Recombinant pearl protein hydrolyzed polypeptide as well as preparation method and application thereof

Abstract

The invention relates to the technical field of bioengineering, and discloses a recombinant pearl protein hydrolyzed polypeptide as well as a preparation method and application thereof. The invention provides a pearl protein hydrolyzed polypeptide capable of promoting melanogenesis through design, the hydrolyzed polypeptide is obtained by hydrolyzing protein coded by a nucleotide sequence as shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 through pepsin, and the hydrolyzed polypeptide can promote proliferation of B16F10 mouse melanoma cells and promote melanin synthesis of the B16F10 mouse melanoma cells. Experiments show that the relative activity of tyrosinase of an experimental group reaches 358% of that of a control group when the addition amount of the pearl protein hydrolyzed polypeptide provided by the invention is 20mg / mL, which shows that the pearl protein hydrolyzed polypeptide has a prospect in preparing products for treating vitiligo, albinism or leukoplakia.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to a recombinant pearl protein hydrolyzed polypeptide and a preparation method and application thereof. Background Art

[0002] Pearl is a famous Chinese herbal medicine included in the Pharmacopoeia of the People's Republic of China. It has the effects of calming the nerves, improving eyesight, removing cataracts, detoxifying and promoting tissue regeneration. Modern research shows that the inorganic content of pearls is as high as more than 90%, mainly calcium carbonate. The organic content is relatively low, mainly some matrix proteins, which have multiple biological activities such as promoting fibroblast proliferation and migration, accelerating wound healing, and anti-oxidation. In addition, there are taurine, porphyrin, vitamins, etc.

[0003] The matrix protein of pearls is the main component that exerts biological activity, but the proportion of matrix protein in pearls is relatively low. The traditional method of extracting pearl matrix protein is to use chelating agent ethylenediaminetetraacetic acid (EDTA), acid and salt ion buffer such as hydrochloric acid, deionized water and other substances to dissolve calcium carbonate in shells to obtain organic matrix in shells. However, the traditional method of extracting pearl matrix protein is direct separation and extraction. The crude extract obtained by EDTA demineralization is a mixture of matrix proteins. If further separation and purification is performed to obtain a single component with relatively high purity, it is necessary to use high performance liquid chromatography and other technologies. The separation steps are cumbersome and the protein loss is large. In addition, the direct separation and extraction method can only obtain some matrix proteins with relatively high content and easy to dissolve in pearl organic matter, while those matrix proteins with low expression abundance but potential high biological activity are often ignored.

[0004] At present, many studies have shown that pearl protein has multiple biological activities and has broad application prospects in the fields of food, health products, medicine and beauty. However, most of the research on the biological activity of pearl protein focuses on the protein mixture obtained by extraction, and there are few studies on the biological activity and mechanism of action of single protein or its hydrolyzed peptides.

[0005] Vitiligo is a common acquired depigmentation skin disease, which is related to melanocyte dysfunction; the melanocyte function in patients with vitiligo may be abnormal, resulting in changes in the color of the skin and mucous membranes and whitening of the skin. Albinism is a hereditary disease, a congenital skin disease characterized by partial or complete depigmentation of the skin, hair and eyes. Albinism is related to melanin synthesis; the tyrosinase of patients with albinism cannot work properly and cannot convert tyrosine into melanin, resulting in abnormal skin, hair and eye color. White spots are white patches caused by the lack of melanin in local areas due to damage or loss of function of melanocytes in the skin. Vitiligo patients, albinos and white spots are treated with products to increase pigmentation and promote melanin synthesis. At present, more products or drugs that promote melanin production are needed to be applied to the clinical treatment of vitiligo patients, albinos and white spots. Summary of the invention

[0006] In order to solve the problem of obtaining the above-mentioned single pearl matrix protein, as well as the problem of preparing products or drugs that promote melanin production, the present invention provides a recombinant pearl protein hydrolyzed polypeptide and a preparation method and application thereof.

[0007] The specific technical scheme of the present invention is: In a first aspect, the present invention provides a method for preparing a recombinant pearl protein hydrolyzed polypeptide, comprising the following steps: Step S1: obtaining pearl protein encoded by the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3; Step S2: The pearl protein provided in step S1 is hydrolyzed by pepsin to obtain a recombinant pearl protein hydrolyzed polypeptide.

