights of NSG mice injected with CT26 WT17# or FMRP KO12# cells on day 14, n = 5 mice per group, unpaired T test was used.

[0026] Figures 6A-6E . Loss of FMRP in mouse melanoma cells significantly impairs tumor growth in immunocompetent mice. (A) Representative images and quantification of immunohistochemical staining of FMRP expression in normal skin and melanoma tissues of mice in the iBIP2 (inducible BRAF INK / ARF PTEN) melanoma mouse model in FVBN background. n = 2 mice for the normal skin group and 4 mice for the iBIP2 melanoma group. Student's T test was used. Scale bar, 100 μm. (B) Western blot validation of FMRP expression in FMRP KO and B16-OVAWT subclones generated by transient transfection of Cas9 / SgRNA vectors targeting the mouse FMR1 gene. Three independent experiments. (C) Colony formation analysis of B16-OVAWT and FMRP KO cells. 1250 cancer cells were seeded in one well of a six-well plate. After 10 days, the cells were fixed and stained with crystal violet; three independent experiments. (D) Tumor growth curves of C57B / 6 mice injected with B16-OVAWT or FMRP KO cells until day 18 after subcutaneous injection. n = 5 to 10 mice per group, using unpaired T test. Briefly, 5X10^5 cells were injected sc into the flank of C57B / 6 mice. Mice were monitored twice a week and sacrificed on day 18 after injection, when the WT tumor volume reached 1000mm^3. (E) Representative images and tumor weights of immunocompetent mice injected with B16-OVAWT or FMRP KO cells collected on day 18, n = 5 to 10 mice per group; using unpaired T test.

[0027] Fig. 7A and 7B Specific deletion of FMRP in early cancer cells in the genetically engineered RIP1-Tag2 (RT2) mouse model of multistep pancreatic neuroendocrine tumorigenesis (PanNET) significantly prolongs survival. (A) Representative images of immunohistochemical staining for FMRP expression in normal pancreas, PanNET tumors, and liver metastases in mice; n = 3 mice per group. Scale bar, 100 μm. (B) Overall survival of male RT2 and FMRP KO RT2 mice, using the Kaplan-Meier test. Male FMRP KO RT2 mice, in which the FMR1 gene encoding FMRP is specifically deleted in pancreatic β cells expressing the oncogene SV40 that drives PanNET tumorigenesis, were generated by crossing FMR1 floxed mice with Rip1-Tag 2 (RT2) and RIP7-Cre mice; n = 17 for the FMRP KO RT2 group, and n = 12 for the RT2 group. All mice were monitored twice a week and sacrificed when veterinary endpoints were reached.

[0028] Fig. 8A and 8B . FMRP expression is elevated in mouse breast cancer tissues. (A) Representative images and quantification of FMRP expression in mouse normal mammary fat pad (MFP) and neoplastic breast tumors of the genetically engineered MMTV-PymT breast cancer mouse model. n = 3 mice per group. Student T test was used. Scale bar, 100 μm. (B) Representative images and quantification of FMRP expression in mouse normal mammary fat pad (MFP) and neoplastic breast tumors of the genetically engineered C3Tag triple-negative breast cancer (TNBC) mouse model. n = 3 mice for the normal MFP group and 3 mice for the C3Tag breast cancer group. Student T test was used. Scale bar, 100 μm. Immunostaining of human triple-negative breast cancer (TNBC) tissue microarrays (not shown) confirmed the results in mouse breast cancer.

[0029] Figures 9A-9C . Inhibition of FMRP in mouse PDAC cells by siRNA. (A) Migration assay of mouse PDAC 4361.12WT2 cells and FMRP KO2 cells. Briefly, 5000 cells in 50 μl of serum-free DMEM medium were seeded in the top well of a Boyden chamber (membrane pore size, 8 μm), and 200 μl of DMEM medium containing FBS was placed in the bottom chamber. After 18 hours, residual cancer cells in the wells were removed using a cotton swab containing 70% EtOH. Those cells that passed through the membrane through the 8-μm pores were fixed and then stained with crystal violet. The number of migrated cells was counted. Data were collected from 3 independent wells. Unpaired T test was used. Three independent experiments. (B) Western blot validation of FMRP expression in mouse PDAC 4361.12WT2 cells transfected with control siRNA (i.e., siCtrl: UAAGG CUAUGAAGAGAUAC (SEQ ID NO: 9)) and siRNA targeting FMRP (siFMRP#1: AUAAGAGACA ACUUG GUGC (SEQ ID NO: 10); and siFMRP#2: UAACUUCGGAAUUAUGUAG (SEQ ID NO: 11)). Three independent experiments. (C) Migration assay of mouse PDAC4361.12WT2 cells transfected with control siRNA and siRNA targeting FMRP; 5000 cells per well for 18 hours. Data were collected from 3 independent wells. Unpaired T-test was used. Three independent experiments.

[0030] Fig. 10A and 10B. FRET-based high throughput screening (HTS) of FMRP inhibitors. A. Schematic diagram of FRET-based high throughput screening (HTS) of FMRP inhibitors. 1) Human FMRP protein is produced in human HEK 293 cells, purified, and biochemically labeled with the fluorescent reporter fluorescein. 2) sc1 RNA1 is labeled with the fluorescence quencher molecule Cy3 or BHQ so that when sc1 binds to FMRP, the excitable fluorescence emission of FITC is quenched. 3) Compounds that cause quenched fluorescence release are further characterized to verify their ability to disrupt the interaction between FMRP and sc1. B. Mammalian expression FMRP-His protein purification profile. Human FMRP protein is produced in human HEK 293 cells, purified, and verified. Left, Coomassie blue staining shows 2ug of total protein in each lane. Right, Western blot of FMRP-His protein expression using anti-His Tag antibody. M. Molecular weight marker. Me. Medium. FT. Flow through. W. Wash. E. Elution fraction. The eluted fractions were combined, buffer exchanged and concentrated.

[0031] The Human Protein Expression Atlas (https: / / www.proteinatlas.org / ENSG00000102081-FMR1 / pathology) demonstrates widespread and highly prevalent expression of FMRP across a range of human cancer types. DETAILED DESCRIPTION

[0032] Although methods and materials similar or equivalent to those described herein can be used in the implementation or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The publications and applications discussed herein are only for the purpose of disclosure prior to the date of filing of the present application. Anything herein should not be construed as admitting that the present invention is not entitled to publish in advance due to prior invention. In addition, materials, methods and embodiments are only illustrative and not restrictive.

[0033] In case of conflict, the present specification (including definitions) will prevail. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the subject matter of this document belongs. As used herein, the following definitions are provided to facilitate understanding of the present invention.

[0034] The term "comprises / comprising" is generally used in the sense of inclusion / comprising, that is, allowing for the presence of one or more features or components.

[0035] As used in the specification and claims, the singular forms "a," "an," and "the" include plural forms unless the context clearly dictates otherwise.

[0036] As used herein, "at least one" means "one or more," "two or more," "three or more," and the like.

[0037] As used herein, the terms "subject" / "subject in need" or "patient" / "patient in need" are recognized in the art and are used interchangeably herein to refer to mammals, including dogs, cats, rats, mice, monkeys, cows, horses, goats, sheep, pigs, camels, and most preferably humans. In some cases, the subject is a subject in need of treatment or a subject suffering from a disease or condition. However, in other aspects, the subject can be a normal subject. The term does not indicate a particular age or gender. Thus, adult and neonatal subjects, whether male / male or female / female, will be covered. Preferably, the subject is a human. Most preferably, a human suffering from cancer and / or cancer metastasis or a human who may be at risk of developing cancer and / or cancer metastasis.

[0038] The terms "nucleic acid", "polynucleotide" and "oligonucleotide" are used interchangeably to refer to any type of deoxyribonucleotide (e.g., DNA, cDNA, etc.) or ribonucleotide (e.g., RNA, mRNA, etc.) polymer, or a combination of deoxyribonucleotide and ribonucleotide (e.g., DNA / RNA) polymers, in linear or circular conformation, and in single-stranded or double-stranded form. These terms should not be construed as limiting the length of the polymer, and may include known analogs of natural nucleotides, as well as nucleotides modified in the base, sugar and / or phosphate moieties (e.g., phosphorothioate backbones). Typically, analogs of a particular nucleotide have the same base pairing specificity; i.e., an analog of A will base pair with T.

[0039] As used herein, the term "vector" refers to a viral vector or a nucleic acid (DNA or RNA) molecule, such as a plasmid or other vector, which contains one or more heterologous nucleic acid sequences of the present invention, and is preferably designed for transfer between different host cells. The terms "expression vector", "gene delivery vector" and "gene therapy vector" refer to any vector that effectively integrates and expresses one or more nucleic acids of the present invention in a cell, preferably under the regulation of a promoter. In addition to the promoter, a cloning or expression vector may contain additional elements, such as regulatory and / or post-transcriptional regulatory elements.

[0040] The term "about," particularly when referring to a given quantity, is intended to include deviations of plus or minus ten (10) percent.

[0041] While focusing on the role of FMRP in promoting the invasive growth of pancreatic neuroendocrine and ductal carcinomas 5, the inventors unexpectedly discovered an unexpected and unprecedented role of FMRP in suppressing anti-tumor immunity in vivo.

[0042] Fragile X mental retardation protein (FMRP) is an RNA-binding protein highly expressed in the brain that binds to a subset of specific mRNAs for synaptic (and other) proteins and regulates their translation in neurons 6 Due to the critical role of FMRP in synaptic function, loss of its expression causes fragile X syndrome (FXS), the most common form of inherited intellectual disability and a major cause of autism. 7 In contrast to this role, other studies of FMRP have shown that it is expressed in a variety of cancer types. 8,9 FMRP is involved in cancer cell survival, invasion and metastasis. In the present disclosure, the term FMRP also refers to FMRP isoforms.

[0043] The inventors have shown that loss of FMRP expression in mouse pancreatic ductal adenocarcinoma cells (PDAC) and colon cancer cells significantly prolonged overall survival and severely impaired tumor growth in syngeneic immunocompetent mice.

[0044] Therefore, the present invention provides an agent capable of regulating the expression and / or activity of i) FMRP protein, ii) mRNA encoding FMRP and / or iii) FMR1 gene for treating and / or preventing cancer and / or cancer metastasis in a subject in need thereof.

[0045] Preferably, modulation of expression and / or activity of the FMRP protein comprises modulated interactions of the FMRP protein with its mRNA and miRNA targets (eg, via its RNA binding domain) and / or with other proteins.

[0046] In certain embodiments, the modulation is a reduction in FMRP mRNA levels. In certain embodiments, the modulation is a reduction in FMRP protein levels and / or activity. In certain embodiments, both FMRP mRNA and protein levels are reduced. This reduction may occur in a time-dependent or dose-dependent manner.

[0047] As used herein, "inhibit" or "reduce" are used interchangeably and mean a decrease in target nucleic acid levels or target protein levels in the presence of an agent of the invention compared to the target nucleic acid levels or target protein levels in the absence of the agent of the invention.

[0048] In one aspect, an agent of the invention inhibits translation of RNA encoding FMRP.

