Lipid compound, nucleic acid conjugate and application thereof

Abstract

The invention belongs to the field of biological medicine, and particularly relates to a lipid compound, a nucleic acid conjugate and application of the lipid compound and the nucleic acid conjugate, the lipid compound and the nucleic acid conjugate remarkably improve intracellular delivery of nucleic acid, further improve delivery of targeted genes and further achieve a major breakthrough of simultaneous delivery of more than two nucleic acids. The invention also relates to an application of the nucleic acid conjugate in preparation of a medicine for treating gene-related diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to a lipid compound and a nucleic acid conjugate, which significantly improve the intracellular delivery of nucleic acids, improve the delivery of targeted genes, and further achieve a major breakthrough in the simultaneous delivery of multiple nucleic acids. Background Art

[0002] Nucleic acids include ribonucleic acid (RNA) and deoxyribonucleic acid (DNA). As the basic genetic material, nucleic acids not only control the biosynthesis of proteins, but also participate in life growth, inheritance, and mutation. Nucleic acids can maintain the body's normal immune function and immune system growth metabolism; delay aging; improve bone marrow hematopoietic function and the metabolic activity of blood components; eliminate carcinogenic factors; improve dementia; inhibit the formation of lipid peroxides, inhibit the production of cholesterol, dilate blood vessels, improve blood flow, correct myocardial incompensation, and promote vascular wall regeneration; promote cell (including pancreatic insulin-secreting cells) metabolism, and the nucleic acid metabolite adenosine also inhibits the decomposition of sugar, slowing down the absorption of sugar in the small intestine. Therefore, nucleic acids can be used to maintain the immune system, anti-aging, treat anemia, treat cerebral thrombosis, myocardial infarction, hypertension and atherosclerosis, and treat diabetes.

[0003] However, nucleic acids can only enter cells through endocytosis due to their large molecular weight, hydrophilicity and / or charge, but the lipid bilayer of cells may capture and retain about 99% of nucleic acid molecules and cause their degradation. Studies have reported that only 0.3-1% of nucleic acids can enter cells.

[0004] Therefore, how to improve the intracellular delivery of nucleic acids is one of the major technical problems that have been waiting to be solved in the art. In particular, how to effectively deliver two or more nucleic acids into cells at the same time is a new technical problem discovered by the inventors.

[0005] In addition, how to improve the targeted delivery of nucleic acids to specific genes is also one of the technical problems that urgently need to be solved in this field. Summary of the invention

[0006] The technical problems to be solved by the present invention include: how to improve the intracellular delivery of nucleic acids; how to effectively deliver multiple nucleic acids into cells at the same time; and how to improve the targeted delivery of nucleic acids to specific genes.

[0007] In order to solve the above technical problems, the present invention provides a lipid compound with a specific structure and a conjugate using the lipid compound as a conjugate.

[0008] The lipid compounds of the present invention include saturated lipid compounds having a structure as shown in the following formula (A) or (B):

[0009]

[0010] Among them, in the compound represented by formula (A):

[0011] The Q 1 Selected from -NH 2 (amino), -COOH (carboxyl), -NHCO (amide), -O-, -S-, -SS-, phosphate, thiophosphate;

[0012] The Q 2 Selected from -OH (hydroxyl), -NH 2 (amino), -H or -CH 3 (methyl);

[0013] The Q 3 Selected from -H or C1-C10 alkyl;

[0014] The L 1 A saturated alkane chain selected from C1-C10;

[0015] The L 2 A saturated alkane chain selected from C1-C10;

[0016] The X 1 is selected from O or S atoms;

[0017] The X 2 Selected from O, S, -OH (hydroxyl), -NH 2 (amino), -CH 3 (methyl), -CH 2 CH 3 (ethyl), -OCH 3 (methoxy) or -OCH 2 CH 3 (ethoxy);

[0018] The R 1 A saturated fatty acid chain or a saturated alkane chain selected from C10-C30;

[0019] Among them, in the compound represented by formula (B), the five-membered ring is a five-membered ring sugar structure in ribose or deoxyribose, and its 1 position is selected from CH 2 , O, or S:

[0020] The M is selected from H, O, C or a modified or unmodified nucleotide base; preferably, the M is independently selected from adenine, uracil, thymine, guanine or cytosine;

[0021] The N 1 is selected from H or C1-C3 alkyl;

[0022] The Y is selected from H, NH2 , OH, halogen, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, MOE or 2'-O-methoxyethoxy;

[0023] The V is selected from a C1-C4 saturated alkane chain;

[0024] The U is selected from -NH 2 (amino), -COOH (carboxyl), or -NHCO (amide);

[0025] The Z 1 is selected from O or S atoms;

[0026] The Z 2 A saturated lipid chain selected from C10-C30 alkoxy or C10-C30 amide;

[0027] The R 2 Selected from C10-C30 alkoxy, C10-C30 saturated fatty acid chain or C10-C30 amide saturated lipid chain.

[0028] The saturated lipid compound of the present invention comprises at least one selected from the following structures (L1)-(L18):

[0029]

[0030]

[0031] Among them, Nu, Nu 1 、Nu 2 Independent of each other, they represent a specific and independent nucleotide sequence.

[0032] The nucleic acid conjugates of the present invention include oligonucleotide conjugates, which include an oligonucleotide and a conjugate conjugated to the oligonucleotide;

[0033] The conjugate is selected from the saturated lipid compounds described above;

[0034] Preferably, the oligonucleotide conjugate comprises a single-stranded or double-stranded oligonucleotide, preferably with a length of 2-30mer.

[0035] The oligonucleotide conjugate of the present invention includes siRNA, which contains a sense strand and an antisense strand, and each nucleotide in the siRNA is independently a modified or unmodified nucleotide.

[0036] The oligonucleotide conjugates of the present invention include oligonucleotide conjugates in which at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide.

[0037] The oligonucleotide conjugates of the present invention include oligonucleotide conjugates in which all nucleotides in the sense strand and / or antisense strand are modified nucleotides.

[0038] The oligonucleotide conjugates of the present invention include oligonucleotide conjugates in which each nucleotide in the sense strand and / or the antisense strand is independently a fluorine-substituted modified nucleotide or a non-fluorine-substituted modified nucleotide;

[0039] Preferably, the fluorine substitution modification is that the hydroxyl group at the 2' position of the nucleotide is replaced by F;

[0040] Preferably, the non-fluorine substitution modification is that the hydroxyl group at the 2' position of the nucleotide is replaced by an alkoxy group.

[0041] The oligonucleotide conjugate of the present invention comprises at least one selected from the following structures:

[0042]

[0043]

[0044]

[0045] The present invention also provides the use of oligonucleotide conjugates for preparing drugs for treating central nervous system diseases;

[0046] Preferably, the central nervous system diseases include Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Huntington's disease, Parkinson's disease, Dravet syndrome, Charcot triad, Alexander disease, spinocerebellar ataxia or Angelman syndrome.

[0047] The present invention also provides a pharmaceutical composition, which comprises the oligonucleotide conjugate of the present invention and a pharmaceutically acceptable carrier;

[0048] Preferably, the pharmaceutical composition comprises drugs for treating central nervous system diseases.

[0049] It should be noted that the five-membered ring in the structure of formula (B) described above can be a five-membered ring sugar structure in ribose or deoxyribose, i.e., ribo-pentofuranose, which is a ribose structure that can carry a saturated lipid chain. This structure can be embedded in an appropriate position in a nucleic acid sequence, and allow the sequence fragment to carry a saturated lipid chain to achieve the purpose of delivery.

[0050] The lipidic compounds of the present invention can bind to nucleic acids through one or two sites, thereby improving the intracellular delivery of nucleic acids. When the delivered nucleic acid is siRNA, the gene silencing effect can be significantly improved to inhibit the target gene. The lipidic compounds of the present invention can be bonded to the hydroxyl group (e.g., 2, 3, or 5 hydroxyl group) or phosphate group (including thiophosphate group) in the ribose molecule of the nucleic acid. Therefore, as long as there are hydroxyl groups and / or phosphate groups in the ribose molecule of the nucleic acid, the lipidic compounds of the present invention can be combined, and the delivery of the nucleic acid into the cell can be significantly improved.

[0051] When the lipid compound of the present invention binds to the nucleic acid through two sites, it is possible to achieve simultaneous delivery of two or more nucleic acids. The aforementioned nucleic acids include double-stranded nucleic acids and single-stranded nucleic acids. When the lipid compound of the present invention binds to a double-stranded nucleic acid and a single-stranded nucleic acid, the targeted delivery effect for a specific gene is significantly increased relative to binding to a single double-stranded nucleic acid or a single single-stranded nucleic acid.

[0052] In the technical solution of the present invention, the saturated fatty acid chain of C10-C30 includes -(CH 2 ) m -COOH or -(CH 2 ) m -COOR' 16 , m and R' 16 As defined below. In the structural formula of the present invention, the wavy line means, for example, the wavy line in formula (I), The wavy line in the formula, or the wavy line in the L1 formula, The wavy lines in the figure indicate the locations where the chemical structures are connected.

[0053] The present invention also discloses a nucleic acid conjugate, comprising an oligonucleotide and a conjugate conjugated to the oligonucleotide;

[0054] The conjugate is selected from the lipid compound;

[0055] Preferably, the nucleic acid conjugate comprises a single-stranded or double-stranded oligonucleotide, preferably 2-30mer in length.

[0056] In the nucleic acid conjugate of the present invention, the active functional oligonucleotide can be selected from the following nucleic acid substances: small interfering RNA, microRNA, single-stranded RNA, antisense nucleic acid, inducing oligonucleotide, stem-loop RNA, etc. Functional oligonucleotides are composed of single-stranded oligonucleotides or double-stranded oligonucleotides. The small interfering RNA in the present invention is selected from double-stranded oligonucleotides, which contain a sense strand and an antisense strand, and the sense and antisense strands are partially or completely complementary, that is, in a double-stranded nucleic acid molecule, the bases of one strand are paired with the bases on the other strand by hydrogen bond interaction to form a partial or complete complementarity. In the double-stranded oligonucleotide, the purine base adenine (A) is paired with the pyrimidine base thymine (T) or uracil (U); the purine base guanine (G) is always paired with the pyrimidine base cytosine (C). The sequence of the two complementary chains is from 5'- to 3', and the other is from 3' to 5'. Each nucleotide in the small interfering RNA is independently a modified or unmodified nucleotide, and the modification refers to any part of the nucleotide being replaced by other groups. The modification of the 2'-position of the nucleotide can be selected from groups such as 2'-methoxy, 2'-fluoro, 2'-methoxyethyl, 2'-2,4-dinitrophenol, 2'-amino, 2'-4'-cyclolock ethyl, etc. Each nucleoside in the sequence is linked by a phosphodiester bond, in which one oxygen atom in the phosphodiester bond is replaced by a sulfur atom to form a thiophosphate diester bond. The length of a sense strand and an antisense strand sequence usually consists of 19-23 nucleotides, and forms a double-stranded pairing in a complementary manner. The sense strand nucleoside sequence is a nucleotide sequence that is identical to the target mRNA for at least 9 consecutive nucleotides. The antisense strand is usually connected to 2 or more consecutive deoxythymidine nucleotides or 2 or more consecutive uracil nucleotides. In addition, the target mRNA usually refers to the mRNA in the gene in which the protein is abnormally expressed in the cell.

[0057] Specifically, in the nucleic acid conjugate, the oligonucleotide contains a sense strand and an antisense strand, and each nucleotide in the oligonucleotide is independently a modified or unmodified nucleotide.

[0058] Optionally, the sense strand comprises the following nucleotide sequence:

[0059] 5'-CAUUUUAAUCCUCACUAAA-3';

[0060] Optionally, the antisense strand comprises the following nucleotide sequence:

[0061] 5'-UUUAGAGUGAGGAUUAAAAUGAG-3'.

[0062] Specifically, in the nucleic acid conjugate, at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide.

[0063] Specifically, in the nucleic acid conjugate, all nucleotides in the sense strand and / or the antisense strand are modified nucleotides.

[0064] Specifically, in the nucleic acid conjugate, each nucleotide in the sense strand and / or the antisense strand is independently a fluorine-substituted modified nucleotide or a non-fluorine-substituted modified nucleotide;

[0065] Preferably, the fluorine substitution modification is that the hydroxyl group at the 2' position of the nucleotide is replaced by F;

[0066] Preferably, the non-fluorine substitution modification is that the hydroxyl group at the 2' position of the nucleotide is replaced by an alkoxy group.

[0067] The present invention also discloses the use of the nucleic acid conjugate in preparing drugs for treating central nervous system diseases.

[0068] The present invention also discloses a pharmaceutical composition, comprising the nucleic acid conjugate and a pharmaceutically acceptable carrier.

[0069] Preferably, the pharmaceutical composition comprises drugs for treating central nervous system diseases.

[0070] The lipid compounds and nucleic acid conjugates described in the present invention relate to nucleic acids, such as small nucleic acid drugs. Through the design of a series of lipid compounds and nucleic acid conjugates and nucleotide conjugates formed therefrom, as well as the optimization and modification of nucleic acid and nucleotide structures, the ability to deliver nucleic acids is greatly improved, so that nucleic acids can better act on cells, thereby improving the delivery of nucleic acids for targeted genes.

[0071] The lipid compound provided by the present invention has the advantages of low raw material cost, simple synthesis method, few synthesis steps, high synthesis yield, etc. For example, the price of the starting material for preparing the key lipid compound of the present invention is as follows: 2,2-bis(hydroxymethyl)propionic acid 4767-03-7 analytical purity 99%, ￥23 / kg. The present invention adopts a common esterification reaction in the chemical field, and does not involve complex purification and separation, chiral stereospecificity and other processes. The lipid ester preparation process of the present invention is a four-step reaction. In the field, even if the yield of each step of the reaction is 80%, the total yield can only be at most 40%. However, the average overall reaction yield (Overall Yield) of the present invention is 45-50%, which is of great significance to industrialization.

[0072] The lipid compound has multiple connection points, which increases the connection design of the active compound and has a certain promoting effect on the research of active drugs. The lipid compound contains an unsaturated fatty acid carrier, preferably with a multifunctional alkane straight chain or branched chain as a carrier linker. The lipid compound can be directly or indirectly connected to any active drug. For example, an active drug connected by a linker. The lipid compound can also be directly or indirectly connected to oligonucleotides, cholesterol, polypeptides, nanoparticles, aptamers, antibodies, nanoantibodies, small molecules, or any agent with clinical application value. For example, the lipid compound can be embedded in the sense chain or antisense chain of the nucleic acid to effectively improve the targeted delivery performance of the nucleic acid; preferably, the lipid compound can be embedded in the sense chain or antisense chain of the siRNA; preferably, the lipid compound can be embedded in the single-stranded antisense oligoribonucleic acid.

[0073] The target genes of the lipid nucleic acid conjugate provided by the present invention include, but are not limited to: APP, SOD1, HTT, MeCP2, DUX4, HDAC2, GPR75, Ataxin 1, Ataxin 2, Ataxin 3, Ataxin 6, Ataxin 7, C9ORF72, UBE3A, Prion, PMP22, Tau, LRRK2, LINGO2, GYS1, KCNT1, IRF5, Progranulin, GFAP, TARDBP, SNCA, FUS, SCA1, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK, MAPT, and TTR, etc. By targeting the aforementioned genes, the conjugates of the present invention can be used to treat diseases related to the aforementioned genes, such as Alzheimer's disease, senile dementia (genes: APP, HDAC2, MAPT / tau), amyotrophic lateral sclerosis (genes: SOD1, C9orf72, TARDBP, FUS), Huntington's disease (genes: HTT, ATXN6), Rett syndrome (gene: MeCP2), facioscapulohumeral muscular dystrophy (gene: DUX4), obesity (gene: GPR75), spinocerebellar ataxia (genes: ATXN1, ATXN2, ATXN3, ATXN6, ATXN7), Angelman syndrome (gene: UBE3A), Creutzfeldt-Jakob disease / variant Creutzfeldt-Jakob disease / Gerstmann-Straussler-Scheinker syndrome / fatal familial insomnia (gene: Prion), Charcot-Marie-Tooth disease (gene: PMP22), Parkinson's disease (genes: LRRK2, LINGO2, SNCA), glycogen synthase deficiency (gene: GYS1), epilepsy (gene: KCNT1), inflammation (gene: IRF5), frontotemporal dementia (genes: Progranulin, FUS), Alexander disease (gene: GFAP), multiple system atrophy (gene: SNCA), dementia with Lewy bodies (gene: SNCA), myotonic dystrophy type 1 (gene: DMPK), and polyneuropathy (gene: TTR). It can be seen therefrom that after knowing the disclosure of the present application, for specific diseases related to genes, those skilled in the art can reasonably select the corresponding nucleic acid targeting a specific gene and conjugate it with the lipid compound of the present invention to form a corresponding conjugate, and the resulting conjugate is also included within the scope of the present invention.

[0074] When forming a nucleic acid conjugate containing one or more than two nucleic acids through the specific lipid compound of the present invention, a significant improvement in intracellular delivery of nucleic acids is achieved, and the inhibitory level of nucleic acids against mRNA is significantly increased.

[0075] In the field of nucleic acid delivery, intracellular delivery of a nucleic acid, such as a double-stranded nucleic acid, has been difficult to achieve. Therefore, in the art, related technical improvements are usually limited to how to improve the delivery of a nucleic acid, and those skilled in the art have no motivation to try to deliver two nucleic acids, such as double-stranded and single-stranded, at the same time. However, the inventors pioneered bold attempts at two nucleic acids and related lipid compounds, and unexpectedly found that: a conjugate conjugated with double-stranded and single-stranded nucleic acids can be formed by the lipid compound of the specific structure of the present invention, and the conjugate achieves significant improvement in intracellular delivery and significantly improves the inhibition level of mRNA. More surprisingly, the inventors also found that: in terms of intracellular delivery of nucleic acids and inhibition of mRNA, the conjugate of the present invention achieves a synergistic effect, that is, an effect superior to the use of double-stranded nucleic acids or single-stranded nucleic acids alone is achieved, and a synergistic effect of 1+1 greater than 2 is achieved.

[0076] Therefore, the present invention achieves a groundbreaking contribution in the field of nucleic acid delivery through specific lipid compounds. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:

[0078] Figure 1 is the residual SOD1 mRNA level of rat B35 cells in (1) of Example 10;

[0079] Figure 2 is the residual SOD1 mRNA level in the brain of SD rats in (2) of Example 10;

[0080] Figure 3 is the residual SOD1 mRNA level in the brain of SD rats in (3) of Example 10;

[0081] Figure 4 is the remaining AT×N3 mRNA level in the mouse brain in (4) of Example 10;

[0082] Figure 5 is the residual SOD1 mRNA level in the brain of SD rats in (5) of Example 10;

[0083] Figure 6 is the residual SOD1 mRNA level in rat brain in (6) of Example 10;

[0084] Figure 7 is the residual SOD1 mRNA level in rat brain in (7) of Example 10;

[0085] Figure 8The remaining human MAPT mRNA level in the mouse brain in (8) of Example 10;

[0086] Fig. 9 is the residual SOD1 mRNA level in rat brain in (9) of Example 10;

[0087] Fig.10 is the residual SOD1 mRNA level in rat brain in (10) of Example 10;

[0088] Fig.11 is the residual SOD1 mRNA level in rat brain in (11) of Example 10;

[0089] Fig.12 is the residual SOD1 mRNA level in each region of the rat brain in (12) in Example 10;

[0090] Fig.13 This is the residual SOD1 mRNA level in rat brain in (13) of Example 10. DETAILED DESCRIPTION

[0091] The present invention includes the following embodiments.

[0092] Embodiment 1: A lipid compound having a structure shown by the following formula (I), (II) or (V):

[0093]

[0094] Among them, the W 1 Select from direct key or

[0095] X' 1 is selected from O or S atoms, or is absent;

[0096] When X' 1 When X is selected from O or S atoms, 2 Selected from -O, -S-, -SH, -OH (hydroxyl), -NH 2 (amino), C1-C6 alkyl, C1-C6 alkoxy, or -O-(CH 2 ) n， -OR' 5 , R' 5 Select from H, direct key or R' 6 H or direct key, X 1 is selected from O or S atoms, X 4 is -OH or -SH, n' is an integer from 1 to 10; when X' 1 When not present, the X 2 It is a direct connection key;

[0097] The T 1 Selected from -(CH 2 ) m CH 3 , m is an integer from 10 to 30; or,

[0098]

[0099] Among them, the Q 1 and Q 4 Each independently selected from a direct bond, -NH 2 (amino), -COOH (carboxyl), amide (-NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, or thiophosphate;

[0100] The Q 2 Selected from -SH, -OH (hydroxyl), -NH 2 (amino), -H, C1-C6 alkyl, preferably -CH 3 (methyl), -COOH (carboxyl), amide (-NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, thiophosphate, or R' 7 H or direct key, X 1 and X 4 As defined above;

[0101] The Q 3 Selected from -H or C1-C10 alkyl;

[0102] The L 1 For -(CH 2 ) l -(NR' 4 ) t -(CH 2 )q-, l and q are integers of 0-10 and l+q=1-10, t is 0 or 1, R' 4 -CO(CH 2 ) r COOH, r is an integer from 10 to 30;

[0103] The L 2 and L 3 Each independently selected from a C1-C10 saturated alkane chain or a direct bond;

[0104] The R' 1 Selected from C10-C30 saturated fatty acid chains, C10-C30 saturated alkane chains, C10-C30 unsaturated hydrocarbon groups or -(CH 2 ) m-X 3 -R' 3 , m is an integer between 10 and 30, X 3 is selected from a direct bond, an oxygen atom or a sulfur atom, R' 3 is selected from a saturated six-membered heterocyclic group containing nitrogen and oxygen, H, a direct bond, or R' 6 , X 1 and X 4 As defined above; when X 3 When it is a direct key, R' 3 Not H, direct key;

[0105] When W 1 When it is a direct key, T 1 Not for-(CH 2 ) m CH 3 ;

[0106]

[0107] In formula (II) and (V), the five-membered ring is a five-membered ring sugar structure in ribose or deoxyribose, wherein X 5 Selected from -CH 2 -、-CH(CH 3 )-、-C(CH 3 ) 2 -、-O-、-NH-、-N(CH 3 )-or-S-;

[0108] The M' is selected from H, -O-, -C- or a modified or unmodified nucleotide base;

[0109] The N 1 Selected from direct bond, H, C1-C3 alkyl or R' 8 is H or a direct bond, the X 1 and X 4 As defined above;

[0110] N 2 is selected from a direct bond, H or a C1-C3 alkyl group;

[0111] The Y is selected from H, NH 2 , OH, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -OR' 9 or -O-(CH 2 ) n -OR' 10 , R' 9 is C1-C6 alkyl, preferably -O-CH 3 , n is an integer from 1 to 6, R'10 is a C1-C6 alkyl group, preferably n is 2, R' 10 is C1 alkyl, i.e. 2'-methoxyethoxy;

[0112] Said V is selected from a C1-C4 saturated alkane chain or does not exist;

[0113] The U' is selected from -NH 2 (amino), -COOH (carboxyl), amide (-NHCO- or -CONH-) or absent;

[0114] The Z 1 is selected from O or S atoms;

[0115] The Z 2 Selected from C10-C30 alkoxy, fatty acid chain, preferably terminal carboxyl fatty acid, amide lipid chain, olefin chain, or alkane chain;

[0116] The R' 2 Alkoxy groups selected from C10-C30, fatty acid chains, preferably terminal carboxyl fatty acids, amide lipid chains, olefin chains, alkane chains or absent.