[0008] The inventors found in the study of pearl protein that the pearl protein encoded by the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 has the activity of promoting melanin production. Furthermore, the present invention uses the pearl protein encoded by the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 as a substrate and hydrolyzes it with pepsin to obtain a recombinant pearl protein hydrolyzed polypeptide, providing a product with higher activity of promoting melanin production. Compared with the blank control group, the recombinant pearl protein hydrolyzed polypeptide can significantly promote the proliferation of B16F10 cells and exhibits higher biological activity. The relative activity of tyrosinase in the experimental group with an addition amount of 20 mg / mL reaches 358% of that in the control group.

[0009] As a preferred preparation method, the pepsin hydrolysis method comprises the following steps: adding (8×10 3 )U~(1.2×10 4 ) U of pepsin, adjusting the pH of the hydrolysis treatment system to 1.0-4.0 and the temperature to 20-45°C to carry out the hydrolysis treatment.

[0010] More preferably, the hydrolysis treatment time is 5 to 10 hours.

[0011] As a preferred embodiment of the above preparation method, the method of obtaining the pearl protein encoded by the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 is: cloning the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQID NO.3 into Escherichia coli, Bacillus subtilis or Pichia pastoris for expression to obtain the recombinant pearl protein.

[0012] The use of DNA recombinant technology and pearl protein heterologous expression technology to prepare heterologous expression of specific pearl proteins can effectively avoid many difficulties of direct extraction methods, such as the difficulty of removing impurity proteins. At the same time, it reduces the cost of pearl farming and avoids problems such as chemical reagent residues during the extraction process. It is a green and sustainable recombinant pearl protein production method.

[0013] Further preferably, the recombinant pearl protein is purified, and the purification process comprises the following steps: Dissolving the recombinant pearl protein using 4.0-8.0 mol / L guanidine hydrochloride; The recombinant pearl protein is purified by column chromatography.

[0014] The inventors further discovered that the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 will form inclusion bodies when expressed in Escherichia coli, Bacillus subtilis or Pichia pastoris. Therefore, for the purification of the recombinant pearl protein, the present invention needs to use 4.0-8.0 mol / L guanidine hydrochloride to dissolve the recombinant pearl protein for renaturation, and then obtain the target protein through column chromatography, i.e., the pearl protein encoded by the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, i.e., the recombinant pearl protein, whose amino acid sequence is shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6.

[0015] In a second aspect, the present invention provides a recombinant pearl protein hydrolyzed polypeptide, which has an excellent effect of promoting melanin production.

[0016] In a third aspect, the present invention provides an application of a recombinant pearl protein hydrolyzed polypeptide in the preparation of a product for treating vitiligo, albinism or leukoplakia.

[0017] Preferably, the product is a medicine. For example, the above-mentioned recombinant pearl protein hydrolyzed polypeptide is prepared into a lyophilized powder, and the lyophilized powder is used as a medicine for patients with vitiligo, albinism or leukoplakia to promote the production of melanin in the patient's body and facilitate the recovery of the patient.

[0018] Compared with the prior art, the present invention has the following technical effects: (1) In order to improve the effect of promoting melanin production of the pearl protein encoded by the nucleotide sequence shown in SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3, the present invention hydrolyzes the pearl protein after recombinant expression to obtain a recombinant pearl protein hydrolyzed polypeptide with excellent melanin production promoting effect. The hydrolyzed polypeptide has great prospects for application in the preparation of products for treating vitiligo, albinism or leukoplakia.

[0019] (2) The present invention adopts DNA recombination technology and pearl protein heterologous expression technology to prepare heterologous expression of specific pearl proteins, which can effectively avoid many difficulties of direct extraction methods, such as the difficulty of removing impurity proteins. The pearl protein provided by the present invention can reduce the cost of pearl breeding and avoid problems such as chemical reagent residues during the extraction process. It is a green and sustainable recombinant pearl protein production method. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the SDS-PAGE image of the induced expression of recombinant Upsalin protein; Figure 2 is the SDS-PAGE image of the purified recombinant Upsalin protein; Figure 3 is the SDS-PAGE image of the pepsin hydrolyzed peptide of recombinant Upsalin; Figure 4 To investigate the effect of adding Upsalin-pepsin hydrolyzed peptide on the proliferation of B16F10 mouse melanoma cells; Figure 5 To investigate the effect of adding Upsalin-pepsin hydrolyzed peptide on melanin synthesis in B16F10 mouse melanoma cells; Figure 6 Effect of adding Upsalin-pepsin hydrolyzed peptide on tyrosinase activity expressed in B16F10 mouse melanoma cells. DETAILED DESCRIPTION

[0021] The present invention will be further described below in conjunction with embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are generally only embodiments of a part of the present invention, rather than all embodiments. Therefore, based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work should belong to the scope of protection of the present invention.