[0049] In another aspect, an agent of the invention inhibits transcription of DNA encoding FMRP.

[0050] In another aspect, the agent inhibits or impairs the binding of FMRP to a target mRNA, and / or the agent inhibits or impairs the binding of FMRP to a protein or other molecule with which it interacts, through which it transmits its immunosuppressive activity.

[0051] Preferably, the cancer and / or cancer metastasis to be treated is resistant to immunotherapy and is selected from the non-limiting examples of cancers including carcinoma, blastoma, sarcoma, melanoma, lymphoma and leukemia or lymphoid malignancies. More specific examples of such cancers include breast cancer, colon cancer, rectal cancer, colorectal cancer, renal cancer, clear cell carcinoma lung cancer (including small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma and lung squamous cell carcinoma), squamous cell carcinoma (e.g., epithelial squamous cell carcinoma), cervical cancer, ovarian cancer, prostate cancer, prostate tumors, liver cancer, bladder cancer, peritoneal cancer, hepatocellular carcinoma (hepatocellular cancer), gastric cancer (including gastrointestinal cancer and gastrointestinal stromal tumors), pancreatic cancer, head and neck cancer, glioblastoma, retinoblastoma, astrocytoma, thecoma, adenoblastoma, hepatoma, hematological malignancies (including non-Hodgkin lymphoma (NHL), multiple myeloma, myelodysplastic disorders, myeloproliferative disorders, chronic myeloid leukemia, and acute hematological malignancies), endometrial cancer or uterine cancer, endometriosis, endometrial stromal sarcoma, fibrosarcoma, choriocarcinoma, salivary gland cancer, vulvar cancer, thyroid cancer, esophageal cancer, hepatic cancer carcinoma, anal cancer, penile cancer, nasopharyngeal cancer, laryngeal cancer, Kaposi's sarcoma, mast cell sarcoma, ovarian sarcoma, uterine sarcoma, malignant mesothelioma, melanoma skin cancer, schwannoma, oligodendroglioma, neuroblastoma, neuroectodermal tumors, rhabdomyosarcoma, osteogenic sarcoma, leiomyosarcoma, Ewing's sarcoma, peripheral primitive neuroectodermal tumors, urinary tract cancer, thyroid carcinomas, Wilms' tumor, and abnormal vascular proliferation associated with nevus hamartomatosis, edema (such as that associated with brain tumors), and Meig's syndrome.

[0052] Typically, the agent of the invention is a compound, a peptide or analog thereof, a nucleic acid, an antibody, an antigen-binding fragment of said antibody, or an antibody mimetic. Given the primary subcellular localization of FMRP in the cytoplasm, preferably the agent is able to enter the intracellular compartment of cancer cells.

[0053] As used herein, "chemical agents or compounds" are compounds that change due to their chemical composition and their effects on living tissues and organisms. Chemical agents can be small molecule inhibitors (SMIs), nucleic acids such as siRNAs, or peptides. In an embodiment, the compound is preferably a non-peptidyl molecule. Most preferably, the non-peptidyl molecule induces selective intracellular proteolysis of a peptide encoded by the nucleic acid sequence of the present invention. Examples of compounds that induce selective intracellular proteolysis include small molecule chemical regulators of deubiquitinating enzymes upstream of the proteasome or on the proteasome and proteolysis targeting chimera (PROTAC) protein degraders. As known in the art, PROTAC, also known as active degraders, are heterobifunctional small molecules consisting of two active domains and a linker capable of removing specific unwanted proteins.

[0054] A variety of techniques and methods known to those skilled in the art can be used to discover and validate inhibition of FMRP to recapitulate the compositions of matter of the present invention revealed by gene knockout. The following is a description of a series of methods that can be used to identify FMRP inhibitors with potential for development as anticancer drug therapies.

[0055] If the agent is a peptide, it is preferably conjugated to an agent that increases the accumulation of the peptide in cancer cells. Such an agent may be a compound that induces receptor-mediated endocytosis (e.g., transferrin receptor-mediated endocytosis of transferrin conjugated to a therapeutic drug) (Qian ZM et al., "Targeted drug delivery via the transferrin receptor-mediated endocytosis pathway" Pharmacological Reviews, 54, 561, 2002), or a cell membrane permeable carrier that can be selected from the fatty acid group such as capric acid, myristic acid and stearic acid, which has been used for protein kinase C peptide (Ioannides CG et al., "Inhibition of IL-2 receptor induction and IL-2 production in the human leukemic cell line Jurkat by a novel peptide inhibitor of protein kinase C" Cell Immunol., 131, 242, 1990) and protein tyrosine phosphatase (Kole HK et al., "A peptide-based protein-tyrosine phosphatase inhibitor specifically enhances insulin receptor function in intact cells" J.Biol.Chem.271,14302,1996) peptide inhibitors or other peptides for intracellular delivery. Preferably, a cell membrane permeable carrier is used. More preferably, a cell membrane permeable carrier peptide is used.

[0056] If the cell membrane permeable carrier is a peptide, it is preferably a peptide rich in positively charged amino acids.

[0057] Preferably, the peptide rich in positively charged amino acids is a peptide rich in arginine. Futaki et al. (Futaki S.etal., "Arginine-rich peptides.An abundant source of membrane-permeable peptideshaving potential as carriers for intracellular protein delivery" J.Biol.Chem., 276, 5836, 2001) have demonstrated that the number of arginine residues in cell membrane permeable carrier peptides has a significant effect on the internalization method, and there seems to be an optimal number of arginine residues for internalization, preferably they contain more than 6 arginines, more preferably they contain 9 arginines (R9).

[0058] The peptide can be conjugated to a cell membrane permeable carrier via a spacer (e.g., two glycine residues). Any cell membrane permeable carrier can be used as determined by a skilled artisan. In this case, the cell membrane permeable carrier is preferably a peptide.

[0059] Typically the arginine-rich peptide is selected from a non-limiting group including HIV-TAT 48-57 peptide (GRKKRRQRRR; SEQ ID NO. 14), FHV-capsid 35-49 peptide (RRRRRNRTRRNRRRVR; SEQ ID NO. 15), HTLV-II Rex 4-16 peptide (TRRQRTRRARRNR; SEQ ID NO. 16) and BMV gag 7-25 peptide (KMTRAQRRAAARRNRWTAR) (SEQ ID NO. 17).

[0060] Since the inherent problem of natural peptides (L-form) is degradation by natural proteases, the peptides of the present invention and cell membrane permeable peptides can be prepared to include D-form peptides and / or "retro-inverso isomers" of the peptides. In this case, retro-inverso isomers of fragments and variants of the peptides of the present invention and retro-inverso isomers of cell membrane permeable peptides are prepared.

[0061] If the agent is a nucleic acid, it is selected from the group consisting of nucleic acids encoding miRNA, siRNA, piRNA, hnRNA, snRNA, sgRNA, esiRNA, shRNA, and antisense oligonucleotides (e.g., modified ASOs), or a combination thereof.

[0062] When the agent is a nucleic acid, the agent can be prepared by any suitable art-recognized method such as phosphoramidite or H-phosphonate chemistry, which can be performed manually or by an automatic synthesizer. The nucleic acid-based agents of the present invention can also be modified in a variety of ways without compromising their ability to hybridize with their targets (see, e.g., Agrawal and Gait, Advances in Nucleic Acid Therapeutics, (2019) https: / / doi.org / 10.1039 / 9781788015714).

[0063] In embodiments where the agent is a miRNA, siRNA, piRNA, hnRNA, snRNA, sgRNA, esiRNA, shRNA, or antisense compound, the agent targets a human FMRP nucleic acid. Nucleotide sequences encoding human FMRP include, but are not limited to, the following: GENBANK Accession No. NM_001185075.1 (incorporated herein as SEQ ID NO: 1); GENBANK Accession No. NM_001185076.1 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. NM_001185081.2 (incorporated herein as SEQ ID NO: 3); GENBANK Accession No. NM_001185082.2 (incorporated herein as SEQ ID NO: 4); and GENBANK Accession No. NM_002024.6 (incorporated herein as SEQ ID NO: 5). Nucleotide sequences encoding murine (mouse) FMRP include, but are not limited to, the following: GENBANK Accession No. NM_001290424.1 (incorporated herein as SEQ ID NO:6); GENBANK Accession No. NM_001374719.1 (incorporated herein as SEQ ID NO:7), and GENBANK Accession No. NM_008031.3 (incorporated herein as SEQ ID NO:8).

[0064] The terms "microRNA", "miRNA" and "MiR" are interchangeable and refer to endogenous or artificial non-coding RNA that can regulate gene expression. It is believed that miRNA works through RNA interference. The design of such microRNA is within the skill of ordinary technicians. The terms "siRNA" and "short interfering RNA" are interchangeable and refer to single-stranded or double-stranded RNA molecules that can induce RNA interference. siRNA molecules typically have a double-stranded region of 18 to 30 base pairs in length. The design of such siRNA is within the skill of ordinary technicians. The terms "piRNA" and "Piwi-interacting RNA" are interchangeable and refer to a class of small RNAs involved in gene silencing. PiRNA molecules are typically 26 to 31 nucleotides in length. The design of such PiRNA is within the skill of ordinary technicians. Examples of modified antisense oligonucleotides (ASOs) include GapmeR. As used herein, GapmeR is a chimeric antisense oligonucleotide that includes a central block of deoxynucleotide monomers that are long enough to induce RNase H cleavage. Typically, the GapmeR of the present invention is directed to one or more mRNAs or target mRNAs encoding FMRP. The design of such GapmeRs is within the skill of an ordinary technician.

[0065] The terms "sgRNA" and "guideRNA" are interchangeable and refer to a specific RNA sequence that recognizes a target DNA region of interest and guides the endonuclease there for editing. The gRNA typically consists of two parts: crispr RNA (crRNA) and tracr RNA, where crispr RNA is a 17 to 20 nucleotide sequence complementary to the target DNA and tracr RNA serves as a binding scaffold for the Cas nuclease.

[0066] Any suitable engineered sgRNA, or crRNA and tracrRNA, can be used as long as it is effective for recognizing the target DNA of the present invention. The design of such sgRNA, or crRNA and tracrRNA is within the skill of ordinary technicians. The sgRNA can, for example, be guided to recognize FMR1 DNA, for example, the sgRNA is selected from a group including 5'-GTGGAAGTGCGGGGCTCCAA-3' (SEQ ID NO: 12) and 5'-GAGCTGGTGGTGGAAGTGCG-3 (SEQ ID NO: 13) or a combination thereof.

[0067] The terms "snRNA" and "small nuclear RNA" are interchangeable and refer to a class of small RNAs that are involved in various processes including RNA splicing and regulation of transcription factors. Subclasses of small nucleolar RNA (snoRNA) are also included. The term is also intended to include artificial snRNAs, such as antisense derivatives of snRNAs. The design of such snRNAs is within the skill of the ordinary technician.