[0117] Embodiment 2: The lipid compound according to embodiment 1 has the structure shown in formula (I):

[0118] When W 1 for When X' 1 is selected from O or S atoms;

[0119] T 1 Selected from

[0120] in,

[0121] The Q 1 and Q 4 Select from direct bond, -NH 2 (amino), -COOH (carboxyl), amide (-NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, or thiophosphate;

[0122] The Q 2 Selected from -SH, -OH (hydroxyl), -NH 2 (amino), -H, C1-C6 alkyl, preferably -CH 3 (methyl), -COOH (carboxyl), amide (NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, thiophosphate or

[0123] The Q3 Selected from -H or C1-C10 alkyl;

[0124] The L 2 and L 3 A saturated alkane chain or a direct bond selected from C1-C10;

[0125] The X 1 is selected from O or S atoms;

[0126] The X 2 Selected from -O-, -S-, -SH, -OH (hydroxyl), -NH 2 (amino), C1-6 alkyl, preferably -CH 3 (methyl), -CH 2 CH 3 (ethyl), C1-6 alkoxy, preferably -OCH 3 (methoxy), -OCH 2 CH 3 (ethoxy) or -O-(CH 2 ) n -OR' 5 , R' 5 Select from H, direct key or

[0127] The R' 1 Selected from C10-C30 saturated fatty acid chains, C10-C30 saturated alkane chains, C10-C30 unsaturated hydrocarbon groups or -(CH 2 ) m -X 3 -R' 3 , m is an integer between 10 and 30, X 3 is selected from a direct bond, an oxygen atom or a sulfur atom, R' 3 is a saturated six-membered heterocyclic group containing nitrogen and oxygen, H, a direct bond or

[0128] Embodiment 3. The lipid compound according to embodiment 2, wherein Q 1 and Q 4 All are amide groups (-NHCO- or -CONH-); Q 2 Selected from -SH, -OH (hydroxyl), -S-, -O- or

[0129] R' 1 is selected from a C10-C30 saturated fatty acid chain, a C10-C30 saturated alkane chain, preferably a C13-16 saturated alkane chain, more preferably a C15 saturated alkane chain, a C10-C30 unsaturated hydrocarbon group or -(CH 2 ) m -X3 -R' 3 , m is an integer from 10 to 30, preferably an integer from 2 to 5, more preferably 3, X 3 is selected from a direct bond, an oxygen atom or a sulfur atom, R' 3 is a saturated six-membered heterocyclic group containing nitrogen and oxygen, H, a direct bond or

[0130] Embodiment 4. The lipidic compound according to Embodiment 3, wherein L 1 is -(CH 2 ) l -(NR’ 4 ) t -(CH 2 )q-, t is 0.

[0131] Embodiment 5. The lipidic compound according to Embodiment 3, wherein L 1 is -(CH 2 ) l -(NR’ 4 ) t -(CH 2 )q-, l + q = 1 - 10, t is 1;

[0132] L 2 is selected from a C1-C10 saturated alkane chain or a direct bond;

[0133] L 3 is a direct bond;

[0134] Q 2 is H;

[0135] Q 3 is selected from -H or a C1-C10 alkyl group;

[0136] R’ 1 is -(CH 2 ) m -X 3 -R' 3 , m is an integer from 10 to 30, X 3 is selected from an oxygen atom or a sulfur atom, R’ 3 is H, a direct bond or

[0137] Embodiment 6. The lipidic compound according to Embodiment 2, wherein Q 1 is a direct bond, Q 4 is an amide group (-NHCO- or -CONH-);

[0138] L 1 is -(CH 2 ) l-(NR' 4 ) t -(CH 2 )q-, l+q=1-10, t is 0;

[0139] L 2 is a C1-C10 saturated alkane chain;

[0140] L 3 It is a direct connection key;

[0141] Q 2 Selected from -SH, -OH (hydroxyl), -S-, -O- or R' 7 and X 4 As defined above.

[0142] Embodiment 7, according to any one of embodiments 1-6, the lipid compound W 1 For direct connection key, Q 2 Selected from -SH, -OH (hydroxyl) or R' 7 is H, and R' 1 Middle R' 6 is not a direct key; or,

[0143] W 1 For direct connection key, Q 2 Selected from -S-, -O- or And R' 7 is a direct key, and R' 1 Middle R' 6 is not a direct key; or,

[0144] W 1 For direct connection key, Q 2 Not -S-, -O- and -SS-, when Q 2 for When R' 7 is H, and R' 1 For -(CH 2 ) m -X 3 -R' 3 , R' 3 For direct connection keys or R' 6 is a direct key; or,

[0145] W 1 for X 2 Selected from -OH or -SH, Q 2 is selected from -SH or -OH (hydroxyl), and R' 1 Middle R' 3 and R'6 is not a direct key; or,

[0146] W 1 for X 2 Selected from -OH or -SH, Q 2 Selected from -S-, -O- or R' 7 is a direct key, and R' 1 Middle R' 3 and R' 6 is not a direct key; or,

[0147] W 1 for X 2 Selected from -OH or -SH, Q 2 Not -S-, -O- and -SS-, when Q 2 for When R' 7 H; R' 1 Middle R' 3 For direct connection, or when R' 3 for When R' 6 It is a direct connection key;

[0148] Preferably, W 1 is a direct bond, and the wavy line of formula (I) is connected to X 6 , X 6 With the following structure R' 11 and R' 12 Each is independently selected from C1-C6 alkyl; Q 1 is a direct bond or an amide group (-NHCO- or -CONH-), Q 4 is an amide group (-NHCO- or -CONH-); Q 2 Selected from -S-, -O- or H; L 1 For -(CH 2 ) l -(NR' 4 ) t -(CH 2 )q-, l and q are integers from 0 to 10 and l+q=1 to 10, t is 0 or 1; when Q 2 When H, L 3 is a direct bond and t is 1; when Q 2 When it is -S- or -O-, Q 2 Connect X 7 , X 7 is selected from (B'1) or (B'2),

[0149]

[0150] Among them, R' 13 and R' 14 Each is independently selected from C1-C6 alkyl, and n is an integer of 1-6;

[0151]

[0152] Among them, R' 15 is a C1-C6 alkyl group; R' 1 Selected from C10-C30 saturated alkane chains, C10-C30 unsaturated hydrocarbon groups or -(CH 2 ) m -X 3 -R' 3 , m is an integer between 10 and 30, X 3 is selected from a direct bond, an oxygen atom or a sulfur atom, R' 3 is selected from a saturated six-membered heterocyclic group containing nitrogen and oxygen or a direct bond; when Q 2 When H, R' 3 is a direct key, R' 3 connect R' 18 and R' 19 Each is independently selected from C1-C6 alkyl, n is an integer of 1-6, or,

[0153] Preferably, W 1 for X' 1 does not exist, the X 2 is a direct bond; the wavy line of formula (I) is connected to -(CH 2 ) n -OX 6 , n is an integer from 1 to 6, X 6 As defined above; T 1 For -(CH 2 ) m CH 3 ;X 2 Connect-N(R' 20 ) 2 , R' 20 It is a C1-C6 alkyl group, preferably a C3 alkyl group, and more preferably an isopropyl group.

[0154] Embodiment 8: According to any one of embodiments 1 to 7, the lipid compound, in formula (I), R' 1 is a saturated fatty acid chain of C10-C30, wherein the saturated fatty acid chain of C10-C30 is -(CH 2 ) m -COOH or -(CH 2 ) m-COOR' 16 , m is an integer of 10-30, R' 16 An alkyl group selected from C1-C6 or Best The C1-C6 alkyl group is preferably methyl, ethyl, isopropyl or tert-butyl. 17 is halogen, preferably Cl;

[0155] R' 1 is a C10-C30 unsaturated hydrocarbon group, wherein the C10-C30 unsaturated hydrocarbon group is -(CH 2 ) m -R' 4 , m is an integer of 10-30, R' 4 is an unsaturated bond, preferably a triple bond; or

[0156] R' 1 For -(CH 2 ) n -X 3 -R' 3 , the -(CH 2 ) n -X 3 -R' 3 In, R' 3 is a saturated six-membered heterocyclic group containing nitrogen and oxygen, X 3 With R' 3 The nitrogen atom is bonded, preferably, R' 3 In the six-membered heterocyclic ring, the six-membered heterocyclic ring contains a nitrogen atom and an oxygen atom and the nitrogen atom and the oxygen atom are located at the para position of the six-membered heterocyclic ring; and / or,

[0157] X 2 Selected from -OH, -SH, -CH 3 (methyl), -CH 2 CH 3 (ethyl), -OCH 3 (methoxy) or -OCH 2 CH 3 (ethoxy), preferably -OH or -SH.

[0158] Embodiment 9. The lipid compound according to embodiment 1, wherein W 1 for

[0159] X' 1 O or S; X 2 For -(CH 2 ) n， -OR' 5 , R' 5 Select from H, direct key or X1 , R' 6 and X 4 As defined above, n' is an integer from 1 to 10; T 1 For -(CH 2 ) m CH 3 , m is an integer from 10 to 30.

[0160] Embodiment 10. The lipid compound according to embodiment 9, wherein R' 5 Select from direct key or R' 6 For direct connection key.

[0161] Embodiment 11: The lipid compound according to any one of embodiments 1 to 10, wherein the wavy line in formula (I) is connected to H or X 6 .

[0162] Embodiment 12: The lipid compound according to Embodiment 1, having the structure shown in Formula (II) or (V), N 1 For direct key, H, or

[0163] N 2 Select from direct bond or H;

[0164] Y is a C1-C6 alkoxy group;

[0165] M' is selected from -O-, -C-, or a modified or unmodified nucleotide base;

[0166] When M' is a modified or unmodified nucleotide base, U', V and R' 2 Preferably, M' is independently selected from adenine, uracil, thymine, guanine or cytosine; More preferably, M' is selected from or,

[0167] When M' is -O- or -C-, V is a C1-C4 saturated alkane chain, U' is an amide group (-NHCO- or -CONH-), R' 2 An alkane chain.

[0168] Embodiment 13: According to the lipid compound of embodiment 12, the M' is independently selected from adenine, uracil, thymine, guanine or cytosine; preferably

[0169] Embodiment 14: The lipid compound according to embodiment 12 or 13 has a structure shown in formula (II) or (V), wherein X 5 It is O or S.

[0170] Embodiment 15. The lipid compound according to any one of embodiments 12 to 14, wherein N 1 Not a direct link, and R' 8 Not a direct key, and N 2 is a direct bond; preferably, N 2 Connect X 7 or,

[0171] N 1 is a direct key, or And R' 8 is a direct key, and N 2 Not a direct bond; preferably, N 1 Connect X 6 ;or,

[0172] N 1 is a direct key, or And R' 8 is a direct key, and N 2 is a direct bond; preferably, N 1 Connect X 6 , N 2 Connect X 7 .

[0173] Embodiment 16. The lipid compound according to any one of embodiments 12 to 15, wherein N 1 、N 2 and R' 8 For a direct key, connect H.

[0174] Embodiment 17. The lipidic compound according to Embodiment 1, wherein the lipidic compound is selected from at least one of the following structures (L1)-(L36) and (L'10):

[0175] Table 1

[0176]

[0177]

[0178] Among them, U is After knowing the disclosure of this application, a person skilled in the art can reasonably infer that L'10 and L'10' shown below can synthesize nucleic acid conjugates, and L'10' can synthesize conjugate L'10":

[0179] Based on the disclosure of the present application, those skilled in the art can also reasonably infer that a conjugate in which U is replaced by other bases (e.g., A, G, C) can be prepared by a method similar to the preparation of L10″, and the conjugate can also achieve the technical effect of the present invention and solve the technical problem of the present invention.

[0180] Embodiment 18: The lipid compound according to Embodiment 1, wherein the lipid compound is selected from at least one of the following structures (L1')-(L36') and (L'10'):

[0181] Table 2

[0182]

[0183]

[0184]

[0185] Wherein, E is selected from O and S, and U is

[0186] Embodiment 19, a nucleic acid conjugate, comprising a nucleic acid and a conjugate conjugated to the nucleic acid;

[0187] The conjugate is selected from the lipid compound described in any one of embodiments 1-18.

[0188] Embodiment 20: The nucleic acid conjugate according to embodiment 19, wherein the conjugate is conjugated to a phosphate group or a hydroxyl group of ribose of the nucleic acid.

[0189] Embodiment 21. The nucleic acid conjugate according to embodiment 20 has the following structure:

[0190] Nu——O——W 1 ——T 1 ;

[0191] Formula (III)

[0192]

[0193] Wherein, Nu is a nucleic acid or a nucleic acid fragment, and other variables are defined as in Embodiments 1 to 18. Those skilled in the art can reasonably exclude the related technical solutions in Embodiments 1 to 18 that cannot conjugate nucleic acids or nucleic acid fragments.

[0194] Embodiment 22: The nucleic acid conjugate according to embodiment 21 has a structure of formula (III) or formula (VI), wherein X2 is -O-(CH 2 ) n， -OR' 5 , R'5 Select from direct key or R' 6 is a direct bond, n' is an integer from 1 to 10; or,

[0195] Q 2 Selected from -O-, -S- or R' 7 Select from direct keys; or,

[0196] R' 1 Selected from -(CH 2 ) m -X 3 -R' 3 , m is an integer between 10 and 30, X 3 Selected from oxygen atoms or sulfur atoms, direct bonds or R' 6 Select from direct keys;

[0197] or,

[0198] Having the structure of formula (IV) or formula (VI), wherein N 1 For direct connection keys or R' 8 Select from direct keys.

[0199] Embodiment 23: According to the nucleic acid conjugate of embodiment 21, Nu is a nucleic acid or a nucleic acid fragment, and other variables are defined as in any one of embodiments 7-10, 12-15 and 17-28.

[0200] Embodiment 24: According to any one of embodiments 21-23, the direct bond is conjugated to a nucleic acid or a nucleic acid fragment. The direct bond includes a direct bond of "-O" and "-S-" that can be conjugated to a nucleic acid and a fragment thereof. A person skilled in the art can reasonably understand that the direct bond does not include a direct bond that cannot be conjugated to a nucleic acid or a nucleic acid fragment.

[0201] Embodiment 25. According to the nucleic acid conjugate according to any one of embodiments 21-24, the nucleic acid is selected from single-stranded nucleic acids and fragments thereof or double-stranded nucleic acids and fragments thereof, the double-stranded nucleic acids and fragments thereof preferably have a length of 12-30mer, and the double-stranded nucleic acids and fragments thereof are preferably siRNA and fragments thereof; preferably, the molecular weight range of the double-stranded nucleic acids and fragments thereof is: 6000-20000 Daltons; the single-stranded nucleic acids and fragments thereof preferably have a length of 12-30mer, and the single-stranded nucleic acids and fragments thereof are preferably single-stranded phosphosulfate oligonucleotides and fragments thereof; preferably, the molecular weight range of the single-stranded nucleic acids and fragments thereof is: 3000-10000 Daltons.

[0202] Embodiment 26. According to the nucleic acid conjugate of Embodiment 25, each nucleotide in the nucleic acid is independently a modified or unmodified nucleotide, or two adjacent nucleotides in the nucleic acid are linked by a phosphodiester bond, and one or more of the phosphodiester bonds are thiophosphate diester bonds.

[0203] Embodiment 27: The nucleic acid conjugate according to embodiment 25 or 26, wherein each nucleotide in the nucleic acid is independently a fluorine-substituted modified nucleotide or a non-fluorine-substituted modified nucleotide;

[0204] Preferably, the fluorine substitution modification is that the 2'-hydroxyl group of the pentose of the nucleotide is replaced by F;

[0205] Preferably, the non-fluorine substitution modification is that the 2'-hydroxyl group of the pentose of the nucleotide is replaced by an alkoxy group, and the 2'-hydroxyl group is preferably replaced by a methoxy group or a 2'-methoxyethoxy group.

[0206] Embodiment 28. According to the nucleic acid conjugate described in any one of Embodiments 25-27, the conjugate is conjugated to the double-stranded nucleic acid; the double-stranded nucleic acid contains a sense strand and an antisense strand, preferably, the conjugate is conjugated to the 3' or 5' end of the sense strand or the antisense strand; preferably, the conjugate is conjugated to the 3' end of the sense strand.

[0207] Embodiment 29. The nucleic acid conjugate according to any one of embodiments 25-27, wherein one side of the conjugate is conjugated to the double-stranded nucleic acid, and the other side is conjugated to the single-stranded nucleic acid; preferably, one side of the conjugate is conjugated to the sense strand of the double-stranded nucleic acid, and the other side is conjugated to the single-stranded nucleic acid to form the sense strand of the nucleic acid conjugate (e.g., SN-17001, SN-17024); preferably, the single-stranded nucleic acid is located at the 3' (e.g., SN-17024) or 5' end (e.g., SN-17001) of the sense strand of the nucleic acid conjugate; preferably, the single-stranded nucleic acid is located at the 3' end of the sense strand of the nucleic acid conjugate.

[0208] Embodiment 30: The nucleic acid conjugate according to any one of embodiments 28 to 29, wherein the sequence of the sense strand is selected from the following sequences:

[0209] 1) CAUUUUAAUCCUCACUCUAAA (see sequence listing SEQ ID NO.1),

[0210] 2) GCUCAGCAUUGCCUGAAUAAA (see SEQ ID NO. 2 in the sequence listing), or

[0211] 3) UGCAAAUAGUCUACAAACCAA (see sequence listing SEQ ID NO.3),

[0212] The sequence of the antisense strand is selected from the following sequences:

[0213] 4) UUUAGAGUGAGGAUUAAAAUGAG (see sequence listing SEQ ID NO.4),

[0214] 5) UUUAUUCAGGCAAUGCUGAGCUU (see SEQ ID NO.5 in the sequence listing), or

[0215] 6) UUGGUUUGUAGACUAUUUGCACA (see SEQ ID NO. 6 in the sequence listing).

[0216] Embodiment 31. The nucleic acid conjugate according to any one of embodiments 25-27, 29-30, wherein the single-stranded nucleic acid comprises a sequence selected from the following:

[0217] CCGTCGCCCTTCAGCACGCA (see sequence listing SEQ ID NO.7),

[0218] CGTCGCCCTTCAGCACGC (see sequence listing SEQ ID NO.8),

[0219] GTCGCCCTTCAGCACG (see SEQ ID NO.9 in the sequence listing), or

[0220] TCGCCCTTCAGCAC (see sequence list SEQ ID NO.10), preferably, the single-stranded nucleic acid comprises TCGCCCTTCAGCAC. More preferably, the single-stranded nucleic acid is the aforementioned sequence.

[0221] Embodiment 32: The conjugate according to embodiment 19, wherein the conjugate is selected from at least one of the following structures (L1")-(L36") and (L'10"):

[0222] Table 3

[0223]

[0224]

[0225] In the above table, Nu, Nu 1 、Nu 2 Independently represent nucleic acids or nucleic acid fragments; Nu, Nu 1 、Nu 2 It can be the same or different;

[0226] Wherein, E is selected from O or S.

[0227] Embodiment 33, according to embodiment 19, the nucleic acid conjugate has the following structure:

[0228] Table 4

[0229]

[0230]

[0231] Table 5

[0232]

[0233]

[0234] , preferably, E is O.

[0235] Embodiment 34. Use of the nucleic acid conjugate described in any one of Embodiments 19 to 33 for preparing a drug for treating gene-related diseases.

[0236] Embodiment 35. The use described in embodiment 34, wherein the gene is selected from APP, SOD1, HTT, MeCP2, DUX4, HDAC2, GPR75, Ataxin 1, Ataxin 2, Ataxin 3, Ataxin 6, Ataxin 7, C9ORF72, UBE3A, Prion, PMP22, Tau, LRRK2, LINGO2, GYS1, KCNT1, IRF5, Progranulin, GFAP, TARDBP, SNCA, FUS, SCA1, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK, MAPT or TTR.

[0237] Embodiment 36, the use described in any one of Embodiments 34-35, wherein the disease is a central nervous system disease; preferably, the central nervous system disease is selected from Alzheimer's disease, preferably Alzheimer's disease, ALS, Huntington's disease, Parkinson's disease, Dravet syndrome, Charcot triad, Alexander disease, spinocerebellar ataxia or Angelman syndrome; preferably, the disease is selected from Alzheimer's disease, ALS or spinocerebellar ataxia.

[0238] Embodiment 37, the use described in any one of Embodiments 34-36, wherein the drug is an injection or an oral preparation; preferably an injection administered intracranially, intrathecally, subcutaneously, intravenously, or intramuscularly.

[0239] Embodiment 38: A method for treating a gene-related disease, comprising administering to a subject a therapeutically effective amount of the conjugate of any one of embodiments 19-33.

[0240] Embodiment 39. The method described in Embodiment 38, wherein the gene is selected from APP, SOD1, HTT, MeCP2, DUX4, HDAC2, GPR75, Ataxin 1, Ataxin 2, Ataxin 3, Ataxin 6, Ataxin 7, C9ORF72, UBE3A, Prion, PMP22, Tau, LRRK2, LINGO2, GYS1, KCNT1, IRF5, Progranulin, GFAP, TARDBP, SNCA, FUS, SCA1, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK or TTR.

[0241] Embodiment 40, the method described in any one of Embodiments 38-39, wherein the disease is a central nervous system disease; preferably, the central nervous system disease is selected from Alzheimer's disease, preferably Alzheimer's disease, ALS, Huntington's disease, Parkinson's disease, Dravet syndrome, Charcot triad, Alexander disease, spinocerebellar ataxia or Angelman syndrome; preferably, the disease is selected from Alzheimer's disease, ALS or spinocerebellar ataxia.

[0242] Embodiment 41, the method described in any one of Embodiments 38-40, administers the conjugate in the form of an injection or an oral preparation; preferably, the injection is administered intracranially, intrathecally, subcutaneously, intravenously, or intramuscularly.

[0243] Embodiment 42. Use of the lipid compound described in any one of Embodiments 1-18 for preparing the nucleic acid conjugate described in any one of Claims 19-33.

[0244] In the following embodiments of the present invention, lipid compounds with the following structures are designed, which have the structures shown in the following formula (A) or (B):

[0245]

[0246] Among them, in the compound represented by formula (A):

[0247] The Q 1 Selected from -NH 2 (amino), -COOH (carboxyl), -NHCO (amide), -O-, -S-, -SS-, phosphate, thiophosphate;

[0248] The Q 2 Selected from -OH (hydroxyl), -NH 2 (amino), -H or -CH 3 (methyl);

[0249] The Q3 Selected from -H or C1-C10 alkyl;

[0250] The L 1 A saturated alkane chain selected from C1-C10;

[0251] The L 2 A saturated alkane chain selected from C1-C10;

[0252] The X 1 is selected from O or S atoms;

[0253] The X 2 Selected from -O-, -S-, -SH, -OH (hydroxyl), -NH 2 (amino), -CH 3 (methyl), -CH 2 CH 3 (ethyl), -OCH 3 (methoxy) or -OCH 2 CH 3 (ethoxy);

[0254] The R 1 A saturated fatty acid chain or a saturated alkane chain selected from C10-C30;

[0255] Among them, in the compound represented by formula (B):

[0256] The M is selected from H, O, C or a nucleotide base; independently selected from a modified or unmodified base, such as adenine, uracil, thymine, guanine or cytosine;

[0257] The N 1 is selected from H or C1-C3 alkyl;

[0258] The Y is selected from H, NH 2 , OH, halogen, C1-C6 alkyl, C1-C6 haloalkyl, C1-C6 alkoxy, MOE 2'-O-methoxyethoxy;

[0259] The V is selected from a C1-C4 saturated alkane chain;

[0260] The U is selected from -NH2 (amino), -COOH (carboxyl) or -NHCO (amide);

[0261] The Z 1 is selected from O or S atoms;

[0262] The Z 2 A saturated lipid chain selected from C10-C30 alkoxy or C10-C30 amide;

[0263] The R 2Selected from C10-C30 alkoxy, C10-C30 saturated fatty acid chain or C10-C30 amide saturated lipid chain.

[0264] In some embodiments, the saturated lipid chain portion is a C6-C30 acid, such as a straight chain saturated hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, undecanoic acid, dodecanoic acid, tridecanoic acid, tetradecanoic acid, pentadecanoic acid, hexadecanoic acid, heptadecanoic acid, octadecanoic acid, oleic acid, and linoleic acid.

[0265] In some embodiments, optional, arachidonic acid, cis-4,7,10,13,16,19-docosahexaenoic acid, vitamin A, vitamin E, cholesterol, etc., or C6-C30 alcohols (for example, hexanol, heptanol, octanol, nonanol, decanol, undecanol, dodecanol, tridecanol, tetradecanol, pentadecanol, hexadecanol, heptadecanol, octadecyl alcohol, oleyl alcohol, linolenic alcohol, arachidonic acid, cis-4,7,10,13,16,19-docosahexaenoic acid, retinol, vitamin E, cholesterol, etc.).