[0022] In the following examples, the LB liquid culture medium used was composed of: NaCl 10 g / L, peptone 10 g / L, and yeast powder 5 g / L.

[0023] In the following examples, the LB solid culture medium used was composed of: NaCl 10 g / L, peptone 10 g / L, yeast powder 5 g / L, and agar powder 18 g / L.

[0024] In the following examples, the fermentation medium used was composed of: yeast powder 12 g / L, peptone 15 g / L, Na 2 HPO 4 12H 2 O 8.9 g / L, KH 2 PO 4 3.4 g / L, NH 4 Cl 2.67g / L, Na 2 SO 4 0.71g / L, MgSO 4 7H 2 O0.49g / L.

[0025] Example 1 Expression of pearl protein Upsalin (1) The amino acid sequences SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 were designed. Based on these amino acid sequences, upsalin Gene sequence, upsalin The nucleotide sequences of the genes are shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3 respectively.

[0026] (2) Construction of a recombinant expression strain of nucleotide sequence SEQ ID NO.1 The nucleotide sequence SEQ ID NO.1 was submitted to GENEWISE for gene synthesis, and a 6×His-tag was added to the C-terminus. Upsalin-F and Upsalin-R as shown in Table 1 were used as primers to upsalinThe gene was PCR amplified to obtain an amplified fragment, which was then purified by gel recovery. Plasmid pET28a+ was PCR amplified by primers pET28a-F and pET28a-R as shown in Table 1 to obtain a linear pET28a+ plasmid fragment, which was digested with DpnI enzyme and then purified by gel recovery. The purified upsalin gene fragment was connected to the linear pET28a+ plasmid fragment by one-step cloning, and then transformed into the competent state of Escherichia coli BL21 (DE3). On LB solid medium containing 50 μg / mL kanamycin, positive transformants were screened, and after colony PCR verification and plasmid sequencing verification, a recombinant expression strain E.coli BL21 (DE3) (pET28a-Upsalin) was obtained.

[0027] Table 1 Primer information Primer name Primer sequences Upsalin-F CCGCGCGGCAGCCATATGTTTTGTTTACGGTGGTGGT Upsalin-R GAGCTCGAATTCGGATCCTTAACCAACACGCAATGGAC pET28a-F CATATGGCTGCCGCGCGGCAC pET28a-R GGATCCGAATTCGAGCTCCGT Upsalin2-F ACCACCACCGTAAACAAAGGATCCGAATTCGAGCTC Upsalin2-R GAGCTCGAATTCGGATCCTTTGTTTTACGGTGGTGGT Upsalin3-F CCGCGCGGCAGCCATATGTTTTGTTTACGGTGGTGGT Upsalin3-R GAGCTCGAATTCGGATCCTTCGTGCTGGGTGGTGGTGG (3) Induced expression of recombinant E. coli BL21(DE3)(pET28a-Upsalin) Pick the transformants with the correct sequencing results and streak them on LB solid medium plates, then invert the plates and incubate them at 37℃ for 12-16 hours. The next day, pick a single colony on the plate and inoculate it into sterile liquid LB medium and incubate it in a 37℃ shaker overnight to obtain seed liquid. Inoculate the seed liquid into 50 mL fermentation medium containing 50 µg / mL kanamycin at a volume concentration of 1% and incubate at 37℃ until OD6 00 =0.6~0.8, add IPTG with a final concentration of 1.0 mmol / L, and continue to culture at 24℃ for 10 h to obtain fermentation broth. Centrifuge the fermentation broth and resuspend it with 10 mL of deionized water, and take a sample for SDS-PAGE analysis. Disrupt the resuspended bacteria with an ultrasonic cell disruptor, centrifuge at 5500 rpm for 20 min, and take the supernatant and precipitate for SDS-PAGE analysis.

[0028] The SDS-PAGE results of the recombinant bacteria induced expression are as follows Figure 1 As shown in the figure, lane M is a protein marker, and lanes 1, 2, and 3 are whole cells, supernatant of the broken liquid, and precipitate of the broken liquid of the induced expression of Upsalin recombinant bacteria, respectively. The SDS-PAGE results show that a clear recombinant Upsalin protein band was observed at 14.4-18.4 kDa, which matches the theoretical molecular weight of the target sequence and is presumed to be the target protein. The results also show that the recombinant Upsalin protein band is mainly in the whole cells and the broken liquid precipitate, indicating that the protein is expressed in the form of inclusion bodies.