[0068] In particular, the present invention therefore provides an isolated siRNA comprising a short double-stranded RNA of about 18 to about 30 nucleotides in length, which targets an mRNA or target mRNA encoding FMRP. The term "isolated" refers to a change or departure from a natural state by human intervention. For example, siRNA naturally present in living animals is not "isolated", but synthetic siRNA or siRNA partially or completely separated from coexisting substances of its natural state is "isolated". Isolated siRNA can exist in a substantially purified form, or can exist in a non-natural environment, for example, the cell to which the siRNA is delivered. The siRNA of the present invention can include partially purified RNA, substantially pure RNA, synthetic RNA or recombinantly produced RNA, and RNA that is different from the change of naturally occurring RNA by adding, missing, replacing and / or changing one or more nucleotides. Such changes can include the addition of non-nucleotide substances, such as one or both ends of the siRNA or one or more internal nucleotides added to the siRNA, including modifications that make the siRNA resistant to nuclease digestion.

[0069] One or both strands of the siRNA of the present invention may also include a 3' overhang. "3' overhang" refers to at least one unpaired nucleotide extending from the 3' end of the RNA strand. Thus, in one aspect, the siRNA of the present invention comprises at least one 3' overhang of 1 to about 6 nucleotides (including ribonucleotides or deoxynucleotides), preferably 1 to about 5 nucleotides, more preferably 1 to about 4 nucleotides, and particularly preferably about 1 to about 2 nucleotides in length.

[0070] In the case where both chains of the siRNA molecule include 3' overhangs, the length of the overhangs of each chain can be the same or different. In the most preferred embodiment, the 3' overhangs are present on both chains of the siRNA and are two nucleotides in length. In order to enhance the stability of existing siRNAs, the 3' overhangs can also be stabilized to prevent degradation. In one embodiment, by including purine nucleotides such as adenosine or guanosine nucleotides to stabilize the overhangs.

[0071] Alternatively, replacement of pyrimidine nucleotides with modified analogs, such as replacement of uridine nucleotides in the 3' overhang with 2'-deoxythymidine, is acceptable and does not affect the efficiency of RNAi degradation. In particular, the absence of the 2' hydroxyl group in 2'-deoxythymidine significantly enhances the nuclease resistance of the 3' overhang in tissue culture medium.

[0072] The siRNA of the present invention can target any fragment of about 18-30, preferably 19-25 consecutive nucleotides in any target mRNA sequence (including mRNA encoding FMRP). The technology of selecting target sequences for siRNA is well known in the art. Therefore, the sense strand of the siRNA of the present invention comprises the same nucleotide sequence as any continuous fragment of about 18 to about 30 nucleotides in the target mRNA.

[0073] The siRNA of the present invention can be obtained using a variety of techniques known to those skilled in the art. For example, siRNA can be produced by chemical synthesis or recombinant methods known in the art. Preferably, the siRNA of the present invention is chemically synthesized using appropriately protected ribonucleoside phosphoramidites and conventional DNA / RNA synthesizers. siRNA can be synthesized into two independent complementary RNA molecules, or synthesized into a single RNA molecule with two complementary regions. Commercial suppliers of synthetic RNA molecules or synthetic reagents include Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colorado, the United States), Pierce Chemical (a division of Perbio Science, Rockford, Illinois, the United States), Glen Research (Sterling, Virginia, the United States), ChemGenes (Ashland, Massachusetts, the United States), Qiagen (Hilden, Germany) and Cruachem (Glasgow, the United Kingdom).

[0074] Alternatively, any suitable promoter may be used to express siRNA from a recombinant circular or linear DNA plasmid. Suitable promoters for expressing siRNA of the present invention from plasmids include, for example, U6 or H1 RNApol III promoter sequences and cytomegalovirus promoters. The selection of other suitable promoters is within the skill of the art. The recombinant plasmid of the present invention may also include an inducible or regulated promoter for expressing siRNA in a specific tissue or a specific intracellular environment. The siRNA expressed by the recombinant plasmid may be isolated from a cultured cell expression system by standard techniques, or may be expressed in neurons.

[0075] The siRNA of the present invention can also be expressed in the cells of neurons by recombinant viral vectors. The recombinant viral vector comprises a sequence encoding the siRNA of the present invention and any suitable promoter for expressing the siRNA sequence. Suitable promoters include, for example, U6 or H1 RNApol III promoter sequences and cytomegalovirus promoters. The selection of other suitable promoters is within the technical scope of the art. The recombinant viral vector of the present invention can also comprise an inducible or regulated promoter for expressing siRNA in the brain (e.g., in hippocampal neurons), in the prostate, etc.

[0076] In one embodiment, the one or more siRNAs of the present invention are selected from the non-limiting group including siRNAs targeting human FMRP (S5317, S5316) from Thermo Scientific.

[0077] In one embodiment, one or more siRNAs of the present invention are selected from the non-limiting group consisting of siFMRP#1: AUAAGAGACAACUUG GUGC (SEQ ID NO: 10), and siFMRP#2: UAACUUCGGAAUAUAUGUAG (SEQ ID NO: 11).

[0078] The agent of the present invention can also be selected from an antibody, an antigen-binding fragment of the antibody, or an antibody mimetic. Preferably, when the agent is an antibody, an antigen-binding fragment of the antibody, or an antibody mimetic, it is in the form of a plasmid or vector comprising one or more nucleic acids encoding the antibody, the antigen-binding fragment of the antibody, or the antibody mimetic so that it can be delivered to cancer cells where FMRP is localized in the cytoplasm and nucleus.

[0079] As used herein, "antibodies" are protein molecules that react with specific antigenic determinants or epitopes and belong to one of five different categories based on structural properties: IgA, IgD, IgE, IgG and IgM. Antibodies can be polyclonal (e.g., polyclonal serum) or monoclonal antibodies, including but not limited to fully assembled antibodies, single-chain antibodies, antibody fragments and chimeric antibodies, humanized antibodies, as long as these molecules still have biological activity and still bind to at least one peptide of the present invention. Preferably, the antibody is a monoclonal antibody. Preferably, the monoclonal antibody will also be selected from the group including IgG1, IgG2, IgG2a, IgG2b, IgG3 and IgG4 or a combination thereof. Most preferably, the monoclonal antibody is selected from the group including IgG1, IgG2, IgG2a and IgG2b or a combination thereof.

[0080] A typical antibody is made up of two immunoglobulin (Ig) heavy chains and two Ig light chains. There are several different types of heavy chains, which define the class, or isotype, of the antibody. These heavy chain types vary from animal to animal. All heavy chains contain a series of immunoglobulin domains, typically with one variable (VH) domain that is important for binding to the antigen and several constant (CH) domains. Each light chain is made up of two tandem immunoglobulin domains: a constant (CL) domain and a variable domain (VL) that is important for antigen binding.

[0081] To produce antibodies, various host animals can be immunized by injection of the FMRP gene product or a portion thereof (including but not limited to a portion of the FMRP gene product in the recombinant protein). Such host animals may include but are not limited to rabbits, mice, and rats, to name a few. Various adjuvants can be used to increase the immune response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surfactants such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacillus Calmette-Guerin) and Corynebacterium brevis.

[0082] Monoclonal antibodies can be prepared by using any technique that produces antibody molecules through a continuous cell line in culture. These include, but are not limited to, the hybridoma technique originally described by Kohler and Milstein, 1975, Nature, 256: 495-497, human B cell hybridoma technique (Kosbor et al., 1983, Immunology Today, 4: 72, Cote et al., 1983, Proc. Natl. Acad. Sci., 80: 2026-2030) and EBV hybridoma technique (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). In addition, the technology developed for producing "chimeric antibodies" by splicing genes from mouse antibody molecules with appropriate antigenic specificity with genes from human antibody molecules with appropriate biological activity (Morrison et al., 1984, Proc. Natl. Acad. Sci., 81: 6851-6855; Neuberger et al., 1984, Nature, 312: 604-608; Takeda et al., 1985, Nature, 314: 452-454) can be used. Alternatively, the technology described for producing single-chain antibodies (U.S. Patent No. 4,946,778) can be modified to produce single-chain antibodies specific for one of the binding partners.

[0083] The term "isolated", when used as a modifier of an antibody of the invention, means that the antibody is artificially produced or completely or at least partially separated from its naturally occurring in vivo environment. Typically, isolated antibodies are substantially free of one or more substances, such as one or more proteins, with which they are normally associated in nature. The term "isolated" does not exclude alternative physical forms of the antibody, such as polymers / oligomers, modified (e.g., phosphorylated, glycosylated, lipidated) or derivatized forms, or forms expressed in artificially produced host cells.

[0084] An "isolated" antibody may also be "substantially pure" or "purified" when it is free from most or all of the material with which it is normally associated in nature. Thus, a substantially pure or purified isolated antibody does not include polypeptides or polynucleotides that are present among millions of other sequences, such as antibodies in an antibody library or nucleic acids in a genomic or cDNA library.

[0085] Antibody fragments that recognize a specific epitope can be produced by known techniques. "Antigen binding fragment" includes a portion of a full-length antibody. Examples of antigen binding fragments include Fab, Fab', F(ab') 2 and Fv fragments; diabodies; minobodies; nanobodies; linear antibodies (Zapata et al. (1995) Protein Eng. 8(10): 1057-1062); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.

[0086] The fragments can be produced by pepsin digestion of antibody molecules and Fab fragments, which can be produced by reducing F(ab') 2 Alternatively, Fab expression libraries can be constructed (Huse et al., 1989, Science, 246: 1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity.

[0087] Preferably, the antibody or antigen-binding fragment of the antibody is either engineered to infiltrate cells, or is directly expressed in cells using gene therapy. The latter is an intracellular antibody produced in a cell and binding to an antigen (e.g., FMRP protein, mRNA encoding FMR, etc.) in the cell, also known as an intracellular antibody.

[0088] The present invention also relates to a gene delivery vector, preferably in the form of a plasmid or vector, comprising one or more nucleic acids encoding miRNA, siRNA, piRNA, hnRNA, snRNA, sgRNA, esiRNA, shRNA, peptides or their analogs, antibodies or antigen-binding fragments of said antibodies, or similar intracellular antibody mimics and / or antisense oligonucleotides of the present invention. As used herein, "vector" is capable of transferring a nucleic acid sequence to a target cell (e.g., viral vectors, non-viral vectors, microparticle vectors, and liposomes).

[0089] Suitable vectors include derivatives of SV40 and known bacterial plasmids, for example, E. coli plasmids col E1, pCR1, pBR322, pMB9 and their derivatives, plasmids such as RP4; phage DNA, for example, numerous derivatives of phage X, such as NM989 and other phage DNA, such as M1 3 and filamentous single-stranded phage DNA; yeast plasmids, such as 2μ plasmid or its derivatives; vectors that can be used in eukaryotic cells, such as vectors that can be used in insect or mammalian cells; vectors derived from a combination of plasmids and phage DNA, such as plasmids modified to use phage DNA or other expression regulatory sequences; and the like.

[0090] Various viral vectors are used to deliver nucleic acids to cells in vitro or in vivo. Non-limiting examples are vectors based on herpes viruses, pox viruses, adeno-associated viruses, lentiviruses, etc. In principle, they are all suitable for delivering expression cassettes comprising expressible nucleic acid molecules encoding miRNA, siRNA, piRNA, hnRNA, snRNA, sgRNA, esiRNA, shRNA and antisense oligonucleotides of the present invention.

