Leuconostoc mesenteroides as well as method for recombinant expression of ferrous chelating enzyme and application thereof

Abstract

The invention relates to the technical field of fermented meat products, in particular to leuconostoc mesenteroides, a method for recombinant expression of ferrous chelating enzyme by the leuconostoc mesenteroides and application of the leuconostoc mesenteroides. The Leuconostoc mesenteroides LMS.HFUT is preserved in the China Center for Type Culture Collection on February 24, 2023, the preservation date is February 24, 2023, and the biological preservation number is CCTCC (China Center for Type Culture Collection) NO: M2023193. The method for recombinant expression of the ferrous chelating enzyme by using the leuconostoc mesenteroides comprises the following steps: 1) extracting DNA (Deoxyribose Nucleic Acid); 2) preparing competent cells; 3) competent cell transformation; (4) carrying out induced expression on the recombinant FECH; (5) collecting and purifying the recombinant FECH; and 6) analyzing the purity and molecular weight of the recombinase through polyacrylamide gel electrophoresis. The FECH is subjected to in-vitro recombinant expression and is separated and purified to improve the yield, and finally, the FECH is applied to fermented sausages to replace the color development effect of nitrite, so that the quality of the sausage in the fermentation process is controlled, and the safety is improved.

Description

Technical Field

[0001] The invention relates to the technical field of fermented meat products, and specifically relates to Leuconostoc mesenteroides, a method for recombinantly expressing ferrochelatase and its application. Background Art

[0002] Color is a direct sensory indicator for evaluating the quality of meat products. Long-term storage of meat products will cause the Fe content of myoglobin (Mb) to 2+ Oxidized Fe 3+ , into gray-brown metmyoglobin. Traditional meat processing widely uses nitrite to improve the color of meat products. Nitric oxide is produced by adding nitrite, and nitric oxide combines with myoglobin to produce bright red nitrosomyoglobin, which keeps the meat products in a relatively stable ideal color. However, nitrite will produce strong carcinogens - N-nitrosamine compounds, and may cause nitric oxide poisoning. In order to improve the safety of meat products and pursue natural clean labels, researchers are urgently seeking coloring methods to replace nitrite.

[0003] At present, the most widely studied method to replace nitrite is to use microorganisms for color development, and these microorganisms mainly include lactic acid bacteria, staphylococci and micrococci. CN109868251A discloses a strain of meat Staphylococcus B1-2 with color development. The coloring agent is meat Staphylococcus, which is cultured in liquid culture medium to make a freeze-dried fermentation agent, and the inoculation amount in salami is 0.01%-0.05%. When used, there is no significant difference in the chromaticity value between the inoculated strain group and the group with 60ppm of nitrite added during the entire fermentation period, which can replace the color development effect of nitrite in sausages. CN109868251A uses a meat Staphylococcus with nitric oxide synthase, which converts myoglobin into nitrosylmyoglobin through the nitric oxide produced by metabolism, thereby significantly improving the color of meat products.

[0004] CN110800913A discloses a coloring agent that replaces nitrite in processed meat products, wherein one coloring agent is a powder or suspension of coagulase-negative staphylococci, and the inoculation amount in meat product processing is 10 6 ~10 7 CFU / g meat; another coloring agent is composed of the above-mentioned bacterial powder or bacterial suspension and L-arginine, and the amount of L-arginine added is 0.6% to 1.2% of the weight of the meat product. The bacterial powder or bacterial suspension is prepared by culturing in a liquid culture medium. Coagulase-negative staphylococci with nitric oxide synthase can metabolize and produce nitric oxide during meat processing, thereby forming red nitrosylmyoglobin, making the processed meat product appear red; adding L-arginine can further enhance the coloring effect.

[0005] Although the above-mentioned microorganisms produce nitric oxide during metabolism and combine with myoglobin to form nitrosylmyoglobin, the microorganisms are not able to produce nitric oxide, resulting in the content of nitrosylmyoglobin in meat products being much lower than that of meat products with added nitrite, and the coloring effect of meat products is much weaker than that of meat products with added nitrite. Zinc protoporphyrin is a pigment that is more photo- and thermally stable than nitrosylmyoglobin. Zinc protoporphyrin (ZnPP) is a natural metal porphyrin pigment with a structure similar to heme, but the center of the porphyrin ring is Zn 2+ , showing better stability in light, heat and low oxygen environments. The formation of ZnPP mainly occurs through two pathways: one is Zn 2+ The first is to directly insert Zn into protoporphyrin (PPIX) to generate ZnPP; the second is to catalyze the ferrochelatase (FECH) to convert the Fe 2+ Removal and subsequent insertion of Zn 2+ FECH is widely present in nature, including plants, animals, microorganisms and other organisms.

[0006] At present, the research on the production of ZnPP by microorganisms mainly focuses on the production rules of ZnPP during the processing of nitrite-free cured ham and the screening of ZnPP-producing strains, while there is little research on FECH in microorganisms. Summary of the invention

[0007] The purpose of the present invention is to provide a Leuconostoc mesenteroides and a method and application of recombinantly expressing ferrochelatase thereof.

[0008] The research team of the present invention detected a large amount of ZnPP in expired pasteurized ham for the first time, and systematically explored the key factors affecting the production of ZnPP, preliminarily determining that microorganisms are an important driving factor for the production of ZnPP. Based on this, the present invention screened and obtained the color-producing Leuconostoc mesenteroides LMS.HFUT, and expressed FECH through in vitro recombinant expression, separated and purified it to increase the yield, and finally added it to meat products, which can achieve the color protection effect of replacing nitrite and improve the safety of meat products.