[0029] (4) Construction of a recombinant expression strain of the nucleotide sequence SEQ ID NO.2 Referring to step (3) and step (4), the Upsalin protein encoded by the nucleotide sequence SEQ ID NO.2 is obtained. upsalin The primers used for PCR amplification of the gene were Upsalin2-F and Upsalin2-R primers as shown in Table 1, and the primers used for PCR amplification of the plasmid pET28a+ were pET28a-F and pET28a-R as shown in Table 1.

[0030] (5) Construction of a recombinant expression strain of nucleotide sequence SEQ ID NO.3 Referring to step (3) and step (4), the Upsalin protein encoded by the nucleotide sequence SEQ ID NO.3 is obtained. upsalin The primers used for gene PCR amplification were Upsalin3-F and Upsalin3-R primers as shown in Table 1, and the primers used for PCR amplification of plasmid pET28a+ were pET28a-F and pET28a-R as shown in Table 1.

[0031] Example 2 Purification of recombinant pearl protein Upsalin The recombinant expression strain for expressing the gene shown in SEQ ID NO.1 constructed in Example 1 was inoculated with 1% inoculum in a fermentation medium with 50 μg / mL kanamycin and cultured at 37°C until OD 600 =0.6~0.8, add IPTG with a final concentration of 1.0 mmol / L, and continue to culture at 24℃ for 10 h to obtain fermentation broth. Centrifuge the fermentation broth, resuspend it in lysis buffer (50mMTris-HCl, 0.1mM EDTA, 0.1mM DTT, 100mM NaCl, 5% glycerol, pH=8.0), use a high-pressure homogenizer to disrupt the cells, and then collect the inclusion bodies by centrifugation. The inclusion bodies were resuspended in a washing buffer (50 mM Tris-HCl, 0.1 mM EDTA, 0.1 mM DTT, 100 mM NaCl, 5% glycerol, 2 M urea, 1% Triton X-100, pH = 8.0) at a dosage of 10% (w / v); ultrasonic treatment was performed for 10 min, and the precipitated inclusion bodies were collected by centrifugation; the precipitate was washed once with 50 mM Tris-HCl buffer (pH = 8.0) at a dosage of 10% (w / v); the precipitated inclusion bodies were resuspended in a dissolution buffer (50 mM Tris-HCl, 6 M guanidine hydrochloride, pH = 8.0) at a dosage of 10% (w / v), and magnetic stirring was performed at 4°C until the precipitate was completely dissolved; centrifugation was performed at 5500 × g for 20 min, and the supernatant was used for the next step of purification.

[0032] The dissolved inclusion bodies were further purified by nickel chelate agarose gel chromatography. The specific purification steps are as follows: (1) Place 2.0 mL of agarose gel filler in a chromatography column, let it stand, and then wash it with 10 column volumes (BV) of ultrapure water; (2) Equilibrate the adsorption column with 10 BV of equilibration buffer (50 mM Tris-HCl, 300 mM NaCl, 20 mM imidazole, 6 M guanidine hydrochloride, pH = 8.0); (3) Take 8.0 mL of the supernatant obtained in the above operation for sample loading and place it on ice for slow shaking and adsorption for 1 h; (4) Wash the non-specifically adsorbed proteins with 10 times BV of washing buffer (50 mM Tris-HCl, 300 mM NaCl, 40 mM imidazole, 6 M guanidine hydrochloride, pH = 8.0); (5) Then, the target protein was eluted with 10 times BV of elution buffer (50 mM Tris-HCl, 300 mM NaCl, 300 mM imidazole, 6 M guanidine hydrochloride, pH = 8.0), and the eluate was collected and stored on ice.

[0033] (6) Regenerate the column using 10 times the BV of regeneration buffer (20 mM MES, 300 mM NaCl, pH adjusted to 5.0 with HCl); (7) Dialysis of the target protein eluate: Add the collected solution into the treated dialysis bag, soak it in deionized water, place it in a 4°C refrigerator and stir it overnight. During this period, change the buffer several times.

[0034] (8) After dialysis, the Upsalin protein was collected, a sample was taken for SDS-PAGE analysis, and the rest was freeze-dried to obtain Upsalin freeze-dried powder, which was then stored frozen.