[0091] Alternatively, the gene delivery vector of the present invention, preferably a viral vector, is released for delivery of a CRISPR-based loss-of-function system comprising i) at least one sgRNA targeting a regulatory sequence of the FMR1 gene or a genomic DNA sequence encoding FMRP mRNA, or crRNA and tracrRNA, and ii) and a structure-guided endonuclease, such as an RNA-guided endonuclease. Any suitable naturally occurring or engineered, RNA-guided endonuclease can be used, as long as it is effective for specifically binding to the target DNA of the present invention and it can be selected from a non-limiting group including Cas9, Cpf1 and FEN-1. Preferably, the RNA-guided endonuclease is Cas9.

[0092] In a preferred aspect, the viral vector is an adenoviral vector, preferably a lentiviral or baculoviral vector, or most preferably an adenoviral / adeno-associated virus (AAV) vector, but other delivery methods or vectors are known (e.g., yeast systems, microvesicles, gene guns / means of attaching vectors to gold nanoparticles), and, in some aspects, one or more viral or plasmid vectors are provided that can be delivered by liposomes, nanoparticles, exosomes, microvesicles, or gene guns. More preferably, the viral vector is selected from the group consisting of adeno-associated virus (AAV) and lentivirus (first, second, and third generation lentivirus).

[0093] The present invention also encompasses a host cell comprising a plasmid or vector of the present invention or one or more nucleic acids encoding miRNA, siRNA, piRNA, hnRNA, snRNA, sgRNA, esiRNA, shRNA, CRISPR-based loss of function system and / or antisense oligonucleotides of the present invention. The host cell can be any prokaryotic or eukaryotic cell, preferably the host cell is a eukaryotic cell, and most preferably the host cell is a mammalian cell. The host cell of the present invention can deliver the plasmid or vector of the present invention to cancer cells using a variety of techniques known to those skilled in the art, such as exosomes and microvesicles.

[0094] The present invention also provides a pharmaceutical composition comprising:

[0095] i) a therapeutically effective amount of an agent that modulates the expression and / or activity of an FMRP protein, mRNA encoding FMRP and / or FMR1 gene as described herein, or ii) a plasmid or vector of the present invention, or iii) a host cell of the present invention,

[0096] and a pharmaceutically acceptable carrier or diluent.

[0097] The pharmaceutical compositions of the present invention can be manufactured in a manner known per se, for example by conventional mixing, dissolving, granulating, dragee manufacturing, grinding, emulsifying, encapsulating, embedding or lyophilizing processes. The appropriate dosage form depends on the chosen route of administration. The formulation and administration techniques of the compounds of the present application can be found in Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa. (latest edition).

[0098] Any agent of the present invention can be administered to animals, including human patients, alone or as a pharmaceutical composition mixed with a suitable carrier or excipient at a therapeutically effective dose for treating or ameliorating a variety of diseases, including those characterized by insufficient, abnormal or excessive FMRP activity.

[0099] In some embodiments, the pharmaceutical compositions of the present invention can be used to treat and / or prevent cancer and / or cancer metastasis in a subject in need thereof.

[0100] As used herein, the term "therapeutically effective amount" refers to an amount of an agent that modulates the expression and / or activity of FMRP protein, mRNA encoding FMRP and / or FMR1 gene that is high enough to significantly and positively alter the symptoms and / or condition to be treated, but low enough to avoid serious side effects (at a reasonable risk / benefit ratio) within the scope of sound medical judgment.

[0101] The therapeutically effective amount of an agent that modulates the expression and / or activity of FMRP protein, mRNA encoding FMRP and / or FMR1 gene is selected according to a variety of factors, including: patient type, species, age, weight, sex and medical condition; severity of the condition to be treated; route of administration; liver and kidney function of the patient. One of ordinary skill in the art can easily determine and prescribe the effective amount of the drug required to prevent, combat or stop the progression of cancer and / or cancer metastasis.

[0102] "Pharmaceutically acceptable carrier or diluent" refers to a carrier or diluent that can be used to prepare a generally safe, non-toxic and desirable pharmaceutical composition, and includes carriers or diluents that are acceptable for human pharmaceutical use.

[0103] Such pharmaceutically acceptable carriers can be sterile liquids, such as water and oils, including oils of petroleum, animal, plant or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc. When the pharmaceutical composition is administered intravenously, water is a preferred carrier. Saline solutions and aqueous solutions of glucose and glycerol can also be used as liquid carriers, particularly for injections.

[0104] Pharmaceutically acceptable excipients include starch, glucose, lactose, sucrose, sodium stearate, glyceryl monostearate, talc, sodium chloride, skimmed milk powder, glycerol, propylene glycol, water, ethanol and the like.

[0105] The pharmaceutical composition may also include one or more pharmaceutically acceptable salts, for example, inorganic acid salts such as hydrochloride, hydrobromide, phosphate, sulfate, etc.; and organic acid salts such as acetate, propionate, malonate, benzoate, etc. In addition, adjuvants, such as wetting agents or emulsifiers, pH buffer substances, gels or gelling materials, flavoring agents, colorants, microspheres, polymers, suspending agents, etc., may also be present in the present invention. In addition, there may be one or more other conventional pharmaceutical ingredients, such as preservatives, wetting agents, suspending agents, surfactants, antioxidants, anticoagulants, fillers, chelating agents, coating agents, chemical stabilizers, etc., especially if the dosage form is a reconstructible form. Suitable exemplary ingredients include microcrystalline cellulose, sodium carboxymethyl cellulose, polysorbate 80, phenylethyl alcohol, chiorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerol, phenol, p-chlorophenol, gelatin, albumin, and combinations thereof. A thorough discussion of pharmaceutically acceptable excipients can be found in REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub. Co., NJ 1991), which is incorporated herein by reference.

[0106] In some embodiments, the present invention relates to the identification, production and use of agents that modulate FMRP gene expression or FMRP gene product activity, as well as pharmaceutical preparations and routes of administration of said compounds, said agents including but not limited to nucleic acids encoding FMRP and its homologues, analogs and deletions, as well as compounds, peptides or their analogs, antibodies or antigen-binding fragments of said antibodies, antibody mimetics or nucleic acids.

[0107] Assays using FMRP transfectants can be used to successfully identify agents that modulate FMRP gene expression.Assays for FMRP gene product activity are also described.

[0108] The invention also includes: antisense oligonucleotides specific for FMRP transcripts; antibodies (fragments and mimetics) directed against said gene products; cell lines engineered to stably express FMRP; assays for screening compounds including peptides, polynucleotides and small organic molecules to identify compounds that inhibit the expression or activity of FMRP gene products; and methods of using said compounds to treat diseases characterized by FMRP activity.

[0109] Human FMRP protein can be used for in vitro studies of the mechanism of action of human FMRP, particularly for further studies of the mechanism of action of any inhibitors that are selective for FMRP identified through drug screening, or for studies of the mechanism of action of existing drugs or inhibitors that may be identified by other means. Purified human FMRP protein can also be used to produce crystals suitable for X-ray crystallography. Such crystals are very useful for the rational design of drugs based on molecular structure.

[0110] The present invention provides an in vitro system for screening agents that modulate FMRP stability and / or activity. The analysis can be performed in living mammalian cells or in microsomal extracts prepared from cultured cell lines, which more closely approximate the effects of a specific serum level of an agent in vivo. Studies using microsomal extracts provide a more rigorous possibility of determining direct interactions.

[0111] Therefore, the present invention also provides a method for evaluating the relative inhibitory activity of an agent that selectively inhibits FMRP. The assay comprises, for example, contacting a transgenic cell line expressing FMRP or a microsomal extract thereof with a preselected amount of the agent in a suitable culture medium or buffer, adding arachidonic acid to the mixture, and measuring the level of FMRP synthesis or FMRP protein activity in the cell line or microsomal extract compared to a portion of a control cell line or microsomal extract in the absence of the agent.

[0112] In some embodiments, the present invention provides a method of determining the ability of an agent to inhibit FMRP activity in a cell, comprising:

[0113] (1) adding a first preselected amount of the agent to cells in culture medium, the cells containing a DNA sequence expressing FMRP;

[0114] (2) measuring the FMRP activity level of the cells; and

[0115] (3) Comparing the levels to the levels of FMRP activity in the cell line in the absence of the agent.

[0116] In some embodiments, the cell is a transgenic cell. In some embodiments, the cell is a transgenic cell line. In some embodiments, the transgenic cell or transgenic cell line comprises a cell containing a chromosomally integrated recombinant DNA sequence expressing FMRP. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell does not express autologous FMRP activity.

[0117] In some embodiments, the cell is a human or mouse cancer cell in which expression of FMRP is significantly upregulated during tumorigenesis and malignant progression to acquire resistance to immune attack.

[0118] In some embodiments, the FMRP is a mammalian FMRP, preferably a human FMRP.

[0119] In some embodiments, the level of expression and / or activity of FMRP is determined by an agent that disrupts the binding of FMRP to its target RNA.

[0120] In some embodiments, the present invention provides a method for identifying an agent that modulates the expression and / or activity of i) FMRP protein, ii) mRNA encoding FMRP, and / or iii) FMR1 gene, the method comprising:

[0121] (1) Providing a sample expressing FMRP;

[0122] (2) contacting the biological sample with a test agent;

[0123] (3) determining the level of expression and / or activity of FMRP;

[0124] (4) comparing the level of expression and / or activity to a control sample that has not been contacted with the test agent; and

[0125] (5) Selecting a test agent that reduces the level of FMRP expression and / or activity.

[0126] In some embodiments, the sample is a cell that naturally expresses high levels of endogenous FMRP. In some embodiments, the sample is a cell that has been engineered to express FMRP.

[0127] In some embodiments, the cell is a transgenic cell. In some embodiments, the cell is a transgenic cell line. In some embodiments, the transgenic cell or transgenic cell line comprises a cell containing a chromosomally integrated recombinant DNA sequence expressing FMRP. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell does not express autologous FMRP activity.

[0128] In some embodiments, the cell is a human or mouse cancer cell in which expression of FMRP is significantly upregulated during tumorigenesis and malignant progression to acquire resistance to immune attack.

[0129] In some embodiments, the FMRP is a mammalian FMRP, preferably a human FMRP.

[0130] In some embodiments, the level of expression and / or activity of FMRP is determined by an agent that disrupts the binding of FMRP to its target RNA.

[0131] Agents identified in the screening will be shown to have the ability to selectively modulate the expression and / or activity of FMRP. These agents include, but are not limited to, nucleic acids encoding FMRP and its homologues, analogs, and deletions thereof, as well as compounds, peptides or their analogs, antibodies or antigen-binding fragments of said antibodies, antibody mimetics, or nucleic acids.

[0132] The DNA encoding the FMRP gene or its homologue, analogue or fragment of the present invention can be used according to the present invention to diagnose a disease state whose phenotype is FMRP genotype or FMRP expression.