[0266] In some embodiments, the lipophilic moiety may contain a saturated or unsaturated lipid chain C4-C30 hydrocarbon chain (e.g., C4-C30 alkyl or alkenyl) and an optional functional group selected from the group consisting of: hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide and alkyne. These functional groups can be used to attach the lipophilic moiety to a double-stranded or single-stranded oligonucleotide.

[0267] In some embodiments, the lipophilic moiety contains a saturated or unsaturated C6-C18 hydrocarbon chain, such as a straight chain C6-C18 alkyl or alkenyl group.

[0268] In one embodiment, the lipophilic moiety contains a saturated or unsaturated C16 hydrocarbon chain, such as a straight chain C16 alkyl or alkenyl group.

[0269] In some embodiments, the lipid chain moiety is exemplified as a lipid, cholesterol, retinoic acid, bile acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexanol, hexadecylglycerol, borneol, menthol, 1,3 propanediol, heptadecanyl, palmitic acid, myristic acid.

[0270] In some embodiments, the lipid chain moiety can form a conjugate with the double-stranded ribose by directly linking to the double-stranded ribose. Wherein, the moiety can form a conjugate with the double-stranded ribose via a linker or a carrier.

[0271] In some embodiments, the lipidic chain portion is conjugated to the double-stranded RNA via a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide bond, or triazole with a post-site locking reaction azide-alkyne cycloaddition.

[0272] In some embodiments, at least one lipid chain moiety is conjugated to the start of the 3' end of the sense strand of the duplex RNA.

[0273] In some embodiments, at least one lipid chain moiety is conjugated to the start of the 3' end of the antisense strand of the duplex RNA.

[0274] In some embodiments, at least one lipid chain moiety is conjugated to the start of the 5' end of the sense strand of the duplex RNA.

[0275] In some embodiments, at least one lipid chain moiety is conjugated to the start of the 5' end of the antisense strand of the duplex RNA.

[0276] In some embodiments, at least one lipid chain moiety is conjugated to any position in the middle of the sense strand sequence of the duplex RNA.

[0277] In some embodiments, at least one lipid chain moiety is conjugated to any position within the antisense strand sequence of the duplex RNA.

[0278] In some embodiments, at least one lipid chain moiety is conjugated to the sense strands of two sets of duplex RNAs of different sequences at the 5' and 3' ends.

[0279] In some embodiments, at least one lipid chain moiety is conjugated to the antisense strands of two sets of duplex RNAs of different sequences at the 5' and 3' ends.

[0280] In some embodiments, at least one lipid chain moiety is conjugated to connect the sense strands of two sets of duplex RNAs of different sequences at the 3' and 4' ends.

[0281] In some embodiments, at least one lipid chain moiety is conjugated to the sense strands of two sets of duplex RNAs of different sequences at the 5' and 5' ends.

[0282] In some embodiments, at least one lipid chain moiety is conjugated to the antisense strands of two sets of duplex RNAs of different sequences at the 3' and 4' ends.

[0283] In some embodiments, at least one lipid chain moiety is conjugated to connect the antisense strands of two sets of duplex RNAs of different sequences at the 5' and 5' ends.

[0284] In some embodiments, a phosphate or a phosphate mimetic is added to the 5' end of the antisense strand of the double-stranded RNA.

[0285] In some embodiments, the phosphate mimetic is 5'-vinylphosphonate (VP).

[0286] In some embodiments, the phosphate mimetic is a 5'-phosphonothioate.

[0287] In some embodiments, the phosphate mimetic is 5'-phosphonic acid methoxythioate.

[0288] In some embodiments, the end of the sense or antisense strand of the double-stranded RNA contains at least one chiral phosphorus atom. In the scheme of the present invention, the chiral modification can occur in the sense strand or antisense strand of the double-stranded siRNA. Each chirally pure phosphorus atom can be in the Rp configuration or the Sp configuration and combinations thereof (Iyer, RP; Gou, M; Yu, D. and Agrawal, S. "Stereoselective Synthesis of Oligonucleoside Phosphorothioates: The Nucleoside Bicyclic Oxazaphospholidines as a Novel Synthons' Tetrahedron Letters, 1998, 39, 2491; Yu, D.; Kandimalla, ER; Roskey, A.; Zhao, Q.; Chen, L; Chen, J. and Agrawal, S. "Stereo-Enriched Phosphorothioate Oligonucleotides: Synthesis, Biophysical and Biological Properties" Bioorganic & Medicinal Chemistry, 2000, 8, 275).

[0289] In some embodiments, the siRNA further comprises at least one ASGPR ligand, ASGPR (asialoglycoprotein receptor) is a lectin highly expressed on hepatocytes, which can efficiently remove glycoproteins in the blood circulation. ASGPR can effectively bind to asialoglycoproteins, so ASGPR ligands are used for liver-specific delivery. For example, ASGPR ligands are derivatives of one or more galactosamines connected by a multifunctional linker (CN 114763367 A), such as:

[0290]

[0291]

[0292] In the following examples of the present invention, the synthesis of the lipid compounds can be carried out by methods known and feasible in the art. For example, the synthesis of the following compounds can be carried out by various pathways and routes known in the art.

[0293]

[0294]

[0295] In the aforementioned synthetic route, the relevant English meanings are as follows:

[0296] Palmitic acid stands for palmitic acid;

[0297] HATU is the abbreviation for 2-(7-azobenzotriazole)-N,N,N′,N′-tetramethyluronium hexafluorophosphate;

[0298] DIPEA is the abbreviation for N,N-diisopropylethylamine;

[0299] DMF is the abbreviation for dimethylformamide;

[0300] EDCl is the abbreviation for 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide;

[0301] HOBT is the abbreviation for 1-hydroxybenzotriazole;

[0302] DCM is the abbreviation for dichloromethane;

[0303] DMT-Cl is the abbreviation for 4,4′-dimethoxytriphenylmethane;

[0304] Pyridine is the abbreviation of pyridine;

[0305] ACN is the abbreviation for acetonitrile;

[0306] yr is the abbreviation of pyridine;

[0307] HCl is the abbreviation for hydrochloric acid;

[0308] EtOAc is the abbreviation for ethyl acetate;

[0309] DMAP is the abbreviation for 4-dimethylaminopyridine;

[0310] E 3 N is the abbreviation for triethylamine;

[0311] NMM is the abbreviation for 4-methylmorpholine.

[0312] The synthesis routes of the above compounds are intended to illustrate that the synthesis of lipid compounds with different structures in the present invention can be carried out based on different routes in the art, and those skilled in the art can select appropriate synthesis routes and synthesis conditions according to their own raw materials and conditions.

[0313] Example 1

[0314] This example designs and synthesizes a linker with a multifunctional group having the following structure:

[0315]

[0316] In this embodiment, the multifunctional linkers listed all have the characteristics of polyhydroxylamine and polyhydroxycarboxyl groups, and these functional groups can be used to independently connect different functional compounds to achieve the overall effect of the designed molecule. For example, the hydroxyl group is positioned to connect small nucleic acid fragments, and more than two different independent sequence fragments can be independently connected. The amine or carboxyl group is connected to a functional group that is relatively stable under various conditions, such as a lipid alkane chain (saturated or unsaturated), a functional group molecule of polyethylene glycol or cholesterol.

[0317] Example 2

[0318] According to the structure of the aforementioned lipid compound, the phosphoramidite structure of the lipid compound monomer of the following structure is designed in this embodiment. The specific structure is shown in Table 6 below.

[0319] Table 6 Lipid phosphoramidite structures

[0320]

[0321]

[0322]

[0323] The English meanings of the above table are as follows:

[0324] Alkyl subsitituted group refers to an alkane substituent;

[0325] Methyl is the abbreviation of methyl;

[0326] Ethyl is the abbreviation of ethyl;

[0327] i-Propyl is the abbreviation of isopropyl;

[0328] t-Butyl is the abbreviation of tert-butyl;

[0329] i-Pr is the abbreviation for isopropyl.

[0330] In this embodiment, the phosphoramidite of this partial structure is a very key chemical reagent in the subsequent solid phase synthesis. Since phosphoramidite is a chemical structure of trivalent phosphorus, it has a very high chemical reactivity, which plays a key role in improving the yield. Since the subsequent synthesis adopts a solid phase synthesis method, the effect of purification and separation is greatly improved.

[0331] Example 3

[0332] According to the structure of the aforementioned lipid compound, this embodiment designs a saturated lipid linker conjugate with the following structure. The specific structure is shown in Table 7 below.

[0333] Table 7 Saturated lipid linker conjugate structure

[0334]

[0335]

[0336]

[0337] The English meanings of the above table are as follows:

[0338] Et is the abbreviation for ethyl.

[0339] In this embodiment, since the subsequent synthesis adopts the solid phase synthesis method, the lipid chain can be connected to the phosphoramidite or directly connected to the solid phase carrier. Considering that the lipid chain will eventually be connected to the nucleic acid sequence, there will be an intermediate compound between the solid phase carrier and the lipid chain to connect. Succinic acid is the best choice, which not only ensures the connection between the two, but also can be separated from the solid phase in the subsequent treatment and separated from the nucleic acid lipid chain. Therefore, the saturated lipid linker conjugate is an important intermediate in the supplementary method of solid phase synthesis of nucleic acid lipid chains.

[0340] Example 4

[0341] According to the structure of the aforementioned lipid compound, the present embodiment designs the structure of the saturated lipid linker conjugate and the solid phase body linker as shown below. The specific structure is shown in Table 8 below.

[0342] Table 8 Saturated lipid linker conjugate solid support structure

[0343]

[0344]

[0345]

[0346] Similar to the scheme of the aforementioned Example 3, this example further describes a lipid compound monomer, which has a carboxyl functional group at the terminal, and uses the amine or hydroxyl group on the solid phase carrier to connect the solid phase and the lipid chain of the lipid compound monomer together through a condensation reaction. Finally, it can be directly applied to the subsequent synthesis of nucleic acid sequences.

[0347] Example 5

[0348] According to the structure of the aforementioned lipid compound, this embodiment designs the following structures of lipid compound monomers as shown in the aforementioned Tables 1 and 2 and nucleic acid conjugates formed by the aforementioned lipid compound monomers (specific structures are shown in the aforementioned Tables 3-5).

[0349] Similar to the scheme described in the above-mentioned Examples 2-4, in this example, the synthesis method for connecting the lipid compound monomer with the nucleotide adopts a solid phase synthesis method.

[0350] Example 6

[0351] This example synthesizes the aforementioned lipid compound monomer.

[0352] (1) Synthesis of lipid compound monomer (B1)

[0353] Examples The synthesis process and specific method of the lipid compound monomer (B1) of the present invention are described as follows.

[0354]

[0355] Hexadecanoic acid (0.513 g, 2 mmol) was dissolved in 10 mL of dried dimethylformamide (DMF) at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N, N, N', N'-tetramethyluronium hexafluorophosphate (HATU, 0.78 g, 2.05 mmol) and N, N-diisopropylethylamine (DIPEA, 1 mL, 6 mmol) were gradually added in an ice bath, and the reaction solution was stirred for 10 minutes at 0°C. After the intermediate product was generated, 6-amino-2-hydroxymethyl-n-hexane-1-ol 1 (0.309 g, 2.1 mmol) was dissolved in 5 mL of dimethylformamide and then added dropwise to the reaction bottle. The reaction solution was warmed to room temperature (25°C) and continued to stir at room temperature for 12 hours. The reaction solution was poured into 30 mL of saturated saline solution and solid precipitation was observed. After the solid was completely precipitated, the solid was filtered out and washed with water to remove the unreacted reagents and solvents. Finally, the product 2 (0.747 g, 97%) was dried under vacuum at room temperature and used directly in the next step.

[0356] Dissolve 4,4'-dimethoxytriphenylmethane chloride (DMT-CI, 0.6 g, 1.7 mmol) in 5 mL of dichloromethane (DCM). Slowly drop the solution into anhydrous pyridine (Py, 10 mL) solution containing compound 2 (0.718 g, 1.86 mmol) at room temperature, and add a small amount of 4-dimethylaminopyridine (20 mg) to the reaction solution. Continue stirring the reaction solution at room temperature for 14 hours. Add 20 mL of saturated saline solution to the reaction mixture and extract with 2×50 mL of ethyl acetate (EtOAc). The organic phase was concentrated to semi-dryness by rotary evaporation and further purified by silica gel chromatography using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), and finally eluting with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and the product components were collected, and the solvent was drained under reduced pressure to obtain a yellow solid 3 (0.58 g, 50%), which was directly used in the next step reaction.

[0357] Dissolve compound 3 (0.58 g, 0.844 mmol) in 15 mL of dry dichloromethane, and then add 0.6 mL of triethylamine. Stir and dissolve 4-dimethylaminopyridine (0.195 g, 1.6 mmol) in the reaction solution, stir and dissolve succinic anhydride (0.127 g, 1.27 mmol) in the reaction solution at room temperature, and stir to react for 8 hours. Continue to add succinic anhydride (32 mg, 0.32 mmol) and continue stirring at room temperature for 14 hours. Pour the reaction solution into saturated saline, extract with 2×50 mL of dichloromethane, separate the organic phase, dry with anhydrous sodium sulfate, and evaporate to semi-dryness under reduced pressure. Purify by silica gel chromatography, using a gradient elution, first with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v) eluted, and then with a mixed solvent (ethyl acetate / methanol / triethylamine, 10:1:0.01, v / v / v) to elute the final product B1, and drain the solvent under reduced pressure to obtain a white solid compound (B1, 0.62 g, 93%). The product structure information is as follows: 1 H NMR (CDCl 3): d, 7.41-7.40 (m, 3H, trityl), 7.39-7.27 (m, 6H, trityl), 7.25-7.19 (m, 1H), 6.83-6. 80(m, 4H, trityl), 4.24-4.12(m, 2H), 3.78(s, 6H), 3.19-3.16(m, 2H), 3.10-3.07(m, 2H) , 3.03-3.01 (m, 1H), 3.00-2.99 (m, 2H), 2.56-2.54 (m, 4H), 2.15-2.12 (m, 2H), 1.60-1.57 (m, 2H), 1.43-1.39 (m, 2H), 1.34-1.20 (m, 26H), 1.19-1.17 (m, 2H), 0.89-86 (m, 3H) ppm. It can be seen that the product structure is correct.

[0358] (2) Synthesis of lipid compound monomer (B3)

[0359]

[0360] Hexadecanoic acid (0.513 g, 2 mmol) was dissolved in 10 mL of dried dimethylformamide at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N, N, N', N'-tetramethyluronium hexafluorophosphate (0.78 g, 2.05 mmol) and N, N-diisopropylethylamine (1 mL, 6 mmol) were gradually added in an ice bath, and the reaction solution was stirred for 10 minutes at 0 ° C. After the intermediate product was generated, 4-amino-2-hydroxymethyl n-butane-1-ol 4 (0.25 g, 2.1 mmol) was dissolved in 5 mL of dimethylformamide and then added dropwise to the reaction bottle. The reaction solution was warmed to room temperature (25 ° C) and continued to stir at room temperature for 12 hours. The reaction solution was poured into 30 mL of saturated saline solution and solid precipitation was observed. After the solid was completely precipitated, the solid was filtered out, and the solid was rinsed with clean water to remove the unreacted reagents and solvents. Finally, the product 5 (0.678 g, 98%) was dried in vacuo at room temperature and used directly in the next reaction.

[0361] Dissolve 4,4'-dimethoxytriphenylmethane (0.63g, 1.9mmol) in 4mL of dichloromethane. Slowly drop the solution into a solution of anhydrous pyridine (20mL) containing compound 5 (0.67g, 1.86mmol) at room temperature, and add a small amount of 4-dimethylaminopyridine (20mg) to the reaction solution. Stir the reaction solution for 14 hours at room temperature. Add 30mL of saturated saline solution to the reaction mixture and extract with 2×50mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified and separated by silica gel chromatography using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), and finally eluting with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and the product components were collected, and the solvent was drained under reduced pressure to obtain a yellow solid 6 (0.76 g, 63%), which was directly used in the next step reaction.

[0362] Dissolve compound 6 (0.76 g, 1.18 mmol) in 15 mL of dry dichloromethane, and then add 0.8 mL of triethylamine. Stir and dissolve 4-dimethylaminopyridine (0.725 g, 5.9 mmol) in the reaction solution, stir and dissolve succinic anhydride (0.172 g, 1.72 mmol) in the reaction solution at room temperature, and stir to react for 8 hours. Continue to add succinic anhydride (32 mg, 0.32 mmol) and continue stirring at room temperature for 14 hours. Pour the reaction solution into saturated saline, extract with 2×50 mL of dichloromethane, separate the organic phase, dry with anhydrous sodium sulfate, and evaporate to semi-dryness under reduced pressure. Purify by silica gel chromatography, using a gradient elution, first eluting with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v), then eluting with a mixed solvent (ethyl acetate / methanol / triethylamine, 10:1:0.01, v / v / v) to elute the final product B3, and drain the solvent under reduced pressure to obtain a white solid compound (B3, 0.72 g, 82%). The product structure detection information data are as follows: 1 H NMR (CDCl 3): d, 7.41-7, 40 (m, 2H, trityl), 7.39-7.27 (m, 6H, trityl), 7.20-7.17 (m, 1H, trityl), 6. 82-6.80(m, 4H, trityl), 5.12-5.11(m, 1H), 3.77(s, 6H), 3.17-3.14(m, 2H), 3.10-3.07(m, 2H), 3.03-2.99 (m, 2H), 2.69-2.66 (m, 2H), 2.64-2.57 (m, 2H), 2.13-2.10 (m, 2H), 1.78-1.73 (m, 2H), 1.59-1.56 (m, 2H), 1.31-1.28 (m, 2H), 1.28-1.23 (m, 22H), 0.89-0.86 (m, 3H) ppm. It can be seen that the product structure is correct.

[0363] (3) Synthesis of lipid compound monomers (A4, B4)

[0364]

[0365] Hexadecanoic acid (5.13 g, 20 mmol) was dissolved in 100 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (8.4 g, 22 mmol) and N,N-diisopropylethylamine (8.7 mL, 50 mmol) were gradually added in an ice bath, and the reaction solution was stirred for 20 minutes at 0°C. After the intermediate product was generated, 3-amino-2-hydroxymethyl n-propane-1-ol 7 (2 g, 21 mmol) was dissolved in 50 mL of dimethylformamide and then added dropwise to the reaction bottle. The reaction solution was warmed to room temperature (25°C) and continued to stir at room temperature for 12 hours. The reaction solution was poured into 500 mL of saturated saline solution and solid precipitation was observed. After the solid was completely precipitated, the solid was filtered out and washed with water to remove the unreacted reagents and solvents. Finally, the product 8 (6.25 g, 95%) was dried under vacuum at room temperature and used directly in the next step.

[0366] Dissolve 4,4'-dimethoxytriphenylmethane (6.2 g, 18.8 mmol) in 20 mL of dichloromethane, and slowly drop the solution into a solution of anhydrous pyridine (100 mL) containing dissolved compound 8 (6.1 g, 18.6 mmol) at room temperature. Stir the reaction solution for 14 hours at room temperature. Add 300 mL of saturated saline solution to the reaction mixture, and extract with 2×250 mL of ethyl acetate. The organic phase is concentrated to semi-dryness by rotary evaporation, and then purified and separated by silica gel chromatography, using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), and finally eluting with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and collect the product components, and drain the solvent under reduced pressure to obtain a yellow solid 9 (6.93 g, 59%). The product 9 is directly used in the next step.

[0367] Dissolve compound 9 (4.75 g, 7.52 mmol) in 50 mL of dry dichloromethane, and then add 3.3 mL of triethylamine. Stir and dissolve 4-dimethylaminopyridine (0.72 g, 5.9 mmol) in the reaction solution, stir and dissolve succinic anhydride (1.13 g, 11.3 mmol) in the reaction solution at room temperature, and stir to react for 8 hours. Continue to add succinic anhydride (100 mg, 1 mmol), and continue stirring at room temperature for 14 hours. Pour the reaction solution into saturated saline, extract with 2×250 mL of dichloromethane, separate the organic phase, add anhydrous sodium sulfate to dry, and evaporate to semi-dryness under reduced pressure. Purify by silica gel chromatography, using a gradient elution, first with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v) eluted, and then with a mixed solvent (ethyl acetate / methanol / triethylamine, 10:1:0.01, v / v / v) to elute the final product B4, and drain the solvent under reduced pressure to obtain a light yellow solid compound (B4, 4.5 g, 82%). The product structure verification information is as follows: 1 H NMR (CDCl 3): d, 7.42-7.40 (m, 2H, trityl), 7.31-7.27 (m, 4H, trityl), 7.25-7.18 (m, 2H, tr ityl), 6.83-6.80(m, 4H, trityl), 5.14-5.11(m, 1H), 3.79(s, 6H), 3.78-3.70(m, 1H), 3.31-3.30 (m, 1H), 3.20-3.19 (m, 2H), 3.02-2.98 (m, 3H), 2.64-2.56 (m, 4H), 2.09-2.05 (m, 2H), 1.54-1.51 (m, 2H), 1.31-1.23 (m, 22H), 0.89-0.86 (m, 3H) ppm. It can be seen that the product structure is correct.

[0368] Dissolve compound 9 (4.8 g, 7.6 mmol) in 100 mL of dry dichloromethane, then quickly add N,N,N'N'-tetraisopropyl 2-cyanoethoxyphosphite (3.4 mL, 11.4 mmol) to the above solution. Stir the reaction solution at room temperature for 20 minutes under nitrogen protection. Add 20 mL of tetrazole (Tetrazole, 0.64 g, 9.12 mmol) dissolved in dry dichloromethane to the above reaction solution, and continue to stir and react for 2 hours under nitrogen protection at room temperature. Pour the reaction solution into saturated saline, extract with 2×150 mL of dichloromethane, separate the organic phase, dry with anhydrous sodium sulfate, and evaporate to semi-dryness under reduced pressure. The silica gel column was used for purification and separation, using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 5:1, v / v, 1% triethylamine), and finally eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), and the product components were collected, and the solvent was drained under reduced pressure to obtain a white solid A4 (5.2 g, 85%). The product structure verification information is as follows: 1 H NMR (CDCl 3): d, 7.45-7.34(m, 3H, trityl), 7.33-7.27(m, 6H, trityl), 7.25-7.21(m, 1H, trityl), 6.84-6.79( m, 4H, trityl), 4.15-4.09 (m, 1H), 4.03-4.02 (m, 1H), 3.91-3.86 (m, 2H), 3.79 (s, 6H), 3.78-3.75 (m, 2H), 3.61-3.55(m, 4H), 3.21-3.17(m, 2H), 3.11-3.08(m, 1H), 2.66-2.62(m, 2H), 2.12-2.08(m, 2H), 1.58-1.54(m, 2H), 1.32-1.25(m, 22H), 1.20-1.17(m, 6H), 1.12-1.11(m, 6H), 0.90-0.86(m, 3H)ppm. 31 P NMR (CDCl 3 ): d, 149.16, 148.96 ppm. It can be seen that the product structure is correct.

[0369] (4) Synthesis of lipid compound monomers (A5, B5)

[0370]

[0371] Dissolve 4,4'-dimethoxytriphenylmethane chloride (1.8 g, 5.3 mmol) in 5 mL of dichloromethane. Slowly drop the solution into anhydrous pyridine (10 mL) solution containing 3-hydroxy-2-hydroxymethyl-2-methyl-propionic acid 10 (0.8 g, 5.97 mmol) at room temperature. Stir the solution for 14 hours at room temperature. Add 20 mL of water to the reaction mixture and extract with 2×50 mL of ethyl acetate. The organic phase is concentrated to semi-dryness by rotary evaporation and further purified by silica gel chromatography using a gradient elution, first with n-hexane solvent, then with (n-hexane / ethyl acetate, 1:1, v / v). Collect the product components, and drain the solvent under reduced pressure to obtain a yellow solid 12 (1.5 g, 58%). The product 12 is directly used in the next step.