[0035] Figure 2 Lane 1 in the middle is the SDS-PAGE analysis result of purified Upsalin, with a distinct band at 14.4-18.4 kDa, the size of which is consistent with expectations.

[0036] Example 3 Preparation of recombinant pearl protein Upsalin hydrolyzed peptide Weigh 100 mg of the Upsalin lyophilized powder obtained in Example 2 into a round-bottom flask and add 1×10 4 U / g of pepsin was added, and 10 mL of Britton-Robinson buffer (pH 2.5) was added, and the mixture was hydrolyzed at 37°C for 7 h. After the enzymatic hydrolysis, the enzyme was inactivated by heating in a boiling water bath for 10 min, and the mixture was filtered through a disposable qualitative filter paper. The pH of the filtrate was adjusted to 7.4, and the mixture was freeze-dried to obtain Upsalin protein hydrolyzed peptides.

[0037] Figure 3Lane 1 in the middle is the SDS-PAGE analysis result of Upsalin hydrolyzed peptide, and there is a continuous band at 14.4 kDa, indicating that the protein has been hydrolyzed.

[0038] Example 4 Biological Activity Detection of Recombinant Pearl Protein Upsalin Hydrolyzed Peptide (1) This step is used to study the effect of Upsalin-pepsin hydrolyzed peptide on the proliferation of B16F10 mouse melanoma cells. The specific steps are as follows: When the cell density reached 85%, the cells were collected by digestion with 0.25% trypsin and resuspended in RPMI 1640 medium containing 10% fetal bovine serum. 20,000 cells / well were inoculated in 96-well plates for the control group and the experimental group and incubated at 37°C and 5% CO 2 , and cultured in a CO2 incubator with a relative humidity of 98% for 24 h. The old culture medium was discarded, and 100 µL of basal culture medium was added to each of the control and experimental groups. 100 µL of Upsalin hydrolyzed peptides with gradient concentrations of 0.125, 0.25, 0.5, 1, 2, 4, 10, and 20 mg / mL were added to the experimental group, and an equal volume of culture medium was added to the control group. The control and experimental groups were cultured for 24 h, and then the culture medium was discarded. CCK-8 and serum-free basal culture medium were mixed at a volume ratio of 1:10, and 100 µL was added to each well. The cells were incubated at 37°C and 5% CO 2 Incubate in the incubator for 30 min. Measure the absorbance at 450 nm using an enzyme-labeled instrument to calculate cell viability. Figure 4 shown.

[0039] like Figure 4 The results show that when the concentration of Upsalin hydrolyzed peptide was 0.125-4 mg / mL, the cell viability increased slowly with the increase of concentration, and increased sharply at 10-20 mg / mL, reaching 235%. The results show that Upsalin hydrolyzed peptide can significantly promote the proliferation of B16F10 cells, showing high biological activity, and no cytotoxicity was shown at all added concentrations.

[0040] (2) This step is used to study the effect of Upsalin-pepsin hydrolyzed peptide on melanin synthesis in B16F10 mouse melanoma cells. The specific steps are as follows: Take B16F10 mouse melanoma cells that are in good growth condition, resuspend the cells in DMEM medium containing 10% fetal bovine serum, take 60,000 cells / well and inoculate them in a 12-well plate, and culture them in an incubator for 24 hours. Aspirate and discard the old medium, and use PBS buffer (2.7 mM KCl, 2 mM KH 2 PO 4 , 137 mM NaCl, 10 mM Na 2 HPO4 , pH 7.4), and then 1 mL of gradient concentration (5, 10, 20 mg / mL) of Upsalin hydrolyzed peptide was added and cultured for another 48 h. The cells were collected by trypsin digestion and placed in a 1.5 mL centrifuge tube, washed once with PBS, and 300 µL of 1M NaOH containing 10% DMSO was added. The cells were incubated in a metal bath at 80°C for 1 h. 200 µL was added to an ELISA plate and the absorbance at 405 nm was measured. The protein concentration was determined according to the instructions of the BCA kit. The relative content of melanin was calculated by dividing the total melanin in the cell extract by the protein concentration. The results are shown in the figure. Figure 5 shown.

[0041] like Figure 5 The results shown in the figure show that compared with the control group, the melanin content of the Upsalin hydrolyzed peptide group increased significantly and in a dose-dependent manner. When the Upsalin hydrolyzed peptide was added at a dosage of 20 mg / mL, the relative melanin content reached 211% of that of the control group. This confirms that Upsalin hydrolyzed peptide can significantly promote melanin synthesis in B16F10 mouse melanoma cells.