[0009] Specifically, the present invention provides the following technical solutions:

[0010] Leuconostoc mesenteroides LMS.HFUT was deposited in the China Center for Type Culture Collection on February 24, 2023, and the biological deposit number is CCTCC NO: M2023193.

[0011] The method for recombinantly expressing FECH using the above-mentioned Leuconostoc mesenteroides comprises the following steps:

[0012] (1) DNA extraction: The Leuconostoc mesenteroides LMS.HFUT strain was cultured in MRS liquid medium to the third generation and inoculated into the liquid medium at an inoculum size of 1.0% v / v, and then cultured at 37°C at a speed of 150-200 rpm for 12-16 h; primers were then designed for PCR amplification, and the primer sequences were as shown in SEQ ID NOs: 1-10; PCR reaction system: TaqPCR Master Mix 25 μL, 2 μL DNA, 1 μL forward and reverse primers, 21 μL sterile double distilled water; gradient PCR reaction conditions were: initial denaturation at 95°C for 20 min; 34 cycles: 95°C for 30 s, 56°C for 30 s, 72°C for 60 s; and finally extension at 72°C for 5 min; after amplification, PCR products and their sizes were observed using 2% agarose gel electrophoresis.

[0013] (2) Preparation of competent cells: Pick a single BL21 colony and inoculate it into LB liquid culture medium, and culture it in a 37°C shaker for 12 to 16 h; inoculate the cultured bacterial solution into LB liquid culture medium at 1% v / v, and continue to culture it in a 37°C shaker until OD600 reaches 0.4; divide the bacterial solution into centrifuge tubes in a clean bench and let it stand on ice for 20 min; after the ice bath, centrifuge it at 4°C, 4000g for 5 min, and remove the supernatant; add 100 μL of pre-cooled 0.1 M CaCl to the precipitate. 2 The solution was resuspended by gently blowing, and the solution was placed on ice for 20 min again. Then, the solution was centrifuged again at 4°C, 4000 g for 5 min, and the supernatant was discarded. 100 μL of pre-cooled 0.1 M CaCl was added to the precipitate again. 2 Solution, gently blow to resuspend the liquid, and the competent cells are ready; store in a -80℃ refrigerator for later use.

[0014] (3) Competent cell transformation: Take out the prepared BL21 competent cells on ice, add the product PQE-80L-FECH connected with the target gene and the PQE-80L vector, and let it stand in an ice box for 30 minutes; then place it in a 42°C water bath for heat shock for 90 seconds, then immediately take it out and cool it on ice for 3 minutes, then add 900 μL of 37°C preheated LB liquid culture medium without resistance, gently blow and mix, and put it in a 37°C constant temperature shaker to recover for 30 minutes; after recovery, take out 100 μL of bacterial solution and add it to the LB solid plate containing 100 μg / mL Amp, and culture it in a 37°C constant temperature incubator for 12 to 18 hours.

[0015] (4) Induced expression of recombinant FECH: The recombinant bacteria were cultured in LB liquid medium at 37°C and 170-220 rpm for 8-10 h to obtain seed solution; 1% v / v of the seed solution was inoculated into LB medium and cultured at 37°C and 170-220 rpm; when the bacterial concentration OD600 reached 0.6, IPTG was added at a final concentration of 0.5 mM for induction; the fermentation was continued at 37°C and 150-200 rpm for 12-16 h, the fermentation solution was collected and centrifuged, and the supernatant was the extracellular recombinant FECH crude enzyme solution.

[0016] (5) Collection and purification of recombinant FECH: After induction, the fermentation broth was centrifuged at 10,000 g and 4°C for 10 to 15 min to collect the bacterial precipitate; the bacterial cells were then resuspended in Tris-HCl buffer and centrifuged again. This operation was repeated twice to wash the bacterial cells; the washed bacterial resuspension was then subjected to ice-bath ultrasonication with the following parameters: power 200 to 300 W, working time 2 to 4 s, interval time 3 to 5 s, working time 10 to 15 min, and cycled 2 to 3 times;

[0017] After ultrasonic disruption until the bacterial solution becomes clear, centrifuge at 12000g for 10 to 15 minutes at 4°C to collect the supernatant, i.e., the crude enzyme solution; purify the obtained crude enzyme solution by nickel affinity chromatography; wash and balance a gravity nickel column containing nickel filler, flow through it three times with the crude enzyme solution, then elute the nickel column loaded with FECH using Tris-HCl buffer, and collect the eluate.

[0018] (6) Analysis of the purity and molecular weight of the recombinant enzyme by polyacrylamide gel electrophoresis: the crude enzyme solution and purified enzyme were mixed evenly with the protein loading buffer, and then heated in a boiling water bath for 2 to 5 min before loading; concentrated gel and separation gel were prepared, and the electrophoresis voltage was set to 70 to 100 V; after the experiment, the gel was immersed in Coomassie brilliant blue staining solution for 1 h, and then decolorized in a decolorizing solution by shaking until the background blue of the gel faded, and finally photographed using a gel imaging system to record the electrophoresis results.

[0019] The FECH obtained by the method of recombinantly expressing FECH by Leuconostoc mesenteroides of the present invention can be used to prepare a meat coloring agent, and can be applied to fermented sausages to replace the coloring effect of nitrite.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The research team of the present invention screened out the dominant strain producing ZnPP, Leuconostoc mesenteroides LMS.HFUT, and revealed its color development mechanism. Based on this, the present invention expressed FECH through in vitro recombinant expression, separated and purified it to increase the yield, and finally applied it to fermented sausages to replace the color development effect of nitrite