[0372] Hexadecanoic acid (16.20 g, 63.28 mmol) was dissolved in 240 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (26.4 g, 69.61 mmol) and N,N-diisopropylethylamine (27.5 mL, 158.2 mmol) were gradually added in an ice bath, and the reaction solution was stirred for 10 minutes at 0°C. After the intermediate product was generated, N-(tert-butyloxycarbonyl)-1,2-diaminoethane N-(2-aminoethyl)carbamic acid tert-butyl ester 13 (10.2 g, 60.2 mmol) was dissolved in 50 mL of dichloromethane and then added dropwise to the reaction bottle. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 6 hours. The dichloromethane was removed by rotary evaporation under reduced pressure, and then the reaction solution was poured into 500 mL of saturated saline solution to observe the precipitation of solids. After the solids were completely precipitated, the solids were filtered out, and the solids were washed with clean water and 50 mL of ethyl acetate to remove the unreacted reagents and solvents. Finally, the product 14 (23.5 g, 93%) was dried under vacuum at room temperature and used directly in the next step.

[0373] Compound 14 (23.5 g, 59 mmol) was dissolved in 300 mL of a mixed solvent (methanol (MeOH) and dichloromethane, v / v, 1:1), and the reaction solution was mixed with 40 mL of a hydrochloric acid (4M) aqueous solution. The mixed reaction solution was stirred continuously for 30 minutes at room temperature, and then stirred at room temperature for 24 hours. After rotary evaporation, methanol and dichloromethane were removed. 100 mL of ethyl acetate was added, and the reaction solution and ethyl acetate were fully mixed and then rotary evaporation was performed. After the concentrate was mixed with 150 mL of a mixed solvent (n-hexane and ethyl acetate, v / v, 1:1), a solid product 15 was gradually precipitated. After filtration and vacuum drying, the product 15 (20 g, 90%) was directly used for the next reaction.

[0374] Compound 12 (18.4 g, 31.1 mmol) was dissolved in 200 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (10.4 g, 27.4 mmol) and N,N-diisopropylethylamine (22 mL, 74.2 mmol) were gradually added in an ice bath, and the reaction solution was stirred for 20 minutes at 0°C. After the intermediate product was generated, compound 15 (8.6 g, 25.7 mmol) was dissolved in 50 mL of dichloromethane and then added dropwise to the reaction bottle. The reaction solution was heated to room temperature (25°C) and stirred at room temperature for 12 hours. The dichloromethane was removed by vacuum rotary evaporation, and then the reaction solution was poured into 500 mL of saturated saline solution and extracted with 2×250 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified and separated by silica gel chromatography using a gradient elution, first washed with n-hexane solvent, then eluted with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), continued to elute with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluted with (ethyl acetate, 1% triethylamine) and collected the product components, and the solvent was evaporated under reduced pressure to obtain a yellow solid 16 (13 g, 59%).

[0375] Dissolve compound 16 (2.7 g, 3.77 mmol) in 50 mL of dry dichloromethane, and then add 2.6 mL of triethylamine. Stir and dissolve 4-dimethylaminopyridine (0.72 g, 5.9 mmol) in the reaction solution, stir and dissolve succinic anhydride (0.57 g, 5.6 mmol) in the reaction solution at room temperature, and stir to react for 8 hours. Continue to add succinic anhydride (100 mg, 1 mmol), and continue stirring at room temperature for 14 hours. Pour the reaction solution into saturated saline, extract with 2×250 mL of ethyl acetate, separate the organic phase, add anhydrous sodium sulfate to dry, and evaporate to semi-dryness under reduced pressure. Purify by silica gel chromatography, using a gradient elution, first eluting with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v), then eluting with a mixed solvent (ethyl acetate / methanol / triethylamine, 10:2:0.01, v / v / v) to elute the final product B5, and drain the solvent under reduced pressure to obtain a light yellow solid compound B5 (2.5 g, 78%). The product structure verification information is as follows: 1 H NMR (CDCl 3): d, 7.39-7.37 (m, 3H, trityl), 7.29-7.26 (m, 6H, trityl), 7.21-7.18 (m, 1H, trityl), 6.84-6.81 (m, 4H, trityl), 4.34-4.32 (m, 1H), 4.16-4.14 (m, 1H), 3.78 (s, 6H), 3.35-3.27 (m, 3H), 3.25-2.97 (m, 3H), 2.54-2.50 (m, 4H), 2.08-2.00 (m, 2H), 1.30-1.19 (m, 31H), 0.88-0.86 (m, 3H) ppm. It can be seen that the product structure is correct.

[0376] Dissolve compound 16 (7.16 g, 10 mmol) in 100 mL of dry dichloromethane, then quickly add N,N,N'N'-tetraisopropyl 2-cyanoethoxyphosphite (3.6 mL, 12 mmol) to the above solution. Stir the reaction solution at room temperature for 20 minutes under nitrogen protection. Add 22 mL of tetrazole (0.68 g, 10 mmol) dissolved in dry dichloromethane to the above reaction solution, and continue stirring the reaction at room temperature under nitrogen protection for 2 hours. Pour the reaction solution into saturated saline, extract with 2×150 mL of dichloromethane, separate the organic phase, dry with anhydrous sodium sulfate, and evaporate to semi-dryness under reduced pressure. The silica gel column was used for purification and separation, using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), then eluting with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine), and the product components were collected, and the solvent was drained under reduced pressure to obtain a white solid A5 (7 g, 82%). The product structure verification information is as follows: 1 H NMR (CDCl 3 ): d, 7.42-7.40 (m, 3H, trityl), 7.30-7.27 (m, 6H, trityl), 7.23-7.21 (m, 1H, trityl ), 6.84-6.82(m, 4H, trityl), 4.14-4.09(m, 1H), 3.79(s, 6H), 3.77-3.71(m, 4H), 3.70 -3.66(m, 4H), 3.55-3.49(m, 2H), 2.56-2.53(m, 2H), 2.04-2.00(m, 2H), 1.55-1.51(m, 2H), 1.31-1.20(m, 22H), 1.16-1.11(m, 6H), 1.09-1.08(m, 6H), 0.88-0.87(m, 3H)ppm. 31P NMR (CDCl 3 ): d, 148.57, 148.48 ppm. It can be seen that the product structure is correct.

[0377] (5) Chemical synthesis of lipid compound monomers (A6-R1-R5, B6-R1-R5)

[0378]

[0379] Hexadecanoic acid (16.20 g, 63.28 mmol) was dissolved in 250 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1.5:1) at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (26.4 g, 69.61 mmol) and N,N-diisopropylethylamine (27.5 mL, 158.2 mmol) were gradually added in an ice bath, and the reaction solution was stirred at 0°C for 20 minutes. After the intermediate product was generated, N-(tert-butyloxycarbonyl)-1,3-diaminopropane N-(3-aminopropyl)carbamic acid tert-butyl ester 17 (11 g, 63.13 mmol) was dissolved in 50 mL of dichloromethane and then added dropwise to the reaction bottle. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 6 hours. The dichloromethane was removed by rotary evaporation under reduced pressure, and then the reaction solution was poured into 500 mL of saturated saline solution to observe the precipitation of solids. After the solids were completely precipitated, the solids were filtered out, and the solids were washed with clean water and 50 mL of ethyl acetate to remove the unreacted reagents and solvents. Finally, the product 19-R3 (25 g, 95%) was dried under vacuum at room temperature and used directly in the next step.

[0380] The same chemical reaction preparation process was used to replace the reactant hexadecanoic acid with tetradecanoic acid, pentadecanoic acid, heptadecanoic acid, and octadecanoic acid to obtain products 19-R1 (24 g, 94%), 19-R2 (26 g, 96%), 19-R4 (21 g, 91%), and 19-R5 (22 g, 93%), respectively.

[0381] Compound 19-R3 (25 g, 62 mmol) was dissolved in 200 mL of methanol solvent, the reaction solution was mixed with 35 mL of hydrochloric acid (4 M) aqueous solution and 35 mL of dioxane was added. The mixed reaction solution was stirred for 30 minutes at room temperature and then stirred for 24 hours at room temperature. Methanol and dioxane were removed after rotary evaporation. 100 mL of ethyl acetate was added, the reaction solution and ethyl acetate were fully mixed, and then rotary evaporation was performed. After the concentrate was mixed with 150 mL of a mixed solvent (n-hexane and ethyl acetate, v / v, 1:1), the solid product 20-R3 was gradually precipitated. After filtration and vacuum drying, the product 20-R3 (19 g, 91%) was directly used for the next step reaction.

[0382] Using the same chemical reaction preparation process, compounds 19-R1, 19-R2, 19-R4, and 19-R5 were post-treated and precipitated to obtain products 20-R1 (17 g, 88%), 20-R2 (15 g, 89%), 20-R4 (19 g, 85%), and 20-R5 (14 g, 82%), respectively.

[0383] Compound 12 (18.4 g, 31.1 mmol) was dissolved in 200 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (9.4 g, 24.8 mmol) and N,N-diisopropylethylamine (21.5 mL, 124 mmol) were gradually added in an ice bath, and the reaction solution was stirred at 0°C for 20 minutes. After the intermediate product was generated, compound 20-R3 (8.6 g, 25.7 mmol) was dissolved in 50 mL of dichloromethane and then added dropwise to the reaction bottle. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 4 hours. The dichloromethane was removed by rotary evaporation under reduced pressure, and then the reaction solution was poured into 500 mL of saturated saline solution and extracted with 2×250 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation, and then purified and separated by silica gel chromatography, using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), continuing to elute with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (ethyl acetate, 1% triethylamine) and collecting the product components, and the solvent was drained under reduced pressure to obtain a yellow solid 21-R3 (12 g, 57%).

[0384] Using the same chemical reaction preparation process, compounds 20-R1, 20-R2, 20-R4, and 20-R5 were reacted and then separated and purified by silica gel chromatography to obtain products 21-R1 (9 g, 51%), 21-R2 (11 g, 55%), 21-R4 (14 g, 55%), and 21-R5 (13 g, 56%), respectively.

[0385] Dissolve compound 21-R3 (2.26 g, 3.1 mmol) in 50 mL of dry dichloromethane, and then add 2.5 mL of triethylamine. Stir and dissolve 4-dimethylaminopyridine (0.72 g, 5.9 mmol) in the reaction solution, stir and dissolve succinic anhydride (0.47 g, 4.65 mmol) in the reaction solution at room temperature, and stir to react for 8 hours. Continue to add succinic anhydride (100 mg, 1 mmol) and continue stirring at room temperature for 14 hours. Pour the reaction solution into saturated saline, extract with 2×250 mL of ethyl acetate, separate the organic phase, dry with anhydrous sodium sulfate, and evaporate to semi-dryness under reduced pressure. Purify by silica gel chromatography, using a gradient elution, first eluting with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v), then eluting with a mixed solvent (ethyl acetate / methanol / triethylamine, 10:2:0.01, v / v / v) to elute the final product B6-R3, and drain the solvent under reduced pressure to obtain a light yellow solid compound B6-R3 (2.1 g, 75%). The product structure verification information is as follows: 1 H NMR (CDCl 3 ): d, 7.39-7.37 (m, 2H, trityl), 7.29-7.26 (m, 6H, trityl), 7.25-7.21 (m, 1H, trityl), 6. 84-6.81(m, 4H, trityl), 4.29-4.26(m, 1H), 4.22-4.20(m, 1H), 3.78(s, 6H), 3.28-3.24(m, 3H), 3.23-3.17 (m, 3H), 3.16-3.10 (m, 3H), 3.05-3.00 (m, 3H), 2.53-2.48 (m, 4H), 2.17-2.14 (m, 2H), 1.61-1.58 (m, 4H), 1.54-1.52 (m, 2H), 1.31-1.22 (m, 22H), 0.88-0.85 (m, 3H) ppm. It can be seen that the product structure is correct.

[0386] Using the same chemical reaction preparation process, the compounds 21-R1, 21-R2, 21-R4, and 21-R5 were reacted and then separated and purified by silica gel chromatography to obtain products B6-R1 (1.5 g, 70%), B6-R2 (2.4 g, 74%), B6-R4 (2.1 g, 71%), and B6-R5 (1.8 g, 68%), respectively.

[0387] Dissolve compound 21-R3 (4.5 g, 6.16 mmol) in 80 mL of dry dichloromethane, and then quickly add N, N, N', N'-tetraisopropyl 2-cyanoethoxy phosphite (2.3 mL, 7.34 mmol) to the above solution. Stir the reaction solution at room temperature for 20 minutes under nitrogen protection. Add 20 mL of tetrazole (1.37 mL, 0.45 M, 6.16 mmol) dissolved in dry dichloromethane to the above reaction solution, and continue to add N, N, N', N'-tetraisopropyl 2-cyanoethoxy phosphite (0.5 mL, 0.26 mmol) to the reaction solution, and continue to stir and react for 2 hours under nitrogen protection at room temperature. Pour the reaction solution into saturated saline, extract with 2×150 mL of dichloromethane, separate the organic phase, dry with anhydrous sodium sulfate, and evaporate to semi-dryness under reduced pressure. The silica gel column was used for purification and separation, using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), then eluting with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine), and the product components were collected, and the solvent was drained under reduced pressure to obtain a white solid A6-R3 (4.9 g, 85%). The product structure verification information is as follows: 1 H NMR (CDCl 3 ): d, 7.42-7.40 (m, 2H, trityl), 7.30-7.26 (m, 6H, trityl), 7.23-7.21 (m, 1H, trityl), 6.87-6.82 ( m, 4H, trityl), 4.14-4.11(m, 2H), 3.79(s, 6H), 3.78-3.72(m, 2H), 3.71-3.67(m, 2H), 3.55-3.50(m, 2H), 3.31-3.26(m, 4H), 3.24-3.22(m, 2H), 2.55-2.53(m, 2H), 2.17-2.14(m, 2H), 1.63-1.60(m, 2H), 1.53-1.51(m, 2H), 1.29-1.25(m, 22H), 1.22-1.15(m, 6H), 1.11-1.09(m, 6H), 0.88-0.86(m, 3H)ppm. 31P NMR (CDCl 3 ): d, 148.95, 148.52 ppm. It can be seen that the product structure is correct.

[0388] The same chemical reaction preparation process is adopted to react the compounds 21-R1, 21-R2, 21-R4 and 21-R5, and then the products are obtained after separation and purification by silica gel chromatography.

[0389] A6-R1: (3.8 g, 91%); 1 H NMR (CDCl 3 ): d, 7.42-7.40 (m, 2H, trityl), 7.30-7.23 (m, 6H, trityl), 7.21-7.19 (m, 1H, trityl), 6.88-6.81 ( m, 4H, trityl), 4.14-4.11(m, 2H), 3.79(s, 6H), 3.77-3.71(m, 2H), 3.70-3.66(m, 2H), 3.57-3.47(m, 2H), 3.31-3.25(m, 4H), 3.23-3.15(m, 2H), 2.55-2.52(m, 2H), 2.17-2.14(m, 2H), 1.80-1.60(m, 2H), 1.53-1.51(m, 2H), 1.28-1.24(m, 18H), 1.22-1.16(m, 6H), 1.14-1.08(m, 6H), 0.89-0.86(m, 3H)ppm. 31 P NMR (CDCl 3 ): d, 148.56, 148.48 ppm.

[0390] A6-R2 (4.2 g, 90%); 1 H NMR (CDCl 3<h2 style=";text-align:left;direction:ltr">(:d,7.42-7.40(m,2H,trityl),7.30-7.23(m,6H,trityl),7.22-7.20(m,1H,trityl),6.87-6.82( m,4H,trityl),4.13-4.11(m,2H),3.79(s,6H),3.78-3.71(m,2H),3.70-3.66(m,2H),3.55-3.50(m, 2H),3.31-3.24(m,4H),3.23-3.14(m,2H),2.55-2.53(m,2H),2.17-2.14(m,2H),1.63-1.60(m,2H),1.58-1.51(m,2H),1.28-1.19(m,18H),1.16-1.11(m,6H),1.09-1.08(m,6H),0.89-0.86(m,3H)ppm.<h2 style=";text-align:left;direction:ltr"> 31 <h2 style=";text-align:left;direction:ltr"> P NMR(CDCl<h2 style=";text-align:left;direction:ltr"> 3 <h2 style=";text-align:left;direction:ltr"> ):d, 148.59, 148.52ppm.<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0391] <h2 style=";text-align:left;direction:ltr"> A6-R4(3.6g,88%);<h2 style=";text-align:left;direction:ltr"> 1 <h2 style=";text-align:left;direction:ltr"> H NMR(CDCl<h2 style=";text-align:left;direction:ltr"> 3 <h2 style=";text-align:left;direction:ltr"> (:d,7.42-7.40(m,2H,trityl),7.30-7.23(m,6H,trityl),7.23-7.20(m,1H,trityl),6.87-6.82( m,4H,trityl),4.14-4.11(m,2H),3.79(s,6H),3.78-3.72(m,2H),3.71-3.66(m,2H),3.55-3.50(m, 2H),3.31-3.24(m,4H),3.23-3.12(m,2H),2.55-2.53(m,2H),2.17-2.14(m,2H),1.67-1.61(m,2H),1.60-1.53(m,2H),1.29-1.19(m,24H),1.16-1.11(m,6H),1.09-1.08(m,6H),0.89-0.86(m,3H)ppm.<h2 style=";text-align:left;direction:ltr"> 31 <h2 style=";text-align:left;direction:ltr"> P NMR(CDCl<h2 style=";text-align:left;direction:ltr"> 3 <h2 style=";text-align:left;direction:ltr"> ):d, 148.59, 148.52ppm.<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0392] <h2 style=";text-align:left;direction:ltr"> A6-R5(4.1g,89%);<h2 style=";text-align:left;direction:ltr"> 1 <h2 style=";text-align:left;direction:ltr"> H NMR(CDCl<h2 style=";text-align:left;direction:ltr"> 3): d, 7.42-7.40 (m, 2H, trityl), 7.30-7.23 (m, 6H, trityl), 7.23-7.19 (m, 1H, trityl), 6.88-6 .81(m, 4H, trityl), 4.13-4.11(m, 2H), 3.79(s, 6H), 3.78-3.70(m, 2H), 3.70-3.67(m, 2H), 3.55 -3.49(m, 2H), 3.31-3.22(m, 4H), 3.15-3.12(m, 2H), 2.56-2.52(m, 2H), 2.18-2.14(m, 2H), 1.61 -1.52(m, 4H), 1.28-1.20(m, 26H), 1.16-1.10(m, 6H), 1.09-1.08(m, 6H), 0.89-0.86(m, 3H)ppm. 31 P NMR (CDCl 3 ): d, 148.56, 148.49 ppm.

[0393] It can be seen that the product structure is correct.

[0394] (6) Synthesis of lipid compound monomers (B7, B8)

[0395]

[0396] DL-Calcium glycerate hydrate (2.5 g) was dissolved in 10 mL of anhydrous pyridine at room temperature, and the solution was slowly added to 10 mL of anhydrous pyridine containing 4,4'-dimethoxytriphenylmethane (6 g, 17.7 mmol). The solution was stirred for 1 hour at room temperature, and then the reaction solution was heated to 45°C and stirred for 12 hours. 40 mL of water was added to the reaction solution, and it was extracted with 2×50 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation, and further purified by silica gel chromatography, first washed with n-hexane solvent, and then washed with a gradient elution (n-hexane / ethyl acetate, 3:1; 1:1; 1; 3; v / v, 1% triethylamine), the product components were collected, and the solvent was drained under reduced pressure to obtain a yellow solid 24 (1.5 g, 58%), which was directly used in the next step reaction.

[0397] Compound 23 (0.9 g, 2.2 mmol) was dissolved in 20 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (0.76 g, 2 mmol) and N,N-diisopropylethylamine (2 mL, 13.2 mmol) were gradually added in an ice bath, and the reaction solution was stirred for 20 minutes at 0°C. After the intermediate product was generated, compound 15 (0.65 g, 2.2 mmol) was dissolved in 5 mL of dichloromethane and then added dropwise to the reaction bottle. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 12 hours. The dichloromethane was removed by vacuum rotary evaporation, and then the reaction solution was poured into 100 mL of saturated saline solution and extracted with 2×150 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified and separated by silica gel chromatography using a gradient elution, first washed with n-hexane solvent, then eluted with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), continued to elute with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluted with (ethyl acetate, 1% triethylamine) and collected the product components, and the solvent was evaporated under reduced pressure to obtain a yellow solid 24 (0.84 g, 59%).

[0398] Compound 24 (0.84 g, 1.22 mmol) was dissolved in 50 mL of dry dichloromethane, and then 0.85 mL of triethylamine was added. 4-Dimethylaminopyridine (0.72 g, 5.9 mmol) was stirred and dissolved in the reaction solution, and succinic anhydride (0.183 g, 1.83 mmol) was stirred and dissolved in the reaction solution at room temperature, and the reaction was stirred for 8 hours. Succinic anhydride (50 mg, 0.2 mmol) was added, and stirring was continued for 14 hours at room temperature. The reaction solution was poured into saturated saline, extracted with 2×250 mL of ethyl acetate, the organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. Purify by silica gel chromatography, using a gradient elution, first with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v) eluted, and then with a mixed solvent (ethyl acetate / methanol / triethylamine, 10:2:0.01, v / v / v) eluted the final product B7, and the solvent was drained under reduced pressure to obtain a light yellow solid compound B7 (0.87 g, 75%). The product structure verification information is as follows: 1 H NMR (CDCl 3): d, 7.82 (m, 2H), 7.41-7.39 (m, 3H, trityl), 7.29-7.27 (m, 6H, trityl), 7.25-7.19 (m, 1 H, trityl), 6.82-6.80 (m, 4H, trityl), 5.34-5.32 (m, 1H), 3.78 (s, 6H), 3.55-3.52 (m, 2H) , 3.46-3.41 (m, 2H), 3.34-3.31 (m, 3H), 3.00-2.96 (m, 2H), 2.72-2.70 (m, 2H), 2.69-2.59 (m, 1H), 2.08-2.05 (m, 2H), 1.52-1.50 (m, 2H), 1.30-1.22 (m, 22H), 0.89-0.86 (m, 3H) ppm. It can be seen that the product structure is correct.

[0399] The same chemical reaction preparation process was used to replace reactant 15 with 20-R3, and finally the product B8 (0.42 g, 77%) was obtained. The product structure verification information is as follows: 1 H NMR (CDCl 3 ): d, 7.47 (m, 2H, trityl), 7.41-7.39 (m, 3H, trityl), 7.30-7.27 (m, 6H, trityl), 7.25-7.19 (m, 1H, trityl) l), 6.82-6.80 (m, 4H, trityl), 6.18 (m, 1H), 5.40-5.39 (m, 1H), 3.78 (s, 6H), 3.57-3.56 (m, 1H), 3.55-3.5 4 (m, 1H), 3.45-3.42 (m, 2H), 3.37-3.34 (m, 1H), 3.34-3.29 (m, 1H), 3.08-3.03 (m, 3H), 2.75-2.68 (m, 2H), 2.20-2.17 (m, 2H), 1.74-2.051.71 (m, 2H), 1.62-1.59 (m, 2H), 1.31-1.13 (m, 22H), 0.89-0.86 (m, 3H) ppm. It can be seen that the product structure is correct.

[0400] (7) Synthesis of lipid compound monomers (A9, B9)

[0401]

[0402] Hexadecanoic acid 18-R3 (12.80 g, 50 mmol) was dissolved in 150 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (21.2 g, 55 mmol) and N,N-diisopropylethylamine (22 mL, 125 mmol) were gradually added in an ice bath, and the reaction solution was stirred at 0°C for 10 minutes. After the intermediate product was generated, N-(tert-butyloxycarbonyl)-1,4-diaminobutane N-(4-aminoethyl)carbamic acid tert-butyl ester 25 (9.5 g, 51 mmol) was dissolved in 50 mL of dichloromethane and then added dropwise to the reaction bottle. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 6 hours. The dichloromethane was removed by rotary evaporation under reduced pressure, and then the reaction solution was poured into 500 mL of saturated saline solution to observe the precipitation of solids. After the solids were completely precipitated, the solids were filtered out, and the solids were washed with clean water and 2×50 mL of ethyl acetate to remove the unreacted reagents and solvents. Finally, the product 26-R3 (10.5 g, 93%) was dried under vacuum at room temperature and used directly in the next step.

[0403] The same chemical reaction preparation process was used, and the reactant hexadecanoic acid was replaced by pentadecanoic acid to obtain the product 26-R2 (7.8 g, 91%).