[0133] Alternatively, the pharmaceutical composition of the present invention further comprises one of the several components of the anticancer therapy. Preferably, the anticancer therapy comprises a therapeutically effective amount of an immune checkpoint inhibitor. Preferably, the immune checkpoint inhibitor is selected from a group including a PD-1 inhibitor, a PD-L1 inhibitor, and a CTLA-4 inhibitor or a combination thereof. Alternatively, or additionally, one or more anticancer therapies are chemotherapeutics as described herein or a mixture of a plurality of different chemotherapeutics.

[0134] As used herein, "PD-1 inhibitor" refers to any agent that interferes with or blocks the binding of the PD-1 receptor on T cells to its ligands PD-L1 and PD-L2 present on tumor cells. The PD-1 inhibitor can be an antibody or fragment thereof that interferes with, inhibits or blocks the binding of PD-1 to its ligands. The PD-1 inhibitor can also be a small molecule or any other agent. Non-limiting examples of PD-1 inhibitors include nivolumab, pembrolizumab, pidilizumab, BMS 936559, MPDL3280A, MSB0010718C BGB-108, mDX-400, and MEDI4736.

[0135] Non-limiting examples of PD-L1 inhibitors are selected from the group consisting of MEDI-0680, RG-7446, durvalumab, KY-1003, KD-033, MSB-0010718C, TSR-042, ALN-PDL, STI-A1014, and BMS-936559.

[0136] As used herein, "CTLA-4 inhibitor" refers to any agent that interferes with or blocks CTLA-4, such as an anti-CTLA-4 mAb or blocking agent, such as ipilimumab, tremelimumab, and abatacept.

[0137] In another aspect, anti-cancer therapy targeting FMRP is used in combination with a therapeutically effective amount of an anti-tumor vaccine (including a personalized tumor neo-antigen mixture, or other immunostimulants that enhance anti-tumor immune responses).

[0138] The present invention further provides a method for treating and / or preventing cancer and / or cancer metastasis in a subject in need thereof, comprising administering to the subject a pharmaceutical composition of the present invention, alone or in combination with one or more anticancer therapies. Most preferably, the anticancer therapy comprises a therapeutically effective amount of an immune checkpoint inhibitor. Preferably, the immune checkpoint inhibitor is selected from a group including a PD-1 inhibitor, a PD-L1 inhibitor, and a CTLA-4 inhibitor or a combination thereof. Alternatively, or additionally, the anticancer therapy is a chemotherapeutic agent as described herein or a mixture of a plurality of different chemotherapeutic agents.

[0139] It should be understood that the combination of the pharmaceutical composition of the present invention and the PD-1 / PD-L 1 / CTLA-4 inhibitor can be administered in any order or simultaneously. In selected aspects, the pharmaceutical composition and PD-1 / PD-L 1 / CTLA-4 will be administered to patients who have previously been treated with other anticancer agents. In certain other aspects, the pharmaceutical composition and PD-1 / PD-L 1 / CTLA-4 inhibitor will be administered substantially simultaneously or in parallel. For example, the subject may be given the pharmaceutical composition of the present invention while receiving treatment with a PD-1 / PD-L 1 / CTLA-4 inhibitor. In addition, it is considered that the subject has received or may be receiving other forms of cancer treatment, such as chemotherapy, at the same time. In certain aspects, the pharmaceutical composition of the present invention will be administered within 1 year of treatment with a PD-1 / PD-L 1 / CTLA-4 inhibitor. In certain alternative aspects, the pharmaceutical composition of the present invention will be administered within 10, 8, 6, 4, or 2 months of any treatment with a PD-1 / PD-L1 / CTLA-4 inhibitor and / or additional anticancer therapy. In certain other aspects, the pharmaceutical compositions of the invention will be administered within 4, 3, 2, or 1 week of any treatment with a PD-1 / PD-L 1 / CTLA-4 inhibitor and / or additional anticancer agent or therapy. In some aspects, the pharmaceutical compositions of the invention will be administered within 5, 4, 3, 2, or 1 day of any treatment with a PD-1 / PD-L 1 / CTLA-4 inhibitor and / or additional anticancer agent or therapy. It is also understood that the pharmaceutical compositions of the invention and the PD-1 / PD-L1 / CTLA-4 inhibitor and / or additional anticancer agent or therapy can be administered to a subject within hours or minutes (i.e., substantially simultaneously).

[0140] In embodiments, agents of the invention may be combined with other immunomodulators that either maintain the killing activity and abundance of T cells (and NK cells) or disrupt other barriers, such as myeloid-derived suppressor cells (MDSCs) and immunosuppressive macrophages, as long as their activities are complementary to the effects of inhibiting FMRP.

[0141] In some embodiments, agents of the invention may be combined with ADAR1 inhibitors.Knockout (ie, genetic inhibition) of ADAR1, an immunosuppressive RNA editing enzyme, has a combined benefit in prolonging overall survival of double KO tumors that also carry FMRP knockout.

[0142] Anticancer agents that can be administered in combination with the pharmaceutical composition of the present invention and PD-1 / PD-L1 / CTLA-4 inhibition include chemotherapeutic agents. Therefore, in some aspects, the method or treatment involves the combined administration of the pharmaceutical composition of the present invention and PD-1 / PD-L 1 / CTLA-4 inhibitors with chemotherapeutic agents or a mixture of multiple different chemotherapeutic agents. Treatment using the pharmaceutical composition of the present invention can be performed before, at the same time, or after the administration of these other therapies. The chemotherapy contemplated by the present invention includes chemical substances or drugs known in the art and commercially available, such as gemcitabine, irinotecan, doxorubicin, 5-fluorouracil, arabinoside ("Ara-C"), cyclophosphamide, thiotepa, busulfan, cyclotoxin, paclitaxel, methotrexate, cisplatin, melphalan, vinblastine, and carboplatin. Combined administration may include co-administration with a single drug formulation or with a separate formulation, or continuous administration in any order but usually over a period of time so that all active agents can simultaneously exert their biological activity. The preparation and dosing regimen of such chemotherapeutic agents can be used according to the manufacturer's instructions or determined empirically by the practitioner.

[0143] Chemotherapeutic agents useful in the present invention also include, but are not limited to, alkylating agents such as thiotepa and cyclophosphamide (CYTOXAN); alkyl sulfonates such as busulfan, prothiosulfan, and thiosulfan; aziridines such as benzodopa, carboquinone, meturedopa, and uredopa; ethyleneimines and methylamelamines, including hexamethylmelamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide, and trimethylolomelamim e); nitrogen mustards, such as chlorambucil, naphthyl mustard, cholophosphamide, estramustine, ifosfamide, dichloromethyl diethylamine, methoxychlor hydrochloride, melphalan, novembichin, phenylephrine, prednimustine, trofosfamide, uracil mustard; nitroureas, such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, ranimustine; antibiotics, such as aclarubicin, actinomycin, authramycin, azaserine, bleomycin, cactinomycin, calicheamicin, car abicin, carmine, carzinophilin, chromomycin, dactinomycin, daunorubicin, detopicin, 6-diazo-5-oxo-isoaminocaproic acid, doxorubicin, epirubicin, esorubicin, idarubicin, mexiromycin, mitomycin, mycophenolic acid, nogamycin, olivetomycin, peplomycin, potfiromycin, puromycin, quelamycin, rhodorubicin, streptozocin, streptozotocin, tuberculin, ubenimex, zinostatin, daunorubicin; antimetabolites such as methotrexate and 5- Fluorouracil (5-FU); folic acid analogs such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxefuridine, enocitabine, floxuridine, 5-FU; androgens such as caprotestosterone, dromotazone propionate, cyclothiodine, melastosane, testosterone lactone; antiadreners such as aminoglutethimide, mitotane, trilostane; folic acid supplements such as frolinic acid; acetoglucuronide; aldophosphamide glycoside; aminolevulinic acid; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demeclofenac; esquinone; elformithine; elformithine;etoglu; gallium nitrate; hydroxyurea; lentinan; lonidamine; mitoguanidine; mitoxantrone; mopidarol; nitracrine; pentostatin; methamine mustard; pirarubicin; podophyllic acid; 2-ethylhydrazide; procarbazine; PSK; razoxane; sizofuran; spirogermanamine; tricholomaric acid; triazoquinone; 2,2',2"-trichlorotriethylamine; urethane; vindesine; dacarbazine; mannitol mustard; dibromomannitol; dibromodulanol; piperobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxanes, such as paclitaxel (TAXOL, Bristol-Myers Squibb Oncology, Princeton, NJ) and docetaxel (TAXOTERE, Rhone-Poulenc Rorer, Antony, France); chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitomycin C; mitoxantrone; vincristine; vinorelbine; navelbine; novantrone hydrochloride; teniposide; daunorubicin; aminopterin; xeloda; ibandronate; CPT11; the topoisomerase inhibitor RFS2000; difluoromethylornithine (OMFO); retinoic acid; esperamidate cins; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above substances. Chemotherapeutic agents also include anti-hormonal agents used to modulate or inhibit hormonal effects on tumors, such as anti-estrogens, including, for example, tamoxifen, raloxifene, aromatase inhibitors 4 (5) -imidazole, 4-hydroxytamoxifen, troxifene, keoxifene, LY117018, onapristone and toremifene (Falutone); and anti-androgens, such as flutamide, nilutamide, bicalutamide, leuprolide and goserelin; and pharmaceutically acceptable salts, acids or derivatives of any of the above substances. ;

[0144] In some aspects, the therapeutic agent is a kinase inhibitor. In some aspects, the kinase inhibitor is a multi-target receptor tyrosine kinase inhibitor. Kinase inhibitors include but are not limited to sunitinib, pazopanib, crizotinib, dasatinib. In some aspects, the second anticancer agent is sunitinib.

[0145] In some aspects, the therapeutic agent is an inhibitor of the mammalian target of rapamycin (mTOR). mTOR inhibitors include, but are not limited to, sirolimus, sirolimus, deforolimus, and everolimus. In some aspects, the second anticancer agent is everolimus.

[0146] In some aspects, the therapeutic agent is a somatostatin analog. Somatostatin analogs work by interacting with specific, high-affinity somatostatin membrane receptors. Somatostatin analogs include, but are not limited to, octreotide, somadulin, and RC 160 (octastatin). In some aspects, the second anticancer agent is octreotide.

[0147] In some aspects, the chemotherapeutic agent is a topoisomerase inhibitor. A topoisomerase inhibitor is a chemotherapeutic agent that interferes with the action of topoisomerase (e.g., topoisomerase I or II). Topoisomerase inhibitors include but are not limited to doxorubicin hydrochloride, daunomycin citrate, mitoxantrone hydrochloride, actinomycin O, etoposide, topotecan hydrochloride, teniposide (VM-26) and irinotecan. In some aspects, the second anticancer agent is irinotecan.

[0148] In certain aspects, the chemotherapeutic agent is an alkylating agent. In certain aspects, the chemotherapeutic agent is temozolomide.