[0042] (3) This step is used to study the effect of Upsalin-pepsin hydrolyzed peptide on the tyrosinase activity expressed in B16F10 mouse melanoma cells. The specific steps are as follows: The cell culture was the same as step (2). After the culture was completed, the cells were digested with trypsin and collected into a 1.5 mL centrifuge tube. The cells were washed once with PBS, and 300 µL of 1% Triton X-100 was added to lyse the cells at 4°C for 30 min. 100 µL of cell extract and 100 µL of 0.1% L-DOPA were added to the ELISA plate and incubated at 37°C for 20 min. The absorbance at 475 nm was measured. The protein concentration was determined according to the instructions of the BCA kit. The blank group was used as a control to calculate the relative activity of tyrosinase. The results are shown in Figure 2. Figure 5 shown.

[0043] like Figure 5 The results show that compared with the control group, the tyrosinase activity of the cell group added with Upsalin hydrolyzed peptide was significantly increased, and increased in a dose-dependent manner. When the addition amount of Upsalin hydrolyzed peptide was 20 mg / mL, the relative activity of tyrosinase reached 358% of the control group. Tyrosinase is a key enzyme in the synthesis of melanin. The above results show that recombinant pearl protein Upsalin hydrolyzed peptide can promote melanin synthesis by increasing tyrosinase activity, indicating that it has potential application value in the treatment of diseases such as vitiligo, albinism and white spots.

[0044] Example 5 Biological Activity Detection of Recombinant Pearl Protein Upsalin Hydrolyzed Peptide According to the methods of Examples 2 and 3, the hydrolyzed peptides of pearl protein Upsalin encoded by the gene sequence shown in SEQ ID NO.2 were prepared, and according to the method of Example 4, the biological activity of the hydrolyzed peptides was detected. The results showed that when the addition amount of Upsalin hydrolyzed peptides was 20 mg / mL, the relative content of melanin reached 156% of that of the control group.

[0045] According to the methods of Examples 2 and 3, the hydrolyzed peptide of pearl protein Upsalin encoded by the gene sequence shown in SEQ ID NO.3 was prepared, and according to the method of Example 4, the biological activity of the hydrolyzed peptide was tested. The results showed that when the addition amount of Upsalin hydrolyzed peptide was 20 mg / mL, the relative content of melanin reached 147% of that of the control group.

[0046] The raw materials and equipment used in the present invention, unless otherwise specified, are all commonly used raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.

[0047] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A method for preparing a recombinant pearl protein hydrolyzed polypeptide, characterized in that: The following steps are involved: Step S1: obtaining pearl protein encoded by the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3; Step S2: The pearl protein provided in step S1 is hydrolyzed by pepsin to obtain a recombinant pearl protein hydrolyzed polypeptide.

2. The method for preparing a recombinant pearl protein hydrolyzed polypeptide according to claim 1, characterized in that: The pepsin hydrolysis method comprises the following steps: adding (8×10 3 )U~(1.2×10 4 ) U of pepsin, adjusting the pH of the hydrolysis treatment system to 1.0-4.0 and the temperature to 20-45°C to carry out the hydrolysis treatment.

3. The method for preparing a recombinant pearl protein hydrolyzed polypeptide according to claim 2, characterized in that: The time of the hydrolysis treatment is 5 to 10 hours.

4. The method for preparing a recombinant pearl protein hydrolyzed polypeptide according to claim 1, characterized in that: The method for obtaining the pearl protein encoded by the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 is: cloning the nucleotide sequence shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 into Escherichia coli, Bacillus subtilis or Pichia pastoris for expression to obtain the recombinant pearl protein.

5. The method for preparing a recombinant pearl protein hydrolyzed polypeptide according to claim 4, characterized in that: The recombinant pearl protein is subjected to a purification process, and the purification process comprises the following steps: Dissolving the recombinant pearl protein using 4.0-8.0 mol / L guanidine hydrochloride; The recombinant pearl protein is purified by column chromatography.

6. The recombinant pearl protein hydrolyzed polypeptide prepared by the preparation method according to any one of claims 1 to 6.

7. Use of the recombinant pearl protein hydrolyzed polypeptide prepared by the preparation method according to any one of claims 1 to 6 in the preparation of products for treating vitiligo, albinism or leukoplakia.

8. The use according to claim 7, characterized in that: The product described is a drug.

Images