[0404] Compound 26-R3 (10.5 g, 24.6 mmol) was dissolved in 100 mL of a mixed solvent (methanol and dichloromethane, v / v, 1:1), and the reaction solution was mixed with 30 mL of a hydrochloric acid (4 M) aqueous solution. The mixed reaction solution was stirred for 30 minutes at room temperature, and then stirred for 20 hours at room temperature. Methanol and dichloromethane were removed after rotary evaporation. 100 mL of ethyl acetate was added, and the reaction solution and ethyl acetate were fully mixed and then rotary evaporation was performed. After the concentrate was mixed with 150 mL of a mixed solvent (n-hexane and ethyl acetate, v / v, 1:1), the solid product 27-R3 gradually precipitated. After filtration and vacuum drying, the product 27-R3 (9.5 g, 90%) was directly used for the next step reaction.

[0405] The same chemical reaction preparation process was used to post-treat compound 26-R2 and precipitate it to obtain product 27-R2 (11.2 g, 85%).

[0406] Compound 12 (8.72 g, 20 mmol) was dissolved in 40 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. After complete dissolution, 2-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (7.6 g, 20 mmol) and N,N-diisopropylethylamine (7 mL, 40 mmol) were gradually added in an ice bath, and the reaction solution was stirred thoroughly at 0 °C for 20 minutes. After the intermediate product was formed, compound 27-R3 (5.8 g, 16 mmol) was dissolved in 50 mL of dichloromethane and then added dropwise to the reaction flask. The reaction solution was warmed to room temperature (25 °C) and stirred at room temperature for another 4 hours. Dichloromethane was removed by rotary evaporation under reduced pressure, and then the reaction solution was poured into 250 mL of saturated sodium chloride solution and extracted with 2 × 200 mL of ethyl acetate. The organic phase was concentrated by rotary evaporation to semi-dryness and further purified by silica gel column chromatography using a gradient elution. First, it was washed with n-hexane solvent, then eluted with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), followed by elution with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluted with (ethyl acetate, 1% triethylamine) to collect the product fraction. The solvent was removed by vacuum pumping to obtain yellow solid 28-R3 (9 g, 59%).

[0407] Using the same chemical reaction preparation process, after reacting compound 27-R2 and separating and purifying by silica gel column chromatography, product 28-R2 (11 g, 55%) was obtained.

[0408] Compound 28-R3 (1.33 g, 2.0 mmol) was dissolved in 20 mL of dried dichloromethane, and then 1.4 mL of triethylamine was added. 4-Dimethylaminopyridine (0.02 g, 5.9 mmol) was stirred and dissolved in the reaction solution, and succinic anhydride (0.3 g, 3.0 mmol) was stirred and dissolved in the reaction solution at room temperature, and the reaction was stirred for 8 hours. Succinic anhydride (20 mg, 0.2 mmol) was added continuously and stirred at room temperature for another 14 hours. The reaction solution was poured into saturated sodium chloride solution and extracted with 2 × 100 mL of ethyl acetate. The organic phase was separated, dried with anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. It was purified by silica gel chromatography using a gradient elution. First, it was eluted with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v), and then eluted with a mixed solvent (ethyl acetate / methanol / triethylamine, 10:2:0.01, v / v / v) to elute the final product B9. The solvent was removed by vacuum pumping to obtain a pale yellow solid compound B9 (1.5 g, 78%). The product structure verification information is as follows: 1 H NMR(CDCl 3): d, 7.40-7.38 (m, 2H, trityl), 7.30-7.27 (m, 6H, trityl), 6.84-6.80 (m, 4H, trityl), 6.70 (m, 1H), 4.33-4.30 (m, 1H), 4.18-4.16 (m, 1H), 3.79 (s, 6H), 3.27-3.21 (m, 7H), 3.04-3.03 (m, 2H), 2.55-2.51 (m, 2H), 1.60-1.58 (m, 3H), 1.46-1.44 (m, 4H), 1.31-1.20 (m, 24H), 0.89-0.86 (m, 3H H) ppm. It can be seen that the product structure is correct.

[0409] Compound 28-R3 (5.3 g, 7.1 mmol) was dissolved in 70 mL of dry dichloromethane, and then N, N, N', N'-tetraisopropyl 2-cyanoethoxyphosphite (2.8 mL, 9.23 mmol) was quickly added to the above solution. The reaction solution was stirred at room temperature for 20 minutes under nitrogen protection. 14 mL of tetrazole (6.39 mmol, 0.45 M) dissolved in dry dichloromethane was added to the above reaction solution, and the reaction was continued under nitrogen protection at room temperature for 2 hours. The reaction solution was poured into saturated saline, extracted with 2×100 mL of dichloromethane, the organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. The silica gel column was used for purification and separation, using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), then eluting with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine), and the product components were collected, and the solvent was drained under reduced pressure to obtain a white solid A9-R3 (5.6 g, 82%). The product structure verification information is as follows: 1 H NMR (CDCl 3):δ, 7.43 - 7.41 (m, 2H, trityl), 7.31 - 7.22 (m, 6H, trityl), 7.23 - 7.21 (m, 1H, trityl), 6.84 - 6.82 (m, 4H, trityl), 6.67 (m, 1H), 5.29 (m, 1H), 3.78 (s, 6H), 3.77 - 3.66 (m, 4H, 3.54 - 3.51 (m, 2H), 3.28 - 3.24 (m, 2H), 3.22 - 3.17 (m, 4H), 2.55 - 2.53 (m, 2H), 2.09 - 2.04 (m, 2H), 1.56 - 1.55 (m, 2H), 1.45 - 1.42 (m, 4H), 1.30 - 1.22 (m, 26H), 1.20 - 1.15 (m, 6H), 1.11 - 1.08 (m, 6H), 0.89 - 0.86 (m, 3H) ppm. 31 ¹³C NMR(CDCl 3 ):δ, 148.44, 148.40 ppm. It can be seen that the structure of the product is correct.

[0410] Using the same chemical reaction preparation process, after reacting the 28 - R2 compound and separating and purifying it through a silica gel chromatography column, product A9 - R2 (3.3 g, 89%) was obtained. The product structure verification information is as follows: 1 ¹H NMR(CDCl 3 ):δ, 7.42 - 7.41 (m, 2H, trityl), 7.31 - 7.27 (m, 6H, trityl), 7.22 - 7.21 (m, 1H, trityl), 6.83 - 6.82 (m, 4H, trityl), 4.12 - 4.11 (m, 1H), 3.79 (s, 6H), 3.77 - 3.66 (m, 4H), 3.54 - 3.52 (m, 3H), 3.28 - 3.22 (m, 2H), 3.20 - 3.17 (m, 3H), 2.55 - 2.53 (m, 2H), 2.09 - 2.06 (m, 2H), 1.58 - 1.55 (m, 2H), 1.45 - 1.43 (m, 4H), 1.29 - 1.20 (m, 29H), 1.11 - 1.08 (m, 6H), 0.89 - 0.86 (m, 6H) ppm. 31 ³¹P NMR(CDCl 3 ):δ, 148.50, 148.46 ppm. It can be seen that the structure of the product is correct.

[0411] (8) Synthesis of lipid compound monomers (A10, B10)

[0412]

[0413] Hexadecanoic acid 18-R3 (6.4 g, 25 mmol) was dissolved in 100 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (10.5 g, 27.5 mmol) and N,N-diisopropylethylamine (11 mL, 63.2 mmol) were gradually added in an ice bath, and the reaction solution was stirred for 10 minutes at 0°C. After the intermediate product was generated, N-(tert-butyloxycarbonyl)-1,5-diaminopentane N-(4-aminoethyl)carbamic acid tert-butyl ester 29 (5.1 g, 25.2 mmol) was dissolved in 50 mL of dichloromethane and then added dropwise to the reaction bottle. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 6 hours. The dichloromethane was removed by rotary evaporation under reduced pressure, and then the reaction solution was poured into 200 mL of saturated saline solution to observe the precipitation of solids. After the solids were completely precipitated, the solids were filtered out, and the solids were washed with clean water and 50 mL of ethyl acetate to remove the unreacted reagents and solvents. Finally, the product 30-R3 (11 g, 91%) was dried under vacuum at room temperature and used directly in the next step.

[0414] The same chemical reaction preparation process was used, and the reactant hexadecanoic acid was replaced by pentadecanoic acid to obtain the product 30-R2 (9.5 g, 94%).

[0415] Compound 30-R3 (11 g, 24.9 mmol) was dissolved in 100 mL of a mixed solvent (methanol and dichloromethane, v / v, 1:1), and the reaction solution was mixed with 30 mL of a hydrochloric acid (4 M) aqueous solution. The mixed reaction solution was stirred for 30 minutes at room temperature, and then stirred for 20 hours at room temperature. After rotary evaporation, methanol and dichloromethane were removed. 100 mL of ethyl acetate was added, and the reaction solution and ethyl acetate were fully mixed and then rotary evaporation was performed. After the concentrate was mixed with 100 mL of a mixed solvent (n-hexane and ethyl acetate, v / v, 1:1), the solid product 31-R3 gradually precipitated. After filtration and vacuum drying, the product 31-R3 (10 g, 90%) was directly used for the next reaction.

[0416] The same chemical reaction preparation process was used to post-treat compound 30-R2 and precipitate it to obtain product 31-R2 (8.8 g, 87%).

[0417] Compound 12 (8.72 g, 20 mmol) was dissolved in 40 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (7.6 g, 20 mmol) and N,N-diisopropylethylamine (7 mL, 40 mmol) were gradually added in an ice bath, and the reaction solution was stirred for 20 minutes at 0°C. After the intermediate product was generated, compound 31-R3 (6 g, 16 mmol) was dissolved in 50 mL of dichloromethane and then added dropwise to the reaction bottle. The reaction solution was warmed to room temperature (25°C) and continued to stir at room temperature for 4 hours. The dichloromethane was removed by vacuum rotary evaporation, and then the reaction solution was poured into 250 mL of saturated saline solution and extracted with 2×200 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified and separated by silica gel chromatography using a gradient elution, first washed with n-hexane solvent, then eluted with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), continued to elute with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally elute with (ethyl acetate, 1% triethylamine) and collect the product components, and the solvent was evaporated under reduced pressure to obtain a yellow solid 32-R3 (9 g, 59%).

[0418] The same chemical reaction preparation process was used to react compound 31-R2, and then separated and purified by silica gel chromatography to obtain product 32-R2 (7.5 g, 54%).

[0419] Dissolve compound 32-R3 (1.4 g, 1.8 mmol) in 40 mL of desiccated dichloromethane, and then add 1.2 mL of triethylamine. Stir and dissolve 4-dimethylaminopyridine (0.02 g, 0.17 mmol) in the reaction solution, stir and dissolve succinic anhydride (0.57 g, 5.6 mmol) in the reaction solution at room temperature, and stir to react for 8 hours. Continue to add succinic anhydride (276 mg, 2.7 mmol) and continue stirring at room temperature for 14 hours. Pour the reaction solution into saturated saline, extract with 2×150 mL of ethyl acetate, separate the organic phase, dry with anhydrous sodium sulfate, and evaporate to semi-dryness under reduced pressure. Purify by silica gel chromatography, using a gradient elution, first with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v) eluted, and then with a mixed solvent (ethyl acetate / methanol / triethylamine, 10:2:0.01, v / v / v) to elute the final product B10, and drain the solvent under reduced pressure to obtain a light yellow solid compound B10-R3 (1.16 g, 75%). The product structure verification information is as follows: 1 H NMR (CDCl 3): d, 7.40-7.38 (m, 2H, trityl), 7.30-7.27 (m, 6H, trityl), 7.23-7.19 (m, 1H, trityl), 6 .84-6.81(m, 4H, trityl), 6.68(m, 1H), 4.34-4.31(m, 1H), 4.18-4.15(m, 1H), 3.78(s, 6H) , 3.27-3.18 (m, 6H), 3.15-3.14 (m, 1H), 3.05-3.01 (m, 2H), 2.57-2.50 (m, 4H), 2.15-2.14 (m, 2H), 1.57-1.49 (m, 2H), 1.47-1.43 (m, 5H), 1.31-1.18 (m, 26H), 0.89-0.86 (m, 3H) ppm. It can be seen that the product structure is correct.

[0420] Dissolve compound 32-R3 (6.1 g, 8 mmol) in 70 mL of dry dichloromethane, and then quickly add N, N, N', N'-tetraisopropyl 2-cyanoethoxyphosphite (3.14 mL, 10.4 mmol) to the above solution. Stir the reaction solution at room temperature for 20 minutes under nitrogen protection. Add 16 mL of tetrazole (7.2 mmol, 0.45 M) dissolved in dry dichloromethane to the above reaction solution, and continue to stir and react for 2 hours under nitrogen protection at room temperature. Pour the reaction solution into saturated saline, extract with 2×120 mL of dichloromethane, separate the organic phase, dry with anhydrous sodium sulfate, and evaporate to semi-dryness under reduced pressure. The silica gel column was used for purification and separation, using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), then eluting with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine), and the product components were collected, and the solvent was drained under reduced pressure to obtain a white solid A10-R3 (6.44 g, 84%). The product structure verification information is as follows: 1 H NMR (CDCl 3): d, 7.42-7.40 (m, 2H, trityl), 7.31-7.27 (m, 6H, trityl), 7.26-7.22 (m, 1H, trityl), 6.84-6.8 2(m, 4H, trityl), 6.76(m, 1H), 5.29(m, 1H), 3.79(s, 6H), 3.78-3.68(m, 4H), 5.54-3.51(m, 3H), 3 .27-3.25(m, 2H), 3.18-3.14(m, 4H), 2.55-2.52(m, 2H), 2.12-2.09(m, 2H), 1.66-1.58(m, 2H), 1. 48-1.40(m, 4H), 1.31-1.22(m, 28H), 1.16-1.15(m, 6H), 1.11-1.09(m, 6H), 0.89-0.86(m, 3H)ppm. 31 PNMR (CDCl 3 ): d, 148.47, 148.43 ppm. It can be seen that the product structure is correct.

[0421] The same chemical reaction preparation process was used to react the 32-R2 compound, and then separated and purified by silica gel chromatography to obtain the product A10-R2 (3.25 g, 91%). The product structure verification information is as follows: 1 H NMR (CDCl 3 ): d, 7.42-7.40 (m, 2H, trityl), 7.31-7.27 (m, 6H, trityl), 7.23-7.21 (m, 1H, trityl), 6.83-6 .82(m, 4H, trityl), 4.12-4.11(m, 1H), 3.79(s, 6H), 3.71-3.67(m, 2H), 3.53-3.52(m, 2H), 3.27 -3.25(m, 2H), 3.18-3.14(m, 4H), 2.55-2.52(m, 2H), 2.12-2.11(m, 2H), 1.60-1.59(m, 2H), 1.48 -1.40(m, 4H), 1.31-1.22(m, 29H), 1.16-1.11(m, 6H), 1.09-1.08(m, 6H), 0.89-0.86(m, 3H)ppm. 31 P NMR (CDCl 3 ): d, 148.53, 148.49 ppm. It can be seen that the product structure is correct.

[0422] (9) Synthesis of lipid compound monomer (A11)

[0423]

[0424] Dissolve 4,4'-dimethoxytriphenylmethane (6.8 g, 20 mmol) in 10 mL of dichloromethane. Slowly drop the solution into anhydrous pyridine (30 mL) solution containing 2'-methoxyuridine 50 (5.16 g, 20 mmol) at room temperature, and mix with a small amount of 0.2 mL of 4-(dimethylaminopyridine). Stir the solution for 14 hours at room temperature. Add 50 mL of water to the reaction mixture, and extract with 2×80 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified by silica gel chromatography using a gradient elution, first washing with (n-hexane / ethyl acetate, 3:1, v / v) solvent, then eluting with (n-hexane / ethyl acetate, 2:1, v / v), and finally eluting with (n-hexane / ethyl acetate, 1:1, v / v). The product components were collected and the solvent was evaporated under reduced pressure to obtain a white foamy solid 51 (9.5 g, 58%). The product 51 was directly used in the next step reaction.

[0425] 1-Hydroxyhexadecanol (2.42 g, 10 mmol) was dissolved in 80 mL of dry dichloromethane, and then N, N, N', N'-tetraisopropyl chlorophosphite (3.2 g, 12 mmol) and diisopropylethylamine (3.6 mL, 24 mmol) were quickly added to the above solution. The reaction solution was stirred at room temperature for 2 hours under nitrogen protection. A solution containing compound 51 (5.7 g, 10 mmol) in 25 mL of dichloromethane was added to the above reaction solution, and tetrazole (5 mL, 0.45 M) was added at the same time, and the reaction was continued to stir at room temperature for two hours. The reaction solution was poured into saturated saline, extracted with 2 × 80 mL of dichloromethane, the organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. Purify by silica gel chromatography, using a gradient elution, first eluting with a mixed solvent (n-hexane / ethyl acetate, 10:1, v / v, 1% triethylamine), then eluting with another mixed solvent (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), and draining the solvent under reduced pressure to obtain a transparent foamy nearly white compound A11 (6.9 g, 74%). The product structure verification information is as follows: 1 H NMR (CD 3CN): d, 8.08-8.03(m, 2H), 7.42-7.40(m, 3H, trityl), 7.30-7.27(m, 6H, trityl), 7.23-7.21( m, 1H, trityl), 6.85-6.82 (m, 4H, trityl), 5.99-5.98 (m, 2H), 5.20-5.16 (m, 2H), 4.50 (m, 1H) , 4.40 (m, 1H), 4.24 (m, 2H), 3.83-3.80 (m, 2H), 3.79 (s, 6H), 3.61-3.57 (m, 4H), 1.70 (m, 2H), 1 .50 (m, 2H), 1.31-1.21 (m, 26H), 1.04-1.03 (m, 6H), 0.89-0.86 (m, 6H), 1.09-1.08 (m, 6H)ppm. 31 P NMR (CDCl 3 ): d, 149.08, 148.63 ppm. It can be seen that the product structure is correct.

[0426] (10) Synthesis of lipid compound monomer (A12)

[0427]

[0428] Dissolve 4,4'-dimethoxytriphenylchloromethane (18g, 0.053mol) in a mixed solvent (40mL of dichloromethane, 8.7mL of triethylamine, 0.1mL of 4-(dimethylamino)pyridine). Add 1,3-propanediol (21g, 0.265mol) dropwise to the above solution with stirring, and continue stirring at room temperature for 12 hours. Pour the reaction solution into 100mL of saturated saline, extract with 300mL of dichloromethane, separate the organic phase, add anhydrous sodium sulfate to dry, and evaporate to semi-dryness under reduced pressure. Purify with silica gel column, use a gradient elution, first elute with a mixed solvent (n-hexane / ethyl acetate, 3:1, v / v), then elute with another mixed solvent (n-hexane / ethyl acetate, 1:1, v / v), and drain the solvent under reduced pressure to obtain an orange compound 1-O-dimethoxytrityl-1,3-propanediol (49, 16g, 80%). The product structure verification information is as follows: 1 H NMR (CDCl 3 ): d, 7.43-7.41 (2H, m), 7.33-7.27 (6H, m), 7.29-7.27 (1H, m), 6.85-6.82 (4H, m), 3.79-3.75 (7H, m), 3.29-3.27 (2H, m), 2.20-2.18 (1H, br), 1.88-1.83 (2H, br), 1.57 (1H, s). It can be seen that the product structure is correct.

[0429] 1-O-dimethoxytrityl-1,3-propanediol 49 (4.5 g, 12 mmol) was dissolved in 80 mL of dry dichloromethane, and then N,N,N',N'-tetraisopropyl chlorophosphite (3.85 g, 14.4 mmol) and diisopropylethylamine (4.4 mL, 24 mmol) were quickly added to the above solution. The reaction solution was stirred at room temperature for 15 minutes under nitrogen protection. 1-Hydroxyhexadecanol (3.9 g, 15.6 mmol) solution was added to the above reaction solution, and tetrazole (6 mL, 0.45 M, 3 mmol) was added at the same time, and the reaction was continued to stir at room temperature for one hour.

[0430] The reaction solution was poured into saturated saline, extracted with 2×60 mL of dichloromethane, the organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. Purification was performed by silica gel chromatography, using a gradient elution, first eluting with a mixed solvent (n-hexane / ethyl acetate, 10:1, v / v, 1% triethylamine), then eluting with another mixed solvent (n-hexane / ethyl acetate, 5:1, v / v, 1% triethylamine), and the solvent was drained under reduced pressure to obtain a transparent foamy nearly white compound A12 (5 g, 56%). The product structure verification information is as follows: 1 H NMR (DMSO-d 6 ): d, 7.42-7.40 (m, 3H, trityl), 7.30-7.27 (m, 6H, trityl), 7.23-7.21 (m, 1H, trityl), 6.84-6.82 (m, 4H, trityl), 3.71 (s, 6H), 3.67- 3.62 (m, 2H), 3.48-3.42 (m, 4H), 3.06-3.02 (m, 2H), 1.81-1.77 (m, 2H), 1.25-1.17 (m, 25H), 1.11-1.07 (m, 10H), 0.85-0.82 (m, 3H)ppm. 31 P NMR (DMSO-d 6 ): d, 145.12, 144.96 ppm. It can be seen that the product structure is correct.

[0431] (11) Synthesis of lipid compound monomer (A19)

[0432]

[0433] Hexadecanoic acid (5 g, 16.64 mmol) was dissolved in 25 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1.5:1) at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (6.6 g, 17.47 mmol) and N,N-diisopropylethylamine (8.7 mL, 49.92 mmol) were gradually added in an ice bath, and the reaction solution was stirred at 0°C for 20 minutes. After the intermediate product was generated, N-(tert-butyloxycarbonyl)-1,3-diaminopropane N-(3-aminopropyl)carbamic acid tert-butyl ester 37 (2.9 g, 16.64 mmol) was dissolved in 10 mL of dichloromethane and then added dropwise to the reaction bottle. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 5 hours. The dichloromethane was removed by rotary evaporation under reduced pressure, and then the reaction solution was poured into 500 mL of saturated saline solution to observe the precipitation of solids. After the solids were completely precipitated, the solids were filtered out, and the solids were washed with clean water and 50 mL of ethyl acetate to remove the unreacted reagents and solvents. Finally, the product 38 (4.7 g, 92%) was dried under vacuum at room temperature and used directly in the next step.

[0434] Compound 38 (4.6 g, 10.1 mmol) was dissolved in 30 mL of methanol solvent, the reaction solution was mixed with 10 mL of hydrochloric acid (4 M) aqueous solution and 30 mL of dioxane was added. The mixed reaction solution was stirred continuously for 30 minutes under ice bath conditions, and then the temperature was raised and stirred at room temperature for 18 hours. After rotary evaporation, methanol and dioxane were removed. 50 mL of ethyl acetate was added, the reaction solution and ethyl acetate were fully mixed, and then rotary evaporation was performed. After the concentrate was mixed with 100 mL of mixed solvent (n-hexane and ethyl acetate, v / v, 1:1), solid product 39 gradually precipitated. After filtering and vacuum drying, product 39 (4 g, 90%) was directly used for the next step reaction.

[0435] Compound 12 (4.7 g, 7.94 mmol) was dissolved in 50 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (3 g, 7.9 mmol) and N,N-diisopropylethylamine (5.5 mL, 26.48 mmol) were gradually added in an ice bath, and the reaction solution was stirred for 20 minutes at 0°C. After the intermediate product was generated, compound 39 (2.6 g, 6.62 mmol) was dissolved in 20 mL of dichloromethane and then added dropwise to the reaction bottle. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 5 hours. The dichloromethane was removed by vacuum rotary evaporation, and then the reaction solution was poured into 500 mL of saturated saline solution and extracted with 2×250 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified and separated by silica gel chromatography using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 2:1, v / v, 1% triethylamine), continuing to elute with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (ethyl acetate, 1% triethylamine) and collecting the product components, and the solvent was evaporated under reduced pressure to obtain a yellow solid 40 (3.4 g, 67%).