[0149] In some aspects, chemotherapeutic agents are antimetabolites.Antimetabolites are chemical substances whose structures are similar to the metabolites required for normal biochemical reactions, but the differences are sufficient to interfere with one or more normal functions of cells, such as cell division.Antimetabolites include but are not limited to gemcitabine, fluorouracil, capecitabine, methotrexate sodium, ralitrexed, pemetrexed, tegafur, cytarabine, thioguanine (GlaxoSmithKlin), 5-azacytidine, 6-mercaptopurine, azathiopurine, 6-thioguanine, pentostatin, fludarabine phosphate and cladribine, and their pharmaceutically acceptable salts, acids or derivatives.In some aspects, the second anticancer agent is gemcitabine.In some aspects, the tumor to be treated is a pancreatic neuroendocrine tumor and the second anticancer agent is antimetabolite (e.g., gemcitabine).

[0150] In some aspects, the chemotherapeutic agent is an antimitotic agent, including but not limited to an agent that binds to tubulin. As a non-limiting example, the agent includes taxane. In some aspects, the agent includes paclitaxel or docetaxel, or a pharmaceutically acceptable salt, acid or derivative of paclitaxel or docetaxel. In some aspects, the agent is paclitaxel (TAXOL), docetaxel (TAXOTERE), albumin-bound paclitaxel (e.g., ABRAXANE), DHA-paclitaxel or PG-paclitaxel. In some alternative aspects, the antimitotic agent includes vinca alkaloids, such as vincristine, vinblastine, vinorelbine or vindesine, or their pharmaceutically acceptable salts, acids or derivatives. In some aspects, the antimitotic agent is an inhibitor of Eg5 kinesin or an inhibitor of mitotic kinases such as AuroraA or Plk1.

[0151] In certain aspects, treatment involves the combined administration of a pharmaceutical composition of the invention and a PD-1 / PD-L 1 / CTLA-4 inhibitor as described herein and radiation therapy. Treatment using the pharmaceutical composition of the invention can be performed before, simultaneously with, or after the administration of radiation therapy. Any dosing regimen determined by the practitioner for such radiation therapy can be used.

[0152] In other aspects of the invention, the pharmaceutical composition of the present invention is a sustained release formulation, or a formulation administered using a sustained release device. Such devices are well known in the art and include, for example, transdermal patches and micro-implantable pumps that can provide drug delivery over time in a continuous, steady-state manner at various doses to achieve the sustained release effect of a non-sustaining pharmaceutical composition.

[0153] In other aspects of the invention, the pharmaceutical composition of the invention is administered before, during and / or after the patient receives radiation therapy.

[0154] "Radiation therapy" refers to the use of high-energy radiation to shrink tumors and kill cancer cells. Examples of radiation therapy include, but are not limited to, external radiation therapy and internal radiation therapy (also called brachytherapy).

[0155] External radiation therapy is the most common and generally involves directing a beam of direct or indirect ionizing radiation to the tumor or cancer site. While the radiation beam, photon, cobalt or particle therapy is focused on the tumor or cancer site, it is almost impossible to avoid exposure of normal, healthy tissue. The energy source for external radiation therapy is selected from the group consisting of direct or indirect ionizing radiation (e.g., X-rays, gamma rays and particle beams or combinations thereof).

[0156] Internal radiation therapy includes implanting a radioactive source, such as a bead, wire, pill, capsule, etc., at or near the tumor site in the body. The energy source for internal radiation therapy is selected from the group of radioisotopes including iodine (iodine 125 or iodine 131), strontium 89, phosphorus radioisotopes, palladium radioisotopes, cesium radioisotopes, indium radioisotopes, phosphate radioisotopes, or cobalt radioisotopes, and combinations thereof. Such implants may be removed after treatment, or left inactive in the body. Types of internal radiation therapy include, but are not limited to, interstitial and intracavitary brachytherapy (high dose rate, low dose rate, pulsed dose rate).

[0157] Less common forms of internal radiation therapy currently involve biological carriers of radioisotopes, such as radioimmunotherapy, which administers tumor-specific antibodies bound to radioactive substances to the patient. The antibodies bind to tumor antigens, effectively delivering a dose of radiation to the relevant tissue.

[0158] Methods of administering radiation therapy are well known to those skilled in the art.

[0159] The pharmaceutical composition of the present invention can be applied to the experimenter by different approaches, including but not limited to oral, parenteral, sublingual, percutaneous, rectal, transmucosal, topical, by inhalation, buccal administration, intrapleural, intravenous, intraarterial, intraperitoneal, subcutaneous, intramuscular, intranasal, intratumoral, intrathecal and intraarticular or their combination. For human use, the composition can be administered as a suitable acceptable preparation according to normal human practice. The technical staff will easily determine the dosage regimen and the route of administration that are most suitable for a particular patient. The composition of the present invention can be administered by traditional syringes, needleless injection devices, "micro-bullet bombardment guns" or other physical methods such as electroporation ("EP"), "fluid dynamics method" or ultrasound.

[0160] The pharmaceutical compositions of the present invention can also be delivered to patients by several techniques, including DNA injection with or without in vivo electroporation (also known as DNA vaccination), liposome-mediated, nanoparticle-promoted, recombinant vectors such as recombinant lentivirus, recombinant adenovirus, and recombinant adeno-associated virus, as described herein. The compositions can be injected intravenously or locally into the brain or muscle, or electroporated into tissues of interest such as muscle, brain, liver, prostate, breast, kidney, and hematopoietic system.

[0161] The agents and / or pharmaceutical compositions of the invention may be used in any method where modulation of the expression and / or immunosuppressive activity of i) FMRP protein, ii) mRNA encoding FMRP protein, and / or iii) FMR1 gene encoding FMRP would be beneficial.

[0162] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications, except those specifically described. It should be understood that the present invention includes all such variations and modifications that do not deviate from its spirit or essential characteristics. The present invention also includes all steps, features, compositions and compounds mentioned or indicated individually or jointly in this specification, as well as any and all combinations of any two or more of the steps or features. Therefore, the present disclosure should be considered to be illustrative in all aspects and not restrictive, and the scope of the present invention is indicated by the appended claims, and all changes within the meaning and scope of the equivalents are intended to be included in the present invention. This specification quotes multiple references throughout, and each reference is incorporated herein by reference in its entirety. The foregoing description will be more fully understood with reference to the following examples.

[0163] Example

[0164] Example 1

[0165] Materials and Methods

[0166] Generation of CRISPER-edited tumor cell lines

[0167] Mouse PDAC 4361.12 cells were cultured in DMEM containing 10% FBS. The FMR1 gene in cells was knocked out using the CRISPR / Cas9 system. Cells were transiently transfected with two Cas9 and single-stranded guide RNA (sgRNA) expression plasmids and selected by blasticidin for five days. This transient CRISPR strategy for knocking out FMRP prevents any potential nonspecific effects mediated by the stable integration of Cas9 / sgRNA into the genome. The guide sequence for FMR1 was 5'-GTGGAAGTGCGGGGCTCCAA-3' (SEQ ID NO: 12) or 5'-GAGCTGGTGGTGGAAGTGCG-3' (SEQ ID NO: 13). Cells were inoculated into 96-well plates without blasticidin. Knockout clones with FMRP protein deficiency were selected by immunoblotting. The obtained FMRP KO cells remained sensitive to blasticidin, indicating that the CRISPR / Cas9 system was only transiently expressed in these cells. Two independent KO clones and a WT clone (transfected with Cas9 and empty sgRNA vectors) were analyzed as indicated.

[0168] Animal experiments

[0169] All experiments using animals were performed according to protocols approved by the local animal experimentation committee of Canton de Vaud (license number 3214). FVBn, Balb / c or C57B / 6, NSG or SCID / beige mice were used at 8 weeks of age. For lung metastasis assays, 2X10^5 mouse PDAC WT or FMRP KO cells suspended in 200μl PBS were injected into the lateral tail vein of mice. For primary tumor growth assays, 5X10^5 cells suspended in 100μl PBS were injected subcutaneously into mice.

[0170] Flow cytometric analysis of tumor-infiltrating lymphocytes

[0171] Flow cytometry was performed using BD LSRII Fortessa, and the results were analyzed using FlowJo software (Treestar). Primary tumor cell suspensions were blocked by mouse Fc blocker (anti-CD16 / CD32; Biolegend, #101312) before staining. Fluorescent dye-conjugated anti-mouse CD45 (clone 30F-11), CD3e (clone 145-2C11), CD8a (clone 53-6.7), granzyme B (clone NGZB), TNFa (MP6-XT22) and IFNg (clone XMG1.2) antibodies were used according to the manufacturer's protocol. Blue UV was used for dead cell staining. In order to analyze the expression of intracellular cytokines, mice carrying sc tumors were injected with 250 μg of protein transport inhibitor BrefaldinA (BD biosciences, #555029) IP 6 hours before sacrifice. Intracellular cytokine staining was then performed using a fixation / permeabilization solution kit (Sigma, B6542-25MG).

[0172] Immunohistochemical staining and immunofluorescence staining

[0173] The obtained mouse tissues were fixed in 4% paraformaldehyde overnight, embedded in paraffin, and sliced ​​by a microtome (Leica). Antigen retrieval was performed in a citrate buffer (pH = 6.0) in a 95°C water bath for 20 minutes, or in a tris-EDTA buffer (pH = 8.0) in a 95°C water bath for 10 minutes. The primary antibody was incubated overnight at 4°C. For immunohistochemistry (IHC) staining, the secondary antibody (ImmPRESS HRP kit, anti-rabbit MP-7401 and anti-rat MP-7444) was incubated at room temperature for 45 minutes, and finally with the peroxidase substrate DAB (Sigma-Aldrich, D5637-1G) at room temperature for the same length of time (up to 10 minutes) for visualization. The stained tissue sections were counterstained with Mayer's hematoxylin. For immunofluorescence (IF) staining, the secondary antibody (Alexa Fluor 488, 568, 647, Thermo Fisher Scientific) was incubated at room temperature for 45 minutes. Images were acquired using a Leica DM5500B and a Zeiss LSM 700 upright confocal microscope and analyzed using Image J. Antibodies used were as follows: FMRP, Abcam, ab191411; mouse CD8, Thermo Fisher Scientific, 14-0808-82.

[0174] Statistical analysis

[0175] Statistical analysis was performed using Prism 7 (GraphPad Software). Unless otherwise indicated, Student's t test was used for unpaired experiments (two-sided). Wilcoxon paired test (two-sided) was used for paired experiments that did not follow a Gaussian distribution. P < 0.05 was considered statistically significant. Values ​​are mean ± SEM.

[0176] result

[0177] A recent study demonstrated that FMRP functions as a downstream effector of NMDAR signaling that promotes the aggressive growth of pancreatic cancer. 16 We further confirmed that in human (data not shown) and mouse PDAC tissues ( Figure 1A ) showed an increase in the expression of FMRP.

[0178] To further explore the role of FMRP in tumor progression, we used the Crisper / Cas9 system 10 FMRP was knocked out in the mouse pancreatic cancer (PDAC) cell line 4361.12 ( Figure 1B ), which is a single-cell derived cell line from the P48-cre;LSL-KrasG12D;P53R172H / +PDAC mouse model in the FvBn background. Importantly, a transient CRISPER strategy for knocking out FMRP was performed to avoid any potential nonspecific effects and immunogenicity mediated by stable Cas9 / sgRNA genomic integration.