[0436] Compound 40 (3 g, 3.88 mmol) was dissolved in 40 mL of dry dichloromethane, and then N, N, N', N'-tetraisopropyl 2-cyanoethoxy phosphite (1.5 mL, 5.04 mmol) was quickly added to the above solution. The reaction solution was stirred at room temperature for 20 minutes under nitrogen protection. 20 mL of tetrazole (1.37 mL, 0.45 M, 6.16 mmol) dissolved in dry dichloromethane was added to the above reaction solution, and N, N, N', N'-tetraisopropyl 2-cyanoethoxy phosphite (0.22 mL, 0.11 mmol) was added to the reaction solution, and the reaction was continued to be stirred for 5 hours under nitrogen protection at room temperature. The reaction solution was poured into saturated saline, extracted with 2×100 mL of dichloromethane, the organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. The silica gel column was used for purification and separation, using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), then eluting with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine), and the product components were collected, and the solvent was drained under reduced pressure to obtain a white solid A19 (2.9 g, 84%). The product structure verification information is as follows: 1 H NMR (CDCl 3): d, 7.42-7.39 (m, 2H, trityl), 7.30-7.26 (m, 6H, trityl), 7.23-7.21 (m, 1H, trityl), 6.84 -6.81(m, 4H, trityl), 3.79(s, 6H), 3.77-3.70(m, 2H), 3.69(s, 3H), 3.69-3.65(m, 2H), 3.53 -3.51(m, 4H), 3.29-3.23(m, 4H), 3.23-3.13(m, 2H), 2.31-2.28(m, 2H), 2.17-2.14(m, 2H), 2 .04(s, 1H), 1.63-1.59(m, 2H), 1.31-1.20(m, 22H), 1.16-1.14(m, 6H), 1.10-1.08(m, 6H)ppm. 31 P NMR (CDCl 3 ): d, 148.53, 148.46 ppm. It can be seen that the product structure is correct.

[0437] (12) Synthesis of lipid compound monomer (A20)

[0438]

[0439] Hexadecanedioic acid 42 (0.286 g, 1 mmol) was dissolved in 5 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1.5:1) at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (0.338 g, 1 mmol) and N,N-diisopropylethylamine (0.4 mL, 4 mmol) were gradually added in an ice bath, and the reaction solution was stirred at 0°C for 20 minutes. After the intermediate product was generated, N-fluorenylmethoxycarbonyl-1,3-diaminopropane hydrochloride 41 (0.332 g, 1 mmol) was dissolved in 2 mL of dichloromethane and then added dropwise to the reaction bottle. The reaction solution was warmed to room temperature (25°C) and continued to stir at room temperature for 5 hours. Extraction was performed with 2×50 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified and separated by silica gel chromatography, eluted with (ethyl acetate / dichloromethane / methanol, 75:20:5, v / v), and the product components were collected. The solvent was evaporated under reduced pressure to obtain a yellow solid 43 (2.58 g, 87%).

[0440] Dissolve 2-chlorotrityl chloride 44 (1.6 g, 5.1 mmol) in 5 mL of dichloromethane. Slowly dropwise add the solution to 10 mL of mixed solvent (dichloromethane / N, N-diisopropylethylamine, 8.4:1.6, v / v) containing compound 43 (2.58 g, 4.57 mmol) at room temperature. Stir the solution for 4 hours at room temperature. Pour the reaction solution into 50 mL of saturated saline solution and extract with 2×50 mL of ethyl acetate. Drain the solvent under reduced pressure to obtain yellow solid 45 (5 g, 58%). Product 45 is directly used in the next step.

[0441] Compound 45 (5 g, 2.9 mmol) was dissolved in 10 mL of dried dimethylformamide. The solution was slowly added dropwise to 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) (1 mL) at room temperature. The solution was stirred for 1 hour at room temperature. The reaction solution was poured into 50 mL of saturated saline solution and extracted with 2×50 mL of ethyl acetate. The solvent was removed under reduced pressure to obtain yellow solid 46 (4.7 g, 95%). The crude product 46 was directly used in the next reaction.

[0442] The crude product compound 46 (4.7 g, 7.6 mmol) was dissolved in 20 mL of dimethylformamide. The reaction solution was mixed with 3-O-4,4'-dimethoxytrityl-2-hydroxy-2-methylpropionic acid 12 (2.3 g, 5.3 mmol) at 0°C, and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.7 g, 5.8 mmol) and N,N-diisopropylethylamine (3 mL) were added and stirred for 20 minutes. The temperature of the reaction solution was slowly raised to room temperature and stirred for 2 hours. The reaction solution was mixed with 20 mL of saturated sodium chloride aqueous solution and extracted with 2×50 mL of ethyl acetate. The organic phase was dried over anhydrous sodium sulfate and then concentrated by vacuum rotary evaporation to obtain the crude product 47. Continue purification with silica gel chromatography column, continue purification and separation with silica gel chromatography column, use a gradient elution, first wash with n-hexane solvent, then elute with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), continue to elute with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally elute with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine), collect the product components, and drain the solvent under reduced pressure to obtain compound 47 (1.4 g, 56%).

[0443] Compound 47 (1.4 g, 1.35 mmol) was dissolved in 20 mL of dry dichloromethane, and then N, N, N', N'-tetraisopropyl 2-cyanoethoxy phosphite (0.61 mL, 2.03 mmol) was quickly added to the above solution. The reaction solution was stirred at room temperature for 20 minutes under nitrogen protection. 20 mL of tetrazole (2.7 mL, 0.45 M, 1.22 mmol) dissolved in dry dichloromethane was added to the above reaction solution, and N, N, N', N'-tetraisopropyl 2-cyanoethoxy phosphite (0.1 mL, 0.33 mmol) was added to the reaction solution, and the reaction was continued to be stirred for 5 hours under nitrogen protection at room temperature. The reaction solution was poured into saturated saline, extracted with 2×100 mL of dichloromethane, the organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. The silica gel column was used for purification and separation, using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), then eluting with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine), and the product components were collected, and the solvent was drained under reduced pressure to obtain a white solid A20 (1.48 g, 90%). The product structure verification information is as follows: 1 H NMR (CDCl 3 ): d, 7.42-7.40(m, 2H, trityl), 7.30-7.18(m, 22H, trityl), 6.84-6.81(m, 4H, trityl), 3.79(s, 6H), 3.76-3.69(m, 3H), 3.68-3.51(m, 2H), 3.29-3.22( m, 4H), 3.14 (m, 2H), 2.55-2.51 (m, 2H), 2.17-2.14 (m, 2H), 2.05 (s, 1H), 1.67 -1.61(m, 2H), 1.29-1.16(m, 30H), 1.16-1.14(m, 6H), 1.11-1.08(m, 6H)ppm. 31 P NMR (CDCl 3 ): d, 148.53, 148.46 ppm. It can be seen that the product structure is correct.

[0444] (13) Synthesis of lipid compound monomers (A21, B21)

[0445]

[0446] 5-Hexynoic acid 33 (4.84 g, 43.2 mmol) was dissolved in 50 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (16.5 g, 43.2 mmol) and N,N-diisopropylethylamine (15 mL, 68.2 mmol) were gradually added in an ice bath, and the reaction solution was stirred at 0°C for 60 minutes. After the intermediate product was generated, N-(tert-butyloxycarbonyl)-1,3-diaminopropane N-(2-aminoethyl)carbamic acid tert-butyl ester 17 (7.53 g, 43.2 mmol) was dissolved in 50 mL of dichloromethane and then added dropwise to the reaction bottle. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 6 hours. The dichloromethane was removed by rotary evaporation under reduced pressure, and then the reaction solution was poured into 500 mL of saturated saline solution and extracted with 2×250 mL of ethyl acetate. The ethyl acetate was removed by rotary evaporation under reduced pressure to obtain a crude product 34 (5.5 g, 93%), which was dried in vacuo at room temperature and used directly in the next step.

[0447] Compound 34 (5.5 g, 40.1 mmol) was dissolved in 50 mL of a mixed solvent (methanol and dichloromethane, v / v, 1:1), and the reaction solution was mixed with 20 mL of a hydrochloric acid (4 M) aqueous solution. The mixed reaction solution was stirred for 30 minutes at room temperature, and then stirred for 24 hours at room temperature. After rotary evaporation, methanol and dichloromethane were removed. 100 mL of ethyl acetate was added, and the reaction solution and ethyl acetate were fully mixed and then rotary evaporation was performed. After the concentrate was mixed with 150 mL of a mixed solvent (n-hexane and ethyl acetate, v / v, 1:1), a solid product 35 was gradually precipitated. After filtration and vacuum drying, the product 35 (5.1 g, 90%) was directly used for the next step reaction.

[0448] Compound 12 (11.8 g, 20.0 mmol) was dissolved in 200 mL of a mixed solvent (dried dimethylformamide and dried dichloromethane, v / v, 1:1) at room temperature. After being fully dissolved, 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (7.6 g, 20.0 mmol) and N,N-diisopropylethylamine (7 mL, 23.6 mmol) were gradually added in an ice bath, and the reaction solution was stirred for 15 minutes at 0°C. After the intermediate product was generated, compound 35 (2.8 g, 20.1 mmol) was dissolved in 50 mL of dichloromethane and then added dropwise to the reaction bottle. The reaction solution was warmed to room temperature (25°C) and stirred at room temperature for 12 hours. The dichloromethane was removed by vacuum rotary evaporation, and then the reaction solution was poured into 500 mL of saturated saline solution and extracted with 2×250 mL of ethyl acetate. The organic phase was concentrated to semi-dryness by rotary evaporation and further purified and separated by silica gel chromatography using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine), continuing to elute with (n-hexane / ethyl acetate, 1:4, v / v, 1% triethylamine), and finally eluting with (ethyl acetate, 1% triethylamine) and collecting the product components, and the solvent was evaporated under reduced pressure to obtain a yellow solid 36 (8.8 g, 59%).

[0449] Compound 36 (1.17 g, 2.0 mmol) was dissolved in 25 mL of dry dichloromethane, and then 1.4 mL of triethylamine was added. 4-Dimethylaminopyridine (0.2 g, 1.6 mmol) was stirred and dissolved in the reaction solution, and succinic anhydride (0.3 g, 3 mmol) was stirred and dissolved in the reaction solution at room temperature, and the reaction was stirred for 8 hours. Succinic anhydride (50 mg, 0.5 mmol) was added, and stirring was continued for 14 hours at room temperature. The reaction solution was poured into saturated saline, extracted with 2×250 mL of ethyl acetate, the organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. Purify by silica gel chromatography, using a gradient elution, first with a mixed solvent (ethyl acetate / triethylamine, 100:1.5, v / v) eluted, and then with a mixed solvent (ethyl acetate / methanol / triethylamine, 100:10:1, v / v / v) to elute the final product B21, and drain the solvent under reduced pressure to obtain a light yellow solid compound B21 (0.97 g, 81%). The product structure verification information is as follows: 1 H NMR (CDCl 3): d, 7.39-7.37 (m, 2H, trityl), 7.30-7.27 (m, 6H, trityl), 7.23-7.21 (m, 1H, trityl), 6.84-6.81 (m, 4H, trityl), 3.79 (s, 6H), 3.28-3.20 (m, 4H), 3.03-3.00 (m, 4H), 2.53-2.51 (m, 4H), 2.33-2.30 (m, 2H), 2.25-2.22 (m, 2H), 1.97 (m, 1H), 1.87-1.83 (m, 2H), 1.58-1.54 (m, 2H), 1.28-1.23 (m, 5H) ppm. It can be seen that the product structure is correct.

[0450] Compound 36 (6.5 g, 11.1 mmol) was dissolved in 80 mL of dry dichloromethane, and then N,N,N'N'-tetraisopropyl 2-cyanoethoxyphosphite (4.0 mL, 13.3 mmol) was quickly added to the above solution. The reaction solution was stirred in an ice bath under nitrogen protection for 20 minutes. 23.4 mL of tetrazole (10.5 mmol) dissolved in dry dichloromethane was added to the above reaction solution, and the reaction was continued in an ice bath under nitrogen protection for 3 hours. The reaction solution was poured into saturated saline, extracted with 2×150 mL of ethyl acetate, the organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. The silica gel column was used for purification and separation, using a gradient elution, first washing with n-hexane solvent, then eluting with (n-hexane / ethyl acetate, 3:1, v / v, 1% triethylamine), then eluting with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine), and finally eluting with (n-hexane / ethyl acetate, 1:2, v / v, 1% triethylamine), and the product components were collected, and the solvent was drained under reduced pressure to obtain a white solid A21 (7.4 g, 80%). The product structure verification information is as follows: 1 H NMR (CDCl 3): d, 7.42-7.39 (m, 2H, trityl), 7.30-7.27 (m, 6H, trityl), 7.23-7.21 (m, 1H, trityl), 6.84 -6.81(m, 4H, trityl), 3.79(s, 6H), 3.78-3.76(m, 2H), 3.71-3.68(m, 2H), 3.29-3.23(m, 4H) , 3.17-3.15(m, 2H), 2.56-2.52(m, 2H), 2.32-3.22(m, 4H), 1.96-1.95(m, 1H), 1.87-1.84(m, 2H), 1.71 (s, 1H), 1.53 (m, 2H), 1.28-1.26 (m, 5H), 1.16-1.12 (m, 6H), 1.10-1.08 (m, 6H)ppm. 31 P NMR (CDCl 3 ): d, 148.62, 148.54 ppm. It can be seen that the product structure is correct.

[0451] (14) Chemical synthesis of lipid compound monomer (A22)

[0452]

[0453] Dissolve hexadecanedioic acid monomethyl ester 53 (6 g, 20 mmol) in 20 mL of a mixed solvent (dried dimethylformamide) at room temperature. After fully dissolved, gradually add 2-(7-azobenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (8 g, 40 mmol) and N,N-diisopropylethylamine (7 mL, 40 mmol) in an ice bath, and stir the reaction solution at 0°C for 20 minutes. After the intermediate product is generated, dissolve 1,7-Bis-Boc-1,4,7-triazaheptane nicosulfuron 52 (6.2 g, 20 mmol) in 10 mL of dimethylformamide and then add it dropwise to the reaction bottle. Warm the reaction solution to room temperature (25°C) and continue stirring at room temperature for 10 hours. Pour the reaction solution into 100 mL of saturated saline solution and extract with 2×150 mL of ethyl acetate. The solvent was removed under reduced pressure to obtain yellow solid 54 (12 g, 85%). The crude product was directly used in the next reaction.

[0454] Compound 54 (12 g, 20 mmol) was dissolved in 50 mL of methanol, and the reaction solution was mixed with 30 mL of hydrochloric acid (4 M) aqueous solution. The mixed reaction solution was stirred for 60 minutes at room temperature. After rotary evaporation, 50 mL of ethyl acetate was added, and the methanol and excess water were removed after further rotary evaporation to obtain a viscous crude product 55 (9 g, 90%), which was directly used in the next step.

[0455] The crude product compound 55 (3.73 g, 8.14 mmol) and 5-hydroxypentanoic acid (2.85 g, 20.35 mmol) were dissolved in 50 mL of dimethyl sulfoxide (DMSO) and stirred at room temperature for 20 minutes. The reaction solution was mixed with benzotriazol-1-yloxytris(dimethylamino)phosphonium hexafluorophosphate (BOP, 9 g, 20.3 mmol) and N,N-diisopropylethylamine (3 mL, 40.6 mmol) and stirred at room temperature for 4 hours. The reaction solution was mixed with 50 mL of water to obtain a white precipitate. After washing and filtering, the product 57 (3.6 g, 76%) was obtained. This product was directly used for the next step reaction.

[0456] Compound 57 was washed with pyridine and rotary evaporated twice, and then dried for later use. 2-Chlorotrityl chloride (2 g, 6 mmol) was dissolved in 5 mL of pyridine. The solution was slowly added dropwise to 20 mL of pyridine containing compound 57 (3.6 g, 6.1 mmol) at room temperature. The solution was stirred continuously for 4 hours at room temperature. The reaction solution was poured into 50 mL of saturated saline solution and extracted with 2×100 mL of ethyl acetate. The solvent was dried under reduced pressure to obtain a crude yellow solid 58. Purification was continued on a silica gel column. Purification and separation were continued on a silica gel column using a gradient elution, first with (ethyl acetate / methanol, 3:1, v / v), then with (ethyl acetate / methanol, 5:1, v / v), and finally with (ethyl acetate / methanol, 10:1, v / v). The product components were collected and the solvent was dried under reduced pressure to obtain compound 58 (2.2 g, 41%).

[0457] Compound 58 (2.1 g, 2.36 mmol) was dissolved in 30 mL of dry dichloromethane, and then N, N, N', N'-tetraisopropyl 2-cyanoethoxyphosphite (926 mg, 3.07 mmol) was quickly added to the above solution. The reaction solution was stirred at room temperature for 20 minutes under nitrogen protection. 5 mL of thioethyltetrazole (ETT, 307 mg, 2.36 mmol) dissolved in dry dichloromethane was added to the above reaction solution, and the reaction was continued to stir for 2 hours under nitrogen protection at room temperature. The reaction solution was poured into saturated saline (25 mL) and saturated sodium bicarbonate aqueous solution (25 mL), extracted with 2×150 mL of ethyl acetate, the organic phase was separated, dried over anhydrous sodium sulfate, and evaporated to semi-dryness under reduced pressure. The silica gel column was used for purification and separation, using a gradient elution, first with (n-hexane / ethyl acetate, 1:1, v / v, 1% triethylamine) solvent washing, then with (n-hexane / ethyl acetate, 0:1, v / v, 1% triethylamine) elution, and finally with (ethyl acetate / methanol, 20:1, v / v, 1% triethylamine) elution, and the product components were collected, and the solvent was drained under reduced pressure to obtain a nearly white solid A22 (2 g, 78%). The product structure verification information is as follows: 1 H NMR (CDCl 3 ): d, 7.42-7.40 (m, 3H, trityl), 7.30-7.27 (m, 6H, trityl), 7.23-7.21 (m, 1H, trityl), 6.84-6 .82(m, 4H, trityl), 4.12-4.11(m, 1H), 3.81-3.80(m, 1H), 3.78(s, 6H), 3.59-3.55(m, 4H), 3.49 -3.47(m, 3H), 3.40-3.42(m, 2H), 3.41-3.40(m, 7H), 3.06-3.04(m, 3H), 2.64-2.59(m, 2H), 2.31 -2.29 (m, 4H), 2.28-2.16 (m, 4H), 1.70-1.58 (m, 8H), 1.29-1.23 (m, 28H), 1.17-1.15 (m, 8H)ppm. 31 P NMR (CDCl 3 ): d, 147.32, 147.23 ppm. It can be seen that the product structure is correct.

[0458] (15) Synthesis of Compounds C1-C14

[0459] The synthesis methods of compounds C1-C14 are similar, and only appropriate raw materials need to be selected and replaced according to the structures of the compounds.

[0460] This example uses compound C1 as an example to illustrate the preparation method. In this step, the solid phase support of (C1) is prepared by connecting the conjugated molecule (B1) to the solid phase support.

[0461] The lipid compound monomer hemisuccinate (B1, 50 mg, 0.072 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate (10 mg, 0.026 mmol) were dissolved in 1.25 mL of anhydrous acetonitrile at room temperature. N,N-diisopropylethylamine (10 μL) was added to the reaction solution. After all reagents were dissolved, 125 mg of long-chain aminoalkane glass sand (500°A, native lcaa-CPG, manufacturer Chemgenes, USA) was added to the reaction solution. At room temperature, the solid and liquid phases were rotated and stirred at 300 rpm. After the reaction lasted for 2 hours, the residual liquid was filtered out and the long-chain aminoalkane glass sand solid phase carrier was washed three times with acetonitrile (3×1 mL). 0.5 mL of the capping reagent A acetic anhydride tetrahydrofuran solution, concentration (10%, v / v) and 0.5 mL of the capping reagent B N-methylimidazole in a mixed solvent of pyridine and acetonitrile, concentration (15:10:75, v / v / v) were mixed with long-chain aminoalkane glass sand and stirred at room temperature for 1 hour. The reaction solution was filtered out, and the long-chain aminoalkane glass sand solid phase carrier was rinsed with acetonitrile 3 times, and the long-chain aminoalkane glass sand solid phase carrier was dried under reduced pressure for 2 hours using a vacuum oil pump. The glass sand solid phase carrier (603C, 130 mg) was obtained. The long-chain aminoalkane glass sand C1 solid phase carrier (8.3 mg) was weighed and added to 100 mL of 3% trichloroacetic acid in dichloromethane solution, stirred for 30 seconds, and allowed to stand for 1 minute. The supernatant was taken and the visible light absorption was measured at 498 nm. The light absorbance was 0.309, and the loading of lipid compound monomer C1 was calculated to be 53.25 μmol / g.

[0462] Example 7

[0463] In this example, the siRNA conjugate structure was designed and synthesized based on the structure of the lipid compound shown in the previous examples.

[0464] This embodiment involves two designs, namely, siRNA double-stranded RNA is coupled to a lipid compound, or siRNA double-stranded RNA is connected to a single-stranded phosphosulfate oligonucleotide by coupling a lipid compound. Single-stranded phosphosulfate oligonucleotides include single-stranded phosphate oligonucleotides, which are formed by thiolation of double-bonded oxygen atoms and / or single-bonded hydroxyl oxygen atoms in the phosphate structure.

[0465] The structures of the conjugates include the specific structures in the aforementioned Tables 3-5.

[0466] In the above siRNA structure of this example, capital letters C, G, U and A represent the base composition of nucleotides; lowercase letters g, t and a represent the base composition of 2'-deoxynucleotides; lowercase letter m represents that the nucleotide adjacent to the right of letter m is a 2'-methoxy-modified nucleotide (i.e., the pentose 2'-OH of the nucleotide is replaced by a methoxy group); lowercase letter f represents that the nucleotide adjacent to the left of letter f is a 2'-fluorine-modified nucleotide (i.e., the pentose 2'-OH of the nucleotide is replaced by a fluorine); capital bold T, G, A represent The uppercase boldface C indicates that the nucleotide is a 2'-O-methoxyethoxy-modified nucleotide; the uppercase boldface C is a 5-methyl-2'-O-methoxyethoxy-modified C nucleotide; the uppercase italic C is a 5-methyl-2'-deoxy-modified C nucleotide; the lowercase letter s indicates that the two nucleotides adjacent to the letter s are connected by a thiophosphate diester bond (i.e., the non-bridging oxygen atom in the phosphodiester bond is replaced by a sulfur atom), and there are no other letters between the two adjacent nucleotides on the left and right, indicating a phosphodiester bond connection; ss represents the sense strand; and as represents the antisense strand.

[0467] According to literature reports, the currently feasible structure may be a gyratory complementary structure, and the synthesis process basically adopts the traditional solid-phase synthesis method.

[0468] This embodiment relates to a method for preparing the above-mentioned nucleic acid lipid chain conjugate. The preparation process of the nucleic acid conjugate refers to the cyclic reaction shown below (this reaction is only for illustrating the principle of the method of the present invention, and the preparation method of the present invention is not limited thereto. Those skilled in the art can prepare the conjugate of the present invention by appropriately adjusting the preparation method according to the disclosure of the present invention).

[0469]

[0470] B in the above figure is selected from the following formulas (B1), (B2), (B3), and DMT is a dye. Therefore, according to some embodiments of the present invention, the A series lipid compound monomer intermediate has any one of the structures shown in the following formulas, thereby forming a monomer for synthesizing a conjugate containing a nucleic acid:

[0471]

[0472] Wherein, M in formula (B2) is selected from one of TEA (triethylamine), trimethylamine, triisopropylamine and tripropylamine. Wherein R in formula (B3) 1 R 2 Can be independently selected from 2,2,2-trichloroethyl, phenyl, o-chlorophenyl and cyanoethyl. (B1), (B2), (B3) Indicates the site where lipid compounds (eg, L1 to L36) can be linked via covalent bonds.

[0473] The preparation method of the nucleic acid conjugate of the present invention adopts a solid phase phosphoramidite chemical synthesis method according to the nucleic acid to be prepared, such as RNA sequence. Unmodified or modified RNA phosphoramidite, unless otherwise specified, can be commercially available.

[0474] As an practicable manner, the solid phase support for solid phase synthesis of the desired nucleotide is selected from a commercially available general solid phase support, such as HL UnyLinker TM 300 Oligonucleotide Synthesis Support, Kinovate Life Sciences, or, Long chain alkylamine controlled pore glass, CPG 500°A, 1000°A; Chemgenes.

[0475]

[0476] CPG is the abbreviation of porous glass sand; Lcaa is the abbreviation of long chain alkane amino; SPS is the abbreviation of sodium polydisulfide propane sulfonate.

[0477] The loading capacity of the solid phase carrier is usually micromoles of the compound that can be loaded per gram of solid phase carrier (30-200 μmol / g).

[0478] The preparation method of the nucleic acid conjugate of the present invention is based on the phosphoramidite solid phase synthesis method, using the cyclic reaction shown above, based on the nucleic acid sequence, and connecting nucleoside monomers or lipid compound monomers one by one in the direction from 3' to 5'. Each connection of a nucleoside monomer or lipid compound monomer includes four steps of deprotection, coupling, capping, and oxidation (refer to the above cyclic reaction).

[0479] This example takes the preparation of a conjugate containing the sense and antisense sequences of rat SOD1 siRNA (numbered SN-16983) as an example to illustrate the preparation method of the conjugate.

[0480] In this embodiment, the siRNA targeting mouse SOD1 is a sequence numbered SN-16983 and is as follows, wherein ss is the sense strand and as is the antisense strand:

[0481] Justice chain (ss):

[0482] 5'-mCsmAsmUmUmUmUAfmAUfCfCfmUmCmAmCmUmCmUmAsmAsmA-3′-L3;

[0483] Antisense strand (as):

[0484] 5'-mUsUfsmUmAmGAfmGUfGfmAmGmGmAUfmUAfmAmAmAmUmGsmAsmG-3';

[0485] Among them, capital letters C, G, U, and A represent the base composition of nucleotides; lowercase letter m represents that the nucleotide adjacent to the right of letter m is a 2'-methoxy-modified nucleotide; lowercase letter f represents that the nucleotide adjacent to the left of letter f is a 2'-fluorine-modified nucleotide; lowercase letter s represents that the two nucleotides adjacent to the left and right of letter s are connected by a phosphorothioate diester bond; no other letters between the two adjacent nucleotides on the left and right represent that they are connected by a phosphodiester bond. L3 is the structural part of the conjugate of the lipid chain, and the specific structure is described in the above embodiment.

[0486] In the embodiment, the preparation method of the nucleic acid conjugate is to connect nucleoside monomers or lipid compound monomers one by one in the direction of 3'-5' according to the above sequence order according to the phosphoramidite solid phase synthesis method. Each connection of a nucleoside monomer or lipid compound monomer includes four steps of deprotection, coupling, capping, and oxidation.

[0487] Specifically, the solid phase synthesis reagent preparation method is as follows:

[0488] The deprotection reagent is a dichloromethane solution of trichloroacetic acid or dichloroacetic acid (3%, v / v), the nucleoside monomer is dissolved in anhydrous acetonitrile, the concentration is (0.05M-0.1M), and a small amount of molecular sieve 3A° is added for anhydrous treatment. The coupling activator is anhydrous acetonitrile of 5-ethylthio-1H-tetrazole (5-Ethylthio-1H-Tetrazole), the concentration is (0.25M or 0.45M), and the activator can also be 1H-tetrazole (Tetrazole); 5-benzylthio-1H-tetrazole, 4,5-dicyanoimidazole (5-Benzylthio-1H-Tetrazole), 4,5-Dicyanoimidazole. Specifically, the capping reagent A is a tetrahydrofuran solution of acetic anhydride, the concentration of which is (10%, v / v), and the capping reagent B is a mixed solvent of N-methylimidazole in pyridine and acetonitrile, the concentration of which is (15:10:75, v / v / v). Specifically, the oxidizing reagent is iodine water and pyridine solution (0.05M, 95% pyridine aqueous solution), the sulfiding reagent is (t-Butylformyl)amino-3H-1,2,4-dithiazoline-3-thione, the concentration of which is (0.05M, pyridine / acetonitrile), and the cleavage deprotection reagent is 28% concentrated ammonia water.

[0489] Specifically, the reaction conditions and process of solid phase synthesis are as follows:

[0490] The 4,4′-dimethoxytrityl protecting group on the solid phase carrier or the nucleoside monomer connected to the carrier on the synthesizer is reacted with a solution of trichloroacetic acid in dichloromethane (3%, v / v) at a molar ratio of (1:30). The solid phase reaction at room temperature is 1.5 minutes, and the operation is repeated three times. When the color of the eluent of the solid phase carrier changes from red to colorless, the deprotection solution is stopped. After repeated washing with anhydrous acetonitrile, the nucleoside monomer (or A6-R3, i.e., the lipid compound monomer used to synthesize L3) and the coupling activator (ratio of 1:1) are added, and the molar ratio of the solid phase carrier to the nucleoside monomer is (1:5-1:6). The room temperature reagent and solid phase reaction time is 3-4 minutes per cycle, and the reaction is stopped after two cycles. After washing with anhydrous acetonitrile, the oxidizing reagent solution is added, and the molar ratio of the solid phase carrier to the oxidizing agent is (1:6). The reaction time of the oxidizing reagent and the solid phase carrier at room temperature is about 2 minutes, and the operation is repeated twice. After the coupling reaction, if a sulfurization step is required, add a sulfurization reagent solution, and the molar ratio of the solid phase carrier to the sulfurization agent is (1:6). The reaction time of the oxidizing agent and the solid phase carrier at room temperature is about 4-5 minutes, and the operation is repeated twice. For the capping protection reaction, add a capping reaction reagent, and the molar ratio of the solid phase carrier to the capping reagent is (1:80). The reaction time of the capping reagent and the solid phase carrier at room temperature is about 1-2 minutes, and the operation is repeated twice. The above deprotection, coupling, oxidation, and capping steps are circulated until the coupling of the last nucleotide is completed. The solid phase carrier carrying the sense chain or antisense chain of the nucleic acid sequence is transferred to a small glass bottle, 28% ammonia solution is added, and the glass cover is screwed and sealed. At a temperature of 55°C, the base protecting group in the sense chain or antisense chain is hydrolyzed and removed, and the sense chain or antisense chain is hydrolyzed and separated from the solid phase carrier. The reaction lasts for 16 hours. The obtained small nucleic acid sequence chain solution is separated from the solid phase carrier by filtration. After concentration, a crude product of the small nucleic acid sequence chain is obtained.

[0491] Specifically, the process of the preparative high pressure liquid chromatography purification separation and desalting method is as follows:

[0492] Small nucleic acids were purified by gradient elution with NaBr using a preparative anion exchange chromatography column (Source 15Q). Mobile phase A: 20 mM sodium phosphate (pH 8.0), mobile phase B: 20 ​​mM sodium phosphate (pH 8.0), 1 M sodium bromide in 10% acetonitrile in water. The column temperature was 65°C and the flow rate was 10 mL / min. The elution gradient started with mobile phase A, and then mobile phase B increased from (0%) to 20% in 12 minutes. In the following 15 minutes, mobile phase B was increased from 20% to 50%. The product eluate was collected, and component analysis and component combination were performed, and desalting or dialysis desalting was performed using a reverse phase chromatography purification column. After concentration and freeze drying, purified small nucleotides were obtained. For the above-synthesized sense and antisense chains, anion exchange liquid chromatography (AE×-HPLC) was used to detect purity, and reverse phase liquid chromatography-mass spectrometry (LC-MS) was used to identify and analyze the molecular weight of the entire sequence to confirm the synthesized nucleic acid sequence.

[0493] Specifically, the annealing method process is as follows:

[0494] According to the aforementioned implementation method, the synthesized sense chain (ss chain) and antisense chain (as chain) are mixed in an equimolar ratio in physiological saline for injection, heated at 90°C for 5 minutes, then slowly cooled to room temperature, and stored in a 4°C refrigerator for 12 hours to form a double-stranded structure through hydrogen bonds to obtain a siRNA conjugate.

[0495] The present invention can prepare all the conjugates of the present invention with the desired structure in a similar manner according to the principles and ideas of the above-mentioned preparation method, which is completely feasible for those skilled in the art.

[0496] Example 8

[0497] In this embodiment, the conjugate synthesized in Example 7 is further illustrated. In this embodiment, conjugates numbered SN-16983, 16996 are synthesized. The sequence of the conjugate is as follows, wherein ss is the sense strand and as is the antisense strand:

[0498] SN-16983:

[0499] Sense strand (ss): 5′-mCsmAsmUmUmUmUAfmAUfCfCfmUmCmAmCmUmCmUmAsmAsmA-3′-L3′;

[0500] Antisense strand (as): 5′-mUsUfsmUmAmGAfmGUfGfmAmGmGmAUfmUAfmAmAmAmUmGsmAsmG-3′;

[0501] SN-16996:

[0502] Sense strand (ss): 5'-mCsmAsmUmUmUmUAfmAUfCfCfmUmCmAmCmUmCmUmAsmAsmA-L17'-TsAGsGAstsastsastststsCstsasCAsGCsT 3′;

[0503] Antisense strand (as) 5'-mUsUfsmUmAmGAfmGUfGfmAmGmGmAUfmUAfmAmAmAmUmGsmAsmG-3'.

[0504] The monomers (phosphoramidites) required for the synthesis are:

[0505] mC represents 2′-methoxycytidine phosphoramidite, for example, CAS: 199593-09-4,

[0506] mG represents 2′-methoxyguanosine phosphoramidite, for example, CAS: 150780-67-9,

[0507] mA represents 2′-methoxyadenine nucleoside phosphoramidite, for example, CAS: 11-782-31-5,

[0508] mU represents 2′-methoxyuridine phosphoramidite, for example, CAS: 110764-79-9,

[0509] fC represents 2′-fluorocytidine phosphoramidite, for example, CAS: 159414-99-0,

[0510] fG represents 2′-fluoroguanosine phosphoramidite,

[0511] fA represents 2′-fluoroadenine nucleoside phosphoramidite, for example, CAS: 136834-22-5,

[0512] fU represents 2′-fluorouridine phosphoramidite,

[0513] t represents thymidine phosphoramidite, for example, CAS: 98796-51-1,

[0514] C represents 2′-methoxyethoxy 5-methylcytidine phosphoramidite, for example, CAS: 163759-94-2,

[0515] G represents 2′-methoxyethoxyguanosine phosphoramidite, for example, CAS: 251647-55-9,

[0516] A represents 2′-methoxyethoxyadenine nucleoside phosphoramidite, for example, CAS: 251647-53-7,

[0517] T represents 2′-methoxyethoxythymidine phosphoramidite,

[0518] C represents 5-methylcytosine deoxynucleoside phosphoramidite, for example, 105931-57-5,

[0519] Lowercase letter a indicates the base composition of 2'-deoxynucleotide, for example, dA amidite, CAS: 98796-53-3,

[0520] The lowercase letter g represents the base composition of 2'-deoxynucleotide, such as dG amidite, CAS: 93183-15--4,

[0521] The above monomers were all purchased from Shanghai Zhaowei Technology Development Co., Ltd.

[0522] The lipid compound monomer A6 (ie, L3 or L17) phosphoramidite synthesized in this example is synthesized by referring to the corresponding preparation method in Example 6.

[0523] The above monomers were synthesized on an RNA / DNA automatic synthesizer (MerMode-12).

[0524] Example 9

[0525] The structure of the conjugate synthesized in the above examples was confirmed by the following instruments and software:

[0526] Instruments: CTC injector, Agilent 1100 Series liquid chromatograph, FINNIGAN LTQMASS 004 mass spectrometer.

[0527] Software: LTQ Tune, Xcalibur, ProMass for Xcalibur.

[0528] The relevant workflow is as follows.

[0529] 2.1 Mobile phase preparation

[0530] 2.1.1 Reagent specifications

[0531] 1) HPLC grade H 2 O (reagent water), ACN (acetonitrile);

[0532] 2) Purity ≥ 99%: HFIP (hexafluoroisopropanol), DIEA (N, N-diisopropylethylamine), EDTA (ethylenediaminetetraacetic acid), ammonia water.

[0533] 2.1.2 Mobile phase A & B

[0534] 2.1.2.1 EDTA Stock Solution 1mM: 1mM EDTA + 1 ml ammonia water in 1 L 15% ACN / water (v:v);

[0535] 2.1.2.2 Phase A: 750 μl HFIP + 375 μl DIEA + 10 ml EDTA stock solution in 990 ml Water;

[0536] 2.1.2.3 Phase B: 750 μl HFIP + 375 μl DIEA + 10 ml EDTA stock solution in 990 ml 65% ACN / water (v:v).

[0537] 2.2 Preparation of Sample Injection Solution

[0538] Prepare the sample into 0.5 OD / 200 μl (about 0.014 nmol / μl) according to the LC-MS injection requirements.

[0539] 2.3 Instrument Method Settings

[0540] 2.3.1 Chromatographic Column Specifications

[0541] XBridge Oligonucleotide BEH C18 Column 2.5 μm, 4.6 × 50 mm.

[0542] 2.3.2 Method Settings

[0543] Flow rate: 0.8 ml / min, injection volume: 10 μl;

[0544]

[0545] MS parameters: Polarity: negative; Data type: Centroid; Ion source: ESI;

[0546] Scan range (m / z): 550 - 1600; Running time: 2 min;

[0547] Sheath Gas flow rate (arb): 45;

[0548] Aux Gas flow rate (arb): 10;

[0549] Sweep Gas flow rate (arb): 10;

[0550] Spray voltage {kV}: 3.00;

[0551] Capillary temperature {℃}: 350.0;

[0552] Capillary voltage {V}: -35;

[0553] Tube Lens {V}: -135.

[0554] In the present invention, the mass spectrometry analysis data of the conjugate containing the sense strand and antisense strand of siRNA are as follows.

[0555] Table 9

[0556]

[0557]

[0558]

[0559]

[0560] Example 10

[0561] In this example, biological data detection was performed on siRNA and / or single-stranded phosphosulfate oligonucleotides, and the siRNA conjugates synthesized in Example 7, including in vitro assays, in vivo assays, and scanned images. In this example, siRNA conjugates, siRNA, and / or single-stranded phosphosulfate oligonucleotides were dissolved in a solvent (PBS buffer; manufacturer absin; item number abs962) to prepare a PBS solution. The solution can be used as an injection. The solution was used in cell experiments and rat experiments.

[0562] (1) Residual SOD1 mRNA levels in rat B35 cells

[0563] The different siRNA conjugates or solvent (PBS) involved in Example 7 were used to test the residual SOD1 mRNA level in mouse B35 cells. The results are shown in the attached Figure 1 .

[0564] After overnight incubation, 12K rat B35 cells were added with siRNA conjugates to a final concentration of 2 μM and incubated for 24 hours. After the incubation, the cells were washed with PBS and RNA was extracted according to the recommendations of the RNeasy mini kit (Qiagen). RT-PCR was then performed to generate cDNA according to the following recipe and procedure.

[0565] Table 10

[0566] Components Volume (μL) 100mM dNTP 0.8 50U / μL Multiscribe Reverse Transcriptase 1 10×RT buffer 2 10×RT random primers 2 Enzyme-free sterile water 4.2 RNA samples 10

[0567] The RT-PCR procedure was as follows: 25°C for 10 min → 37°C for 2 h → 85°C for 5 min → 4°C for standby.

[0568] The generated cDNA was PCR-PCR-converted into TaqMan TM For Fast qPCR experiments, two technical replicates were performed for each sample according to the following formula.

[0569] Table 11

[0570]

[0571]

[0572] qPCR in QuantStudio TM 6 Pro (Thermo Fisher), the procedure is as follows:

[0573]

[0574] The SOD1 gene expression was detected by qPCR. 1 When it is an alkane chain, within the range of C13 to C16 alkane chains, R' 1 The conjugate with C15 alkane chain achieved the best intracellular delivery and the best inhibition level on mRNA.

[0575] (2) Residual SOD1 mRNA levels in SD rat brain

[0576] siRNA (SN-981), different siRNA conjugates mentioned in Example 7 or vehicle (PBS) were used to test the residual SOD1 mRNA level in the brain of SD rats.

[0577] SD rats were injected intracranially with vehicle (without siRNA and siRNA conjugates), PBS solution containing 0.9 mg siRNA or siRNA conjugates on day 0, and with RNA extraction reagent (Thermo Fisher) was used to extract RNA from brain tissue, and cDNA was generated according to the aforementioned RT-PCR method. The expression of rat SOD1 gene was detected by the aforementioned qPCR method, with 3 rats in each group. The results are shown in the attached Figure 2 .

[0578] SN-981 (which has a sense strand and an antisense strand as shown below) is a double-stranded nucleic acid without a conjugated lipid compound. The use of SN-981 corresponds to the case where the lipid compound of the present invention is not used to deliver the nucleic acid.

[0579] Table 12

[0580]

[0581] The experimental results show that: compared with the case where the lipid compound of the present invention is not used to deliver the nucleic acid, the use of the lipid compound of the present invention to deliver the nucleic acid can significantly improve the intracellular delivery of the nucleic acid and the level of inhibition of mRNA. 1 and Q 4 is an amide group (-NHCO- or -CONH-) and R' 1 When it is an alkane chain, within the range of C13 to C16 alkane chains, R' 1 The conjugate with C15 alkane chain achieved the best intracellular delivery and the best inhibition level on mRNA.

[0582] (3) Residual SOD1 mRNA levels in SD rat brain

[0583] siRNA (SN-981), different siRNA conjugates mentioned in Example 7 or vehicle (PBS) were used to test the residual SOD1 mRNA level in the brain of SD rats.

[0584] On day 0, SD rats were intracranial injected with vehicle (without siRNA and siRNA conjugates), PBS solution containing 0.9 mg siRNA or siRNA conjugates, and on day 7, the above-mentioned Methods Brain tissue RNA was extracted and the expression of SOD1 gene in rats was detected by RT-PCR and qPCR methods. There were 3 rats in each group. The results are shown in the attached Figure 3 .

[0585] The experimental results show that when the lipid compound has the structure of formula (I), Q 1 and Q 4 is an amide group (-NHCO- or -CONH-) and R' 1 When it is an alkane chain, within the range of C2 to C5 alkane chains, the C3 alkane chain has the best effect, which means that the conjugate in which the two amide groups in the left structure of the lipid compound are separated by 3 C atoms achieves the best intracellular delivery and the best inhibition level of mRNA.

[0586] (4) Remaining ATXN3 mRNA levels in mouse brain

[0587] The siRNA conjugates or solvent (PBS) involved in the above Example 7 were respectively used to test the residual ATXN3 mRNA level in the mouse brain. The specific siRNA conjugate structures are shown in Table 13 below.

[0588] Table 13 siRNA conjugate structure

[0589]

[0590] On day 0, mice were intracranially injected with vehicle (without SN-17011) or PBS solution containing 0.5 mg SN-17011. On day 30, the mice were intracranially injected with the same Methods Brain mRNA was extracted and the expression level of mouse ATXN3 gene was detected by RT-PCR and qPCR methods. The mouse ATXN3 probe was Mm00804702_m1 and the mouse HPRT probe was Mm03024075_m1. There were 2-3 mice in each group. The results are shown in the attached Figure 4 It can be seen that the conjugates formed by L3' achieved significant intracellular delivery at different target sites and enhanced the level of mRNA inhibition.

[0591] (5) Residual SOD1 mRNA levels in SD rat brain

[0592] The solvent (PBS) and the siRNA conjugates mentioned in Example 7 were respectively used to measure the residual SOD1 mRNA level in the brain of SD rats.

[0593] On day 0, SD rats were intracranial injected with vehicle (without SN-16983) or PBS solution containing 0.1, 0.3, or 0.9 mg SN-16983. Methods Brain tissue RNA was extracted and the expression of SOD1 gene in rats was detected by RT-PCR and qPCR methods. There were 3 rats in each group. The results are shown in the attached Figure 5 It can be seen that the conjugates formed by L3' at different concentrations achieved significant intracellular delivery and enhanced the inhibition level of mRNA.

[0594] (6) Residual SOD1 mRNA levels in rat brain

[0595] The remaining SOD1 mRNA level in the rat brain was tested by taking known drugs, the siRNA conjugates mentioned in Example 7 or the solvent (PBS) respectively. The specific structures of known drugs and siRNA conjugates are shown in Table 14 below.

[0596] Table 14 Known drug or conjugate structures

[0597]

[0598] On day 0, SD rats were intracranial injected with vehicle (without SN-16983 and AD-68981), PBS solution containing 0.9 mg SN-16983 or AD-68981, and on day 7, the same solution was used as above. Methods Brain tissue RNA was extracted and the expression of SOD1 gene in rats was detected by RT-PCR and qPCR methods. There were 3 rats in each group. The results are shown in the attached Figure 6It can be seen that the conjugate formed by L3' of the present invention has better effect than the known drug (AD-68981 disclosed in US20220125823A1).

[0599] (7) Residual SOD1 mRNA levels in rat brain

[0600] The different siRNA conjugates or solvent (PBS) mentioned in Example 7 were used to measure the residual SOD1 mRNA level in rat brain.

[0601] On day 0, SD rats were injected with vehicle (without SN-16983 or SN-17002) or PBS solution containing 0.6 mg SN-16983 or SN-17002 at the foramen magnum. On day 7, Methods Brain tissue RNA was extracted and the expression of SOD1 gene in rats was detected by RT-PCR and qPCR methods. There were 3 rats in each group. The results are shown in the attached Figure 7 It can be seen that when the lipid compound has the structure of formula (I), Q 1 and Q 4 is an amide group (-NHCO- or -CONH-) and R' 1 When it is an alkane chain or an alkane chain substituted with a carboxyl group, the conjugate formed by the lipid compound after further modifying the alkane chain with COOH achieves better intracellular delivery and mRNA inhibition level.

[0602] (8) Remaining human MAPT mRNA levels in mouse brain

[0603] The siRNA conjugates or solvent (PBS) involved in the above Example 7 were respectively used to test the level of residual human MAPT mRNA in the mouse brain. The specific siRNA conjugate structures are shown in Table 15 below.

[0604] Table 15 siRNA conjugate structure

[0605]

[0606] Human MAPT transgenic mice were intracranially injected with vehicle (without SN-68081) or PBS solution containing 500 mg SN-68081 on day 0, and with the same solution as above on day 30. Methods Brain tissue mRNA was extracted and the expression level of human MAPT gene was detected by RT-PCR and qPCR methods. The human MAPT probe was Hs00902194_m1 and the internal reference was the mouse HPRT. There were 2-3 mice in each group. The results are shown in the attached Figure 8 It can be seen that the conjugate formed by L16' of the present invention achieves significantly improved intracellular delivery and mRNA inhibition levels for different nucleic acids at different targets.

[0607] (9) Residual SOD1 mRNA levels in rat brain

[0608] The different siRNA conjugates or solvent (PBS) mentioned in Example 7 were respectively used to test the residual SOD1 mRNA level in rat brain.

[0609] SD rats were intracranial injected with vehicle (without SN-16995 and SN-16996) or PBS solution containing 0.6 mg SN-16995 or SN-16996 on day 0, and then injected with the above-mentioned Methods Brain tissue RNA was extracted and the expression of SOD1 gene in rats was detected by RT-PCR and qPCR methods. There were 3 rats in each group. The results are shown in the attached Fig. 9 . It can be seen that in the conjugate of the present application, the conjugation mode of the conjugate with the double-stranded nucleic acid, especially the siRNA double-stranded ribonucleic acid and the single-stranded phosphosulfate oligonucleotide will affect the effect. When one side of the conjugate is conjugated with the sense strand of the double-stranded nucleic acid and the other side is conjugated with the single-stranded nucleic acid to form the sense strand of the nucleic acid conjugate, compared with the conjugate formed by the single-stranded nucleic acid being located at the 5' end of the sense strand of the nucleic acid conjugate, the conjugate formed by the single-stranded nucleic acid being located at the 3' end of the sense strand of the nucleic acid conjugate achieves better intracellular delivery and mRNA inhibition level.

[0610] (10) Residual SOD1 mRNA levels in rat brain

[0611] The different siRNA conjugates or solvent (PBS) mentioned in Example 7 were respectively used to test the residual SOD1 mRNA level in rat brain.

[0612] SD rats were injected with vehicle (without siRNA conjugate) or PBS solution containing 0.6 mg siRNA conjugate at the foramen magnum on day 0, and then with the above-mentioned Methods Brain tissue RNA was extracted and the expression of SOD1 gene in rats was detected by RT-PCR and qPCR methods. There were 5-6 rats in each group. The results are shown in the attached Fig.10 . It can be seen that in the conjugate of the present application, compared with the conjugate containing only double-stranded nucleic acid, such as siRNA double-stranded ribonucleic acid, the conjugate of double-stranded nucleic acid and single-stranded phosphosulfate oligonucleotide simultaneously conjugated by lipid compound achieves better intracellular delivery and mRNA inhibition level. In the conjugate of double-stranded nucleic acid and single-stranded phosphosulfate oligonucleotide simultaneously conjugated by lipid compound, within the range of 14-20 nucleotides, the single-stranded phosphosulfate oligonucleotide with 16 nucleotides achieves the best intracellular delivery and mRNA inhibition level.