[0179] In vitro functional assays showed that there was no significant difference in colony formation ability between WT and FMRP KO PDAC cells ( Figure 1C Considering the possible role of FMRP in metastasis, we first injected WT and FMRP KO cells into the tail vein of immunocompetent FVBn mice, a standard in vivo lung metastasis assay ( Figure 1D Strikingly, two of the five mice injected with FMRP-KO2 cells survived 120 days after injection, whereas all five mice injected with FMRP-WT cells died before 25 days after injection ( Figure 1E When a similar in vivo lung metastasis assay was performed in immunodeficient SCID / beige mice, there was no such significant difference in overall survival between the two groups ( Figure 1F ), suggesting that the adaptive immune system is responsible for the survival benefit observed in mice bearing FMRP-KO tumors. We then turned to a primary tumor model established by subcutaneous injection of cancer cells ( Figure 1HWhen the cells were injected subcutaneously into FVBn mice, tumor growth of FMRP-KO cells was severely impaired compared with FMRP-WT cells, whereas when the cells were injected subcutaneously into immunodeficient NSG mice, no significant changes in tumor weights between the two groups were observed ( Fig. 1I and 1J ), which further suggests that FMRP may play a role in regulating anti-tumor immunity in vivo.

[0180] Importantly, IHC staining of tumors formed by WT and FMRP-KO cancer cells revealed a large number of infiltrating CD8+ cytotoxic T cells in the KO tumors; in stark contrast, there were almost no CD8+ T cells in the WT tumors ( Figure 2A FMRP KO tumors also had an increase in the number of CD45+ immune cells compared to WT tumors ( Figure 2B Consistently, FACS analysis of primary cell suspensions from WT and FMRP-KO tumors further demonstrated that the numbers of CD45+ immune cells, CD3+CD8+ T cells, and GRZb+, IFNγ+, and TNF+ T cells were significantly increased in KO tumors compared with WT tumors ( Figure 2C-2G ), further supporting the role of FMRP in suppressing anti-tumor immunity in vivo. Further double IHC staining of FMRP and CD8 in mouse PDAC tissues revealed that CD8 T cells were almost undetectable in the center of tumors expressing FMRP ( Figure 2H ). We also identified a significant inverse correlation between FMRP expression and CD8 T cell infiltration in human PDAC samples.

[0181] We explored whether the loss of FMRP in cancer cells alters the expression of immune checkpoint proteins to trigger antitumor immune responses. If FMRP-suppressed antitumor immunity depends on the established T cell co-inhibitory PD-1 or CTLA-4 signaling, then the PD-1 ligands PD-L1 / CD274 and PD-L2 / PDCD1LG2, or possibly the CTLA-4 ligands B7 / B7-1 / CD80 and CD86, would be expected to be downregulated in FMRP-KO tumor cells. However, WB analysis and IHC staining showed no changes in PD-L1 expression comparing WT and FMRP KO cells in vitro and in vivo ( Figure 3A -B), while PDL2, CD86, and CD80 were barely detected in both (data not shown), suggesting that the underlying mechanism of FMRP-mediated immune resistance in this PDAC cancer cell line does not involve inhibition of PD-1 or CTLA-4 immune checkpoint ligands.

[0182] In addition, we also conducted preclinical trials using anti-PD1 antibodies against WT tumors formed in immunocompetent FVBn mice, and the results showed that WT PDAC tumors were unresponsive to anti-PD-1 treatment, recapitulating the unresponsiveness of human PDAC patients to anti-PD1 treatment (Figure 3C). Despite this therapeutic resistance to anti-PD1 checkpoint immunotherapy, derived PDAC tumor cells with FMRP KO had significantly impaired tumor growth in vivo (Figure 1), which was associated with the influx of CD8 T cells (Figure 2). The results suggest that FMRP inhibitors may serve as a novel immunotherapeutic strategy for the treatment of PDAC and other tumors that are unresponsive to checkpoint inhibitors. Interestingly, PD1 antibody treatment in FMRP KO tumors further suppressed tumor growth, suggesting that the combination of anti-PD1 antibodies and FMRP knockout has a combined benefit in prolonging survival ( Figure 3D ).

[0183] A recent study demonstrated that ADAR1, an RNA-binding protein that mediates A-to-I RNA hyperediting, promotes resistance to immune checkpoint blockade. 23 Interestingly, another study showed that FMRP also regulates RNA hyperediting in neurons through physical interaction with ADAR1. The strong interaction between FMRP and ADAR1 in mouse PDAC cells was confirmed by co-immunoprecipitation (co-IP) and reverse co-IP ( Figure 4A To determine whether the combination of FMRP and ADAR1 double KO would trigger a stronger antitumor immune response, PDAC cells with ADAR1 single KO and FMRP / ADAR1 double KO were generated using transient transfection of Cas9 / sgRNA vectors targeting FMR1 and ADAR1 genes ( Figure 4C ) and injected into syngeneic mice. Interestingly, the combination of FMRP and ADAR1 KO significantly prolonged overall survival compared with the FMRP single KO and ADAR1 single KO groups ( Figure 4D ), supporting the clinical application of the combination of targeting FMRP and ADAR1 in cancer immunotherapy.

[0184] To more broadly explore the potential role of FMRP in suppressing antitumor immunity in other types of cancer, we performed in vitro fertilization in mouse colon tissue ( Figure 5A ), melanoma tissue ( Fig. 6A ), pancreatic neuroendocrine tumors (PNET), and liver metastases ( Fig. 7A ), breast cancer tissue ( Fig. 8A ) compared with the corresponding normal tissues. The human data are consistent with the mouse data (not shown). Similarly, mouse colon cancer cells ( Figure 6B ) and melanoma cells ( Figure 7B) did not significantly impair colony formation in vitro, which reflects proliferation and survival capacity. However, FMRP KO severely impaired colon tumor growth in syngeneic mice but not in immunodeficient mice. Increased numbers of CD8 T cells were only found in FMRP KO colon tumors but not in WT tumors. FMRP was also knocked out in PanNET tumors developed in the RIP1-Tag2 (RT2) PanNET mouse model, which was obtained by crossing RIP-7cre mice with RT2 mice and FMR1-floxed mice. Importantly, the survival time of FMRP KO RT2 mice was significantly prolonged compared with WT RT2 mice, strongly supporting the role of FMRP in promoting PNET tumor progression.

[0185] Other investigations of FMRP expression in human tumors have shown that FMRP expression is significantly upregulated in 30% to 100% of patients with a broad range of cancer types, including all major forms of lethal solid tumors.

[0186] Example 2

[0187] Direct targeting of RNA binding sites in FMRP using oligonucleotides and peptides to disrupt interactions involved in FMRP effector function

[0188] The RGG and KH2 RNA binding domains of FMRP have been implicated in several studies for its functional activity (e.g., Vasilyev, 2015; Darnell 2005) and for disruption of FMRA-RNA interactions by delivery of a number of competing molecules based on structural knowledge related to these interactions. In one variation of this approach, DNA or RNA oligonucleotides representing the core sequence of the sc1 / kc RNA that binds to the RGG / KH2 domains will be synthesized, respectively. In some embodiments, locked nucleic acid (LNA) technology may be incorporated into the synthesis, aiming to increase the half-life of the oligonucleotides and their binding affinity. In a second variation, polypeptides spanning the RGG and KH2 domains of FMRP will be synthesized and tested. In some embodiments, the polypeptides are conjugated via a polypeptide linker. In both variations, candidates are first tested by delivering the candidate to cultured cancer cells expressing FMRP and scoring for impaired invasiveness in a Boyden chamber assay as previously described (Li & Hanahan 2013; Li, Zeng, et al 2018). Candidate compounds are inoculated into tumors composed of cancer cells expressing FMRP, such as those described in this application, and the subsequent infiltration of CD8 T cells, which would otherwise be excluded due to the expression of FMRP, is assessed. A variation of this approach would use a transfection enhancer to increase the uptake of the candidate oligonucleotide in the tumor.

[0189] Example 3

[0190] Therapeutic inhibition of FMRP by siRNA

[0191] An increasingly well-validated therapeutic strategy involves the delivery of siRNAs that bind to and destroy or block mRNA from being translated into tissues, thereby inhibiting the production of disease-associated proteins (Selvam 2017). In this approach, siRNAs were designed to bind and destroy FMR1 mRNA (encoding FMRP) and tested by delivery into FMRP tumors devoid of CD8 T cells. Infiltration of such cells was scored using knockout tumors described elsewhere in this application as a benchmark. Prior to such in vivo testing, candidate siRNAs (i.e., siCtrl: UAAGG CUAUGAAGAGAUAC (SEQ ID NO: 9); siFMRP#1: AUAAG AGACA ACUUG GUGC (SEQ ID NO: 10); and siFMRP#2: UAACUUCGGAAUUAUGUAG (SEQ ID NO: 11)) were tested in a cancer cell invasion assay, where the inhibitory ability of the prototype siRNAs on FMR1 mRNA is shown in Figure 9. In some embodiments, siRNAs against FMR1 can include additional improvements, such as chemical modifications to enhance stability and activity (Hassler 2018) and / or the use of "transfection" agents to enhance the delivery of nucleic acids to tumor cancer cells.

[0192] Example 4

[0193] Description of a high-throughput biochemical screening method for identifying small molecules that bind to key interaction sites on FMRP

[0194] One well-described interaction mode of FMRP involves its regulation of a select group of mRNAs that contain a G-quadruplex motif that binds to a domain called RGG on the FMRP protein. Binding of the G-quadruplex motif results in altered translation of the targeted mRNA. An RNA called sc1 binds tightly to the RGD domain of FMRP and is widely used as a prototype for FMRP binding to target mRNAs. Therefore, compounds that disrupt sc1 RNA binding to FMRP may represent a) inhibitors of the translational control mechanism involved in FMRP binding to mRNAs, and b) tight binders of the RGG site that do not necessarily inhibit all FMRP functions, in which case other mechanisms of action of FMRP outside of the RGG domain are involved in its newly discovered immunosuppressive activity.

[0195] The second mode of FMRP interaction involves its binding to high affinity RNA targets through its KH2 RNA binding domain (Darnell et al., 2005). Studies have identified a series of RNAs with structural and sequence-specific features, called "kissing complex (kc) RNAs". For example, kc2 RNA is able to compete with polysomes for FMRP at a half-maximal concentration of about 100 nM. Human and mouse studies have shown that single missense mutations in KH2 eliminate FMRP polysome binding and lead to severe forms of fragile X syndrome. Compounds that disrupt kcRNA binding to FMRP may disrupt FMRP polysome binding and abolish its function. The compound may be an agent as disclosed herein. In some embodiments, the agent is a synthetic nucleic acid that disrupts kcRNA binding to FMRP. In some embodiments, the synthetic nucleic acid can serve as a benchmark for screening and identifying other types of small molecule inhibitors that act to disrupt FMRP function.