[0613] (11) Residual SOD1 mRNA levels in rat brain

[0614] The different siRNA conjugates or solvent (PBS) mentioned in Example 7 were respectively used to test the residual SOD1 mRNA level in rat brain.

[0615] SD rats were intracranially injected with vehicle (without siRNA conjugate), PBS solution containing 0.3, 0.6, or 0.9 mg SN-17004 or SN-17006 on day 0, and then with the above-mentioned Methods Brain tissue RNA was extracted and the expression of SOD1 gene in rats was detected by RT-PCR and qPCR methods. There were 3 rats in each group. The results are shown in the attached Fig.11 It can be seen that for the formation of a conjugate by simultaneously conjugating a double-stranded nucleic acid and a single-stranded phosphosulfate oligonucleotide by a lipid compound, when the length and conjugation position of the single-stranded phosphosulfate oligonucleotide are the same, when the lipid compound has the structure of formula (I), Q 1 and Q 4 is an amide group (-NHCO- or -CONH-) and R' 1 When it is an alkane chain or an alkane chain substituted with a carboxyl group, the conjugate formed by the lipid compound after further modifying the alkane chain with COOH achieves better intracellular delivery and mRNA inhibition level.

[0616] (12) Residual SOD1 mRNA levels in various regions of the rat brain

[0617] The siRNA conjugates involved in the above Example 7 were respectively used to test the residual SOD1 mRNA level in various regions of the rat brain.

[0618] On day 0, SD rats were injected with PBS solution containing 0.9 mg SN-17006 into the foramen magnum. On day 14, Methods RNA was extracted from brain tissues, and the expression of SOD1 gene in rats was detected by RT-PCR and qPCR methods. The vehicle group was taken as 100% for comparison. There were 3 rats in each group. The results are shown in the attached Fig.12 It can be seen that the conjugates of the present invention improve the intracellular delivery and the inhibition level of mRNA in different parts of the brain. Therefore, it is proved that the conjugates of the present invention can improve the intracellular delivery of nucleic acids and the inhibition level of mRNA in different cells.

[0619] (13) Residual SOD1 mRNA levels in rat brain

[0620] The residual SOD1 mRNA level in rat brain was tested by taking siRNA (SN-981), single-stranded oligonucleotide (SN-17035), the siRNA conjugate mentioned in Example 7 or the solvent (PBS).

[0621] On day 0, SD rats were intracranial injected with vehicle (without SN-17006, SN-17035, and SN-981), PBS solution containing 0.6 mg SN-17006, 0.6 mg SN-17035, or 0.6 mg SN-981, and on day 7, the above Methods RNA was extracted from brain tissues, and the expression of SOD1 gene in rats was detected by RT-PCR and qPCR methods as mentioned above, with 3 rats in each group.

[0622] SN-17035 is a single-stranded oligonucleotide with the following sequence:

[0623] Table 16

[0624] SN-17035 5'-GsTsCsgsCsCsCststsCsasgsCsAsCsG-3'

[0625] See attached for the results Fig.13 . Intracellular delivery of a double-stranded nucleic acid is usually difficult to achieve, let alone the simultaneous delivery of double-stranded and single-stranded nucleic acids. However, this example demonstrates that a conjugate conjugated with double-stranded and single-stranded nucleic acids can be formed by a lipid compound of a specific structure of the present invention, and the conjugate achieves significant improvement in intracellular delivery and significantly improves the inhibition level of mRNA. With the mRNA level corresponding to PBS (100.0±5.2) as a reference, SN-17006 (mRNA level 33.9±8.6) reduces the mRNA level by about 66.1%, while SN-17035 (mRNA level 95.5±5.3) and SN-981 (mRNA level 89.7±2.0) only reduce the mRNA level by about 4.5% and about 10.3%, respectively. Therefore, this example also demonstrates that the conjugate of the present invention achieves a synergistic effect, that is, it achieves an effect that is superior to the use of double-stranded nucleic acids or single-stranded nucleic acids alone, and achieves a synergistic effect of 1+1 greater than 2.

[0626] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A lipid compound, characterized in that Having a structure shown in the following formula (I), (II) or (V): Wherein, W1 is selected from a direct bond or Said X'1 is selected from O or S atoms, or does not exist; When X'1 is selected from O or S atoms, the X2 is selected from -O-, -S-, -SH, -OH (hydroxyl), -NH2 (amino), C1-C6 alkyl, C1-C6 alkoxy, or -O-(CH2) n， -OR'5, R'5 is selected from H, a direct bond or R'6 is H or a direct bond, X1 is selected from O or S atoms, X4 is -OH or -SH, n' is an integer of 1-10; when X'1 does not exist, X2 is a direct bond; The T1 is selected from -(CH2) m CH3, m is an integer from 10 to 30; or, wherein Q1 and Q4 are each independently selected from a direct bond, -NH2 (amino), -COOH (carboxyl), amide (-NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, or thiophosphate; The Q2 is selected from -SH, -OH (hydroxyl), -NH2 (amino), -H, C1-C6 alkyl, preferably -CH3 (methyl), -COOH (carboxyl), amide (-NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, thiophosphate, or R'7 is H or a direct bond, X1 and X4 are as defined above; Said Q3 is selected from -H or C1-C10 alkyl; The L1 is -(CH2)1-(NR'4) t -(CH2)q-, 1 and q are integers from 0 to 10 and 1+q=1 to 10, t is 0 or 1, and R'4 is -CO(CH2) r COOH, r is an integer from 10 to 30; The L2 and L3 are each independently selected from a C1-C10 saturated alkane chain or a direct bond; The R'1 is selected from a C10-C30 saturated fatty acid chain, a C10-C30 saturated alkane chain, a C10-C30 unsaturated hydrocarbon group or -(CH2) m -X3-R'3, m is an integer of 10-30, X3 is selected from a direct bond, an oxygen atom or a sulfur atom, and R'3 is selected from a saturated six-membered heterocyclic group containing nitrogen and oxygen, H, a direct bond, or R'6, X1 and X4 are as defined above; when X3 is a direct bond, R'3 is not H, a direct bond; When W1 is a direct bond, T1 is not -(CH2) m CH3; In formula (II) and (V), the five-membered ring is a five-membered ring sugar structure in ribose or deoxyribose, wherein X5 is selected from -CH2-, -CH(CH3)-, -C(CH3)2-, -O-, -NH-, -N(CH3)- or -S-; The M' is selected from H, -O-, -C- or a modified or unmodified nucleotide base; The N1 is selected from a direct bond, H, a C1-C3 alkyl or R'8 is H or a direct bond, and X1 and X4 are as defined above; N2 is selected from a direct bond, H or a C1-C3 alkyl group; The Y is selected from H, NH2, OH, halogen, C1-C6 alkyl, C1-C6 haloalkyl, -O-R'9 or -O-(CH2) n -O-R' 10 , R'9 is a C1-C6 alkyl group, preferably -O-CH3, n is an integer from 1 to 6, R' 10 is a C1-C6 alkyl group, preferably n is 2, R' 10 is C1 alkyl, i.e. 2'-methoxyethoxy; Said V is selected from a C1-C4 saturated alkane chain or does not exist; The U' is selected from -NH2 (amino), -COOH (carboxyl), amide (-NHCO- or -CONH-) or does not exist; Said Z1 is selected from O or S atoms; The Z2 is selected from a C10-C30 alkoxy group, a fatty acid chain, preferably a terminal carboxyl fatty acid, an amide lipid chain, an olefin chain, or an alkane chain; The R'2 is selected from C10-C30 alkoxy, fatty acid chain, preferably terminal carboxyl fatty acid, amide lipid chain, olefin chain, alkane chain or absent.

2. The lipid compound according to claim 1, characterized in that Having the structure shown in formula (I): When W1 is When X'1 is selected from O or S atoms; T1 is selected from in, The Q1 and Q4 are selected from a direct bond, -NH2 (amino), -COOH (carboxyl), amide (-NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, or thiophosphate; The Q2 is selected from -SH, -OH (hydroxyl), -NH2 (amino), -H, C1-C6 alkyl, preferably -CH3 (methyl), -COOH (carboxyl), amide (-NHCO- or -CONH-), -O-, -S-, -SS-, phosphate, thiophosphate or Said Q3 is selected from -H or C1-C10 alkyl; The L2 and L3 are selected from C1-C10 saturated alkane chains or direct bonds; Said X1 is selected from O or S atoms; The X2 is selected from -O-, -S-, -SH, -OH (hydroxyl), -NH2 (amino), C1-6 alkyl, preferably -CH3 (methyl), -CH2CH3 (ethyl), C1-6 alkoxy, preferably -OCH3 (methoxy), -OCH2CH3 (ethoxy) or -O-(CH2) n -OR'5, R'5 is selected from H, a direct bond or The R'1 is selected from a C10-C30 saturated fatty acid chain, a C10-C30 saturated alkane chain, a C10-C30 unsaturated hydrocarbon group or -(CH2) m -X3-R'3, m is an integer of 10-30, X3 is selected from a direct bond, an oxygen atom or a sulfur atom, and R'3 is a saturated six-membered heterocyclic group containing nitrogen and oxygen, H, a direct bond or 3. The lipid compound according to claim 2, characterized in that Q1 and Q4 are both amide groups (-NHCO- or -CONH-); Q2 is selected from -SH, -OH (hydroxyl), -S-, -O- or R'1 is selected from a C10-C30 saturated fatty acid chain, a C10-C30 saturated alkane chain, preferably a C13-16 saturated alkane chain, more preferably a C15 saturated alkane chain, a C10-C30 unsaturated hydrocarbon group or -(CH2) m -X3-R'3, m is an integer of 10-30, preferably an integer of 2-5, more preferably 3, X3 is selected from a direct bond, an oxygen atom or a sulfur atom, R'3 is a saturated six-membered heterocyclic group containing nitrogen and oxygen, H, a direct bond or 4. The lipid compound according to claim 3, characterized in that L1 is -(CH2) l -(NR'4) t -(CH2)q-, t is 0.

5. The lipid compound according to claim 3, characterized in that L1 is -(CH2) l -(NR'4) t -(CH2)q-, l+q=1-10, t is 1; L2 is selected from a C1-C10 saturated alkane chain or a direct bond; L3 is a direct connection key; Q2 is H; Q3 is selected from -H or C1-C10 alkyl; R'1 is -(CH2) m -X3-R'3, m is an integer of 10-30, X3 is selected from oxygen atom or sulfur atom, R'3 is H, direct bond or 6. The lipid compound according to claim 2, characterized in that The Q1 is a direct bond, and Q4 is an amide group (-NHCO- or -CONH-); L1 is -(CH2) l -(NR'4) t -(CH2)q-, l+q=1-10, t is 0; L2 is a C1-C10 saturated alkane chain; L3 is a direct connection key; Q2 is selected from -SH, -OH (hydroxy), -S-, -O- or R'7 and X4 are as defined above.

7. The lipid compound according to any one of claims 1 to 6, characterized in that W1 is a direct bond, Q2 is selected from -SH, -OH (hydroxyl) or R'7 is H, and R'6 in R'1 is not a direct bond; or, W1 is a direct bond, Q2 is selected from -S-, -O- or and R'7 is a direct bond, and R'6 in R'1 is not a direct bond; or, W1 is a direct bond, Q2 is not -S-, -O-, or -SS-. When Q2 is When R'7 is H, and R'1 is -(CH2) m -X3-R'3, R3 is a direct key or R'6 is a direct bond; or, W1 is X2 is selected from -OH or -SH, Q2 is selected from -SH or -OH (hydroxyl), and R'3 and R'6 in R'1 are not directly connected; or, W1 is X2 is selected from -OH or -SH, Q2 is selected from -S-, -O- or R'7 is a direct bond, and R'3 and R'6 in R'1 are not direct bonds; or, W1 is X2 is selected from -OH or -SH, Q2 is not -S-, -O- and -SS-, when Q2 is When R'7 is H; R'3 in R'1 is a direct bond, or when R'3 is When , R'6 is a direct bond; Preferably, W1 is a direct bond, and the wavy line of formula (I) is connected to X6, and X6 has the following structure: R' 11 and R' 12 Each is independently selected from C1-C6 alkyl; Q1 is a direct bond or an amide group (-NHCO- or -CONH-), Q4 is an amide group (-NHCO- or -CONH-); Q2 is selected from -S-, -O- or H; L1 is -(CH2) l -(NR'4) t -(CH2)q-, l and q are integers of 0-10 and l+q=1-10, t is 0 or 1; when Q2 is H, L3 is a direct bond and t is 1; when Q2 is -S- or -O-, Q2 is connected to X7, and X7 is selected from (B'1) or (B'2), Among them, R' 13 and R' 14 Each is independently selected from C1-C6 alkyl, preferably C3 alkyl, more preferably isopropyl, and n is an integer of 1-6; Among them, R' 15 is a C1-C6 alkyl group, n is an integer of 1-6; R'1 is selected from a C10-C30 saturated alkane chain, a C10-C30 unsaturated hydrocarbon group or -(CH2) m -X3-R'3, m is an integer of 10-30, X3 is selected from a direct bond, an oxygen atom or a sulfur atom, and R'3 is selected from a saturated six-membered heterocyclic group containing nitrogen and oxygen or a direct bond; when Q2 is H, R'3 is a direct bond, and R'3 is connected R' 18 and R' 19 Each is independently selected from C1-C6 alkyl, n is an integer of 1-6, or, Preferably, W1 is X'1 does not exist, and the X2 is a direct bond; the wavy line of formula (I) is connected to -(CH2) n -O-X6, n is an integer of 1-6, X6 is as defined above; T1 is -(CH2) m CH3; X2 connection -N(R' 20 )2, R' 20 It is a C1-C6 alkyl group, preferably a C3 alkyl group, and more preferably an isopropyl group.

8. The lipid compound according to any one of claims 1 to 7, characterized in that In formula (I), R'1 is a C10-C30 saturated fatty acid chain, wherein the C10-C30 saturated fatty acid chain is -(CH2) m -COOH or -(CH2) m -COOR' 16 , m is an integer of 10-30, R' 16 An alkyl group selected from C1-C6 or Best The C1-C6 alkyl group is preferably methyl, ethyl, isopropyl or tert-butyl. 17 is halogen, preferably Cl; or R'1 is a C10-C30 unsaturated hydrocarbon group, wherein the C10-C30 unsaturated hydrocarbon group is -(CH2) m -R'4, m is an integer of 10-30, R'4 is an unsaturated bond, preferably a triple bond; or, R'1 is -(CH2) n -X3-R'3, -(CH2) n -X3-R'3, R'3 is a saturated six-membered heterocyclic group containing nitrogen and oxygen, X3 forms a bond with the nitrogen atom of R'3, preferably, in R'3, the six-membered heterocyclic ring contains one nitrogen atom and one oxygen atom and the nitrogen atom and the oxygen atom are located in the para position of the six-membered heterocyclic ring; and / or, X2 is selected from -OH, -SH, -CH3 (methyl), -CH2CH3 (ethyl), -OCH3 (methoxy) or -OCH2CH3 (ethoxy), preferably -OH or -SH.

9. The lipid compound according to claim 1, characterized in that W1 is X'1 is O or S; X2 is -(CH2) n’ -OR'5, R'5 is selected from H, a direct bond or X1, R'6 and X4 are as defined above, n' is an integer from 1 to 10; T1 is -(CH2) m CH3, m is an integer of 10-30.

10. The lipid compound according to claim 9, characterized in that R'5 is selected from a direct bond or R'6 is a direct bond.

11. The lipid compound according to any one of claims 1 to 10, characterized in that The wavy line in formula (I) is connected to H or X6.

12. The lipid compound according to claim 1, characterized in that Having the structure shown in formula (II) or (V), N1 is a direct bond, H, or N2 is selected from a direct bond or H; Y is a C1-C6 alkoxy group; M' is selected from -O-, -C-, or a modified or unmodified nucleotide base; When M' is a modified or unmodified nucleotide base, U', V and R'2 are absent; preferably, M' is independently selected from adenine, uracil, thymine, guanine or cytosine; more preferably, M' is selected from or, When M' is -O- or -C-, V is a C1-C4 saturated alkane chain, U' is an amide group (-NHCO- or -CONH-), and R'2 is a C10-C30 alkane chain.

13. The lipid compound according to claim 12, characterized in that It has a structure represented by formula (II) or (V), wherein X5 is O or S.

14. The lipid compound according to any one of claims 12 to 13, characterized in that N1 is not a direct bond, and R'8 is not a direct bond, and N2 is a direct bond; preferably, N2 is connected to X7 or, N1 is a direct key, or and R'8 is a direct bond, and N2 is not a direct bond; preferably, N1 is connected to X6; or, N1 is a direct key, or And R'8 is a direct bond, and N2 is a direct bond; preferably, N1 is connected to X6, and N2 is connected to X7.

15. The lipid compound according to any one of claims 12 to 14, characterized in that When N1, N2 and R'8 are directly connected, H is connected.

16. The lipid compound according to claim 1, characterized in that The lipid compound is selected from at least one of the following structures (L1)-(L36) and (L'10): Among them, U is 17. The lipid compound according to claim 1, characterized in that The lipid compound is selected from at least one of the following structures (L1')-(L36') and (L'10'): Wherein, E is selected from O and S, and U is 18. A nucleic acid conjugate, characterized in that comprising a nucleic acid and a conjugate conjugated to the nucleic acid; The conjugate is selected from the lipid compound according to any one of claims 1 to 17; Preferably, the conjugate is conjugated to a phosphate group or a hydroxyl group of a ribose of a nucleic acid; More preferably, the nucleic acid conjugate has the following structure: Nu——O——W1——T1, Formula (III) or, Wherein, Nu is a nucleic acid or a nucleic acid fragment, and other variables are defined as defined in any one of claims 1-17.

19. The nucleic acid conjugate according to claim 18, characterized in that It has the structure of formula (III), wherein X2 is -O-(CH2) n’ -OR'5, R'5 is selected from a direct bond or R'6 is a direct bond, n' is an integer from 1 to 10; or, Q2 is selected from -O-, -S- or R'7 is selected from a direct bond; or, R'1 is selected from -(CH2) m -X3-R'3, m is an integer from 10 to 30, X3 is selected from oxygen atoms or sulfur atoms, direct bonds or R'6 is selected from a direct bond; or, Having the structure of formula (IV) or formula (VI), wherein N1 is a direct bond or R'8 is selected from a direct bond.

20. The nucleic acid conjugate according to claim 18, characterized in that Nu is a nucleic acid or a nucleic acid fragment, and the other variables are defined as in any one of claims 7-10, 12-14 and 16-17.

21. The nucleic acid conjugate according to any one of claims 18 to 20, characterized in that: The direct linkage is conjugated to the nucleic acid or nucleic acid fragment.

22. The nucleic acid conjugate according to any one of claims 18 to 21, characterized in that The nucleic acid is selected from single-stranded nucleic acid and fragments thereof or double-stranded nucleic acid and fragments thereof, the double-stranded nucleic acid and fragments thereof preferably have a length of 12-30mer, and the double-stranded nucleic acid and fragments thereof are preferably siRNA and fragments thereof; preferably, the molecular weight range of the double-stranded nucleic acid and fragments thereof is: 6000-20000 Daltons; the single-stranded nucleic acid and fragments thereof preferably have a length of 12-30mer, and the single-stranded nucleic acid and fragments thereof are preferably single-stranded phosphosulfate oligonucleotides and fragments thereof; preferably, the molecular weight range of the single-stranded nucleic acid and fragments thereof is: 3000-10000 Daltons.

23. The nucleic acid conjugate according to claim 22, characterized in that Each nucleotide in the nucleic acid is independently a modified or unmodified nucleotide, or two adjacent nucleotides in the nucleic acid are linked by a phosphodiester bond, and one or more of the phosphodiester bonds are thiophosphate diester bonds; Preferably, each nucleotide in the nucleic acid is independently a fluorine-substituted modified nucleotide or a non-fluorine-substituted modified nucleotide; Preferably, the fluorine substitution modification is that the 2'-hydroxyl group of the pentose of the nucleotide is replaced by F; Preferably, the non-fluorine substitution modification is that the 2'-hydroxyl group of the pentose of the nucleotide is replaced by an alkoxy group, and the 2'-hydroxyl group is preferably replaced by a methoxy group or a 2'-methoxyethoxy group.

24. The nucleic acid conjugate according to claim 22 or 23, characterized in that The conjugate is conjugated to the double-stranded nucleic acid; the double-stranded nucleic acid contains a sense strand and an antisense strand, preferably, the conjugate is conjugated to the 3' or 5' end of the sense strand or the antisense strand; preferably, the conjugate is conjugated to the 3' end of the sense strand.

25. The nucleic acid conjugate according to any one of claims 22 to 25, characterized in that One side of the conjugate is conjugated to the double-stranded nucleic acid, and the other side is conjugated to the single-stranded nucleic acid; preferably, one side of the conjugate is conjugated to the sense strand of the double-stranded nucleic acid, and the other side is conjugated to the single-stranded nucleic acid to form the sense strand of the nucleic acid conjugate; preferably, the single-stranded nucleic acid is located at the 3' or 5' end of the sense strand of the nucleic acid conjugate; preferably, the single-stranded nucleic acid is located at the 3' end of the sense strand of the nucleic acid conjugate.

26. The nucleic acid conjugate according to any one of claims 24 to 25, characterized in that The sequence of the sense strand is selected from the following sequences: 1)CAUUUUAAUCCUCACUCUAAA, 2) GCUCAGCAUUGCCUGAAUAAA, or, 3)UGCAAAUAGUCUACAAACCAA, The sequence of the antisense strand is selected from the following sequences: 4)UUUAGAGUGAGGAUUAAAAUGAG, 5) UUUAUUCAGGCAAUGCUGAGCUU, or 6)UUGGUUUGUAGACUAUUUGCACA.

27. The nucleic acid conjugate according to any one of claims 22 to 25, characterized in that The single-stranded nucleic acid comprises 14-20 nucleotides, preferably 16 nucleotides, and preferably comprises a sequence selected from the following: CCGTCGCCCTTCAGCACGCA, CGTCGCCCTTCAGCACGC, GTCGCCCTTCAGCACG, or, TCGCCCTTCAGCAC; Preferably, the single-stranded nucleic acid comprises TCGCCCTTCAGCAC.

28. The conjugate according to claim 18, characterized in that The conjugate is selected from at least one of the following structures (L1")-(L36") and (L'10"): In the above table, Nu, Nu1, and Nu2 independently represent nucleic acids or nucleic acid fragments; Nu, Nu1, and Nu2 may be the same or different; Wherein, E is selected from O or S.

29. The nucleic acid conjugate according to claim 18, characterized in that The nucleic acid conjugate has the following structure: Preferably, E is O.

30. Use of the lipid compound according to any one of claims 1 to 17 for preparing the nucleic acid conjugate according to any one of claims 18 to 29.

31. Use of the nucleic acid conjugate according to any one of claims 18 to 29 for preparing a drug for treating gene-related diseases; Preferably, the gene is selected from APP, SOD1, HTT, MeCP2, DUX4, HDAC2, GPR75, Ataxin 1, Ataxin 2, Ataxin 3, Ataxin 6, Ataxin 7, C9ORF72, UBE3A, Prion, PMP22, Tau, LRRK2, LINGO2, GYS / , KCNT1, IRF5, Progranulin, GFAP, TARDBP, SNCA, FUS, SCA1, SCA7, SCA8, MeCP2, PRNP, SOD1, DMPK, MAPT or TTR; Preferably, the disease is a central nervous system disease; preferably, the central nervous system disease is selected from Alzheimer's disease, preferably Alzheimer's disease, ALS, Huntington's disease, Parkinson's disease, Dravet syndrome, Charcot triad, Alexander disease, spinocerebellar ataxia or Angelman syndrome; preferably, the disease is selected from Alzheimer's disease, ALS or spinocerebellar ataxia; Preferably, the drug is an injection or an oral preparation; preferably, it is an injection administered intracranially, intrathecally, subcutaneously, intravenously, or intramuscularly.

Images