[0196] Any suitable detection method known in the art for identifying inhibitors of RNA binding proteins can be used to screen compound libraries for small molecules that interfere with the binding of FMRP to its unique target mRNA (see, e.g., Roos et al. 2016). The readout involves identifying compounds that, upon binding, release fluorescence quenching of a fluorophore covalently attached to the protein, whose emission is otherwise blocked by the bound target RNA molecule modified to carry a fluorescence quencher. When applied to FMRP, the method would proceed as follows and is schematically illustrated in FIG10 .

[0197] For example, 1) human FMRP protein is produced in human HEK 293 cells, purified, and biochemically labeled with the fluorescent reporter fluorescein. 2) sc1 RNA will be labeled with a fluorescence quenching molecule such as Cy3 or BHQ so that when sc1 binds to FMRP, the excitable fluorescence emission of FITC is quenched. 3) FITC-FMRP and sc1-Cy3 / BCG are combined and aliquoted into 384-well microwells, and compounds from a large compound library are then added to each well. This assay is best performed in an HTP screening instrument, where a robot will prepare the microwells containing the protein / RNA complex, add the encoding compound to each well, and then read the fluorescence emission. 4) Compounds that elicit quenched fluorescence release will be further characterized to verify their ability to disrupt the interaction between FMRP and sc1. 5) Such "lead compounds" will then be further characterized by microscale thermophoresis (MST) measurements and biofilm interferometry (BLI via ForteBio-Octet) to reveal binding affinity and kinetic parameters. Newly identified compounds will be further characterized by biochemical, structural and cell-based assays and in tumor models to determine whether the compound inhibits the function of FMRP and / or binds tightly to the FMRP protein regardless of functional inhibition. Tight binders may become components of protein degradation molecules designed to selectively degrade the FMRP protein regardless of whether the compound itself proves to be a functional inhibitor.

[0198] Example 5

[0199] Identification of compounds that inhibit FMRP / FMR1 expression

[0200] Cancer cells expressing high levels of endogenous FMRP protein and mRNA will be engineered with the FMRP promoter driving GFP and the ubiquitous promoter driving RFP. A cell-based HTP screen will be performed to score compounds that inhibit green fluorescence (FMRP transcription) but not red fluorescence (cell viability). Since true FMR1 transcriptional inhibitors should inhibit not only the reporter gene but also FMR1 itself, the initial hits will be filtered by immunostaining for endogenously expressed FMRP. A variant is to engineer cell lines with an FMRP promoter driving a fusion gene consisting of FMRP and GFP, and the cells can also be scored for translation and protein stability inhibitors. HTP cell-based screening to identify transcriptional inhibitors is increasingly being successfully applied (see, e.g., Zhang, 2018; Vuong, 2016).

[0201] References

[0202] 1.Hargadon et a.,Immune checkpoint blockade therapy for cancer:Anoverview of FDAapproved immune checkpoint inhibitors.InternationalImmunopharmacology 62:29–39(2018).

[0203] 2.Schoenfeld and Hellman,Acquired Resistance to Immune CheckpointInhibitors.Cancer Cell 37:443-455(April 13,2020)

[0204] 3.Royal,R.E.et al.Phase 2 trial of single agent Ipilimumab

[0205] (anti-CTLA-4)for locally advanced or metastatic pancreaticadenocarcinoma.J.Immunother.33,828–833(2010).

[0206] 4.Brahmer,J.R.et al.Safety and Activity of Anti–PD-L1 Antibody inPatients with Advanced Cancer.New England Journal of Medicine 366,

[0207] 2455–2465(2012).

[0208] 5.Li,L.et al.GKAP Acts as a Genetic Modulator ofNMDAR Signaling toGovern Invasive Tumor Growth.Cancer Cell 0,(2018).

[0209] 6.Bassell,G.J.&Warren,S.T.Fragile X Syndrome:Loss of Local mRNARegulation Alters Synaptic Development and Function.Neuron

[0210] 60,201–214(2008).

[0211] 7.Santoro,M.R.,Bray,S.M.&Warren,S.T.Molecular Mechanisms of Fragile XSyndrome:A Twenty-Year Perspective.Annu.Rev.Pathol.

[0212] Mech.Dis.7,219–245(2012).

[0213] 8.Lucá,R.et al.The Fragile X Protein binds mRNAs involved in cancerprogression and modulates metastasis formation.EMBO Molecular Medicine 5,1523–1536(2013).

[0214] 9.Jeon,S.J.et al.Cellular stress-induced up-regulation of FMRPpromotes cell survival by modulating PI3K-Akt phosphorylationcascades.Journal ofBiomedical Science 18,17(2011).

[0215] 10.Mali,P.et al.RNA-Guided Human Genome Engineering via Cas9.

[0216] Science 339,823–826(2013).

[0217] 11.Vasilyev,N.et al.Crystal structure reveals specific recognition ofa G-quadruplex RNA by aβ-turn in the RGG motif of FMRP.Proc.Natl.

[0218] Acad.Sci.112,E5391–E5400(2015).

[0219] 12.Roos,M.et al.A Small-Molecule Inhibitor of Lin28.ACS Chem.Biol.

[0220] 11,2773–2781(2016).

[0221] 13.Darnell JC,Fraser CE,Mostovetsky O,Stevani G,Jones TA,Eddy SR andDarnell RB.(2005)Kissing complex RNAs mediate interaction between theFragile-X mental retardation protein KH2 domain and brain polyribosomes.GenesDev 19:903-918.

[0222] 14.Vasilyev N,PolonskaiaA,Darnell JC,Darnell RB,Patel DJ,Serganov A.

[0223] (2015).Crystal structure reveals specific recognition of a G-quadruplex RNA by aβ-turn in the RGG motifofFMRP.Proc Natl Acad Sci U S A.

[0224] 112(39):E5391-400.doi:10.1073 / pnas.1515737112.

[0225] 15 Li,L.,&Hanahan,D.(2013).Hijacking the neuronal NMDAR signalingcircuit to promote tumor growth and invasion.Cell.153:86-100.

[0227] 16.Li,L.,Zeng,Q.,Bhutkar,A.,Galvan,J.,Karamitopoulou,E.,Noordermeer,D.,Peng,MW,Piersgilli,A.,Perren,A.,Zlobec,I.,Robinson,H.,Iruela-Arispe,ML,&Hanahan D.(2018) as a modulator of GKAP genetics. NMDAR signaling togovern invasive tumor growth.Cancer Cell,33:736-751.

[0228] 17.Roos M,Pradère U,Ngondo RP,Behera A,Allegrini S,Civenni G,ZagalakJA,Marchand JR,Menzi M,Towbin H,Scheuermann J,Neri D,Caflisch A,Catapano CV,Ciaudo C,Hall J.(2016)A Small-Molecule Inhibitor of Lin ACS28. Biol.11(10):2773-2781.doi:

[0229] 10.1021 / acschembio.6b00232.

[0230] 18.Darnell JC,Fraser CE,Mostovetsky O,Stevani G,Jones TA,Eddy SR andDarnell RB.(2005)Kissing complex RNAs mediate interaction between theFragile-X mental retardation protein KH2 domain and brain polyribosomes.GenesDev 19183-1983.

[0231] 19.Hassler MR,Turanov AA,Alterman JF,Haraszti RA,Coles AH,Osborn MF,Echeverria D,Nikan M,Solomon WE,Roux L,Godinho BMDC,Davis SM,Morrissey DV,Zamore PD,Karumanchi SA,Moore MJ,Aronin N,Khvorova A.(2018).Comparison of partially and fully chemically-modified siRNA in conjugate-mediated delivery in vivo.

[0232] Nucleic Acids Res.46(5):2185–2196.doi:10.1093 / nar / gky037.PMID:29432571

[0234] 20.Selvam C,Mutisya D,Prakash S,Ranganna K,Thilagavathi R.(2017)

[0235] Therapeutic potential of chemically modified siRNA:Recent trends.

[0236] Chem Biol Drug Des.2017 Nov90(5):665-678.doi:10.1111 / cbdd.12993.Epub2017 May 16.PMID:28378934

[0238] 21.Zhang H,et al,Issa JJ.2018 Targeting CDK9 ReactivatesEpigenetically Silenced Genes in Cancer.Cell 175(5):1244-1258.e26.doi:10.1016 / j.cell.2018.09.051.PMID:30454645

[0240] 22.Vuong W,Tew BY,Little GH,Frenkel B,Jones JO.(2016).High-ThroughputScreen for Inhibitors of Androgen Receptor-RUNX2Transcriptional Regulation inProstate Cancer.J Pharmacol Exp Ther.359(2):256-261.doi:10.1124 / jpet.116.234567..PMID:27554677

[0243] 23.Ishizuka et al.,Loss of ADAR1 in tumours overcomes resistance toimmune checkpoint blockade.Nature.2019 Jan;565(7737):43-48.doi:10.1038 / s41586-018-0768-9.Epub 2018 Dec 17.PMID:30559380

[0245] 24.Tran et al.,Widespread RNA editing dysregulation in brains fromautistic individuals.Nat Neurosci.2019 Jan;22(1):25-36.doi:10.1038 / s41593-018-0287-x.Epub 2018 Dec 17.PMID:30559470

Claims

1. An agent that inhibits the expression and / or activity of i) FMRP protein, ii) mRNA encoding FMRP and / or iii) FMR1 gene, or a pharmaceutical composition thereof, for the preparation of a medicament for treating and / or preventing pancreatic cancer and / or pancreatic cancer metastasis in a subject in need thereof, wherein a reduction in FMRP mRNA levels, FMRP protein levels and / or FMRP protein activity would be beneficial, and wherein the agent is selected from the group consisting of nucleic acids encoding siRNA, sg RNA, esiRNA, shRNA, antisense oligonucleotides and CRISPR-based loss-of-function systems, or a combination thereof, and wherein the pancreatic cancer and / or pancreatic cancer metastasis is intrinsically resistant to immunotherapy or has acquired adaptive resistance to immunotherapy.

2. The use of claim 1, wherein the agent is selected from siRNA and a CRISPR-based loss-of-function system.

3. The use according to claim 1, wherein the inhibition of the expression and / or activity of the FMRP protein comprises the regulatory interaction of the FMRP protein with its mRNA target and / or with other proteins.

4. The use according to any one of claims 1 to 3, wherein the agent inhibits encoding Translation of FMRP RNA.

5. The use according to any one of claims 1 to 3, wherein the agent inhibits encoding Transcription of the FMR1 gene of FMRP.

6. The use of any one of claims 1 to 3, wherein the agent inhibits or disrupts the binding of the FMRP to a target mRNA or miRNA.

7. The use according to any one of claims 1 to 3, further comprising one or more anti-cancer therapies.

8. The method of claim 7, wherein the one or more anti-cancer therapies comprise a therapeutically effective amount of an immune checkpoint inhibitor.

9. The use according to claim 8, wherein the immune checkpoint inhibitor is selected from the group consisting of a PD-1 inhibitor, a PD-L1 inhibitor and a CTLA-4 inhibitor or a combination thereof.

10. The use of any one of claims 1 to 3, wherein the one or more anti-cancer therapies targeting FMRP are included in combination with a therapeutically effective amount of an anti-tumor vaccine comprising a personalized tumor neoantigen cocktail or other immunostimulants that enhance anti-tumor immune responses.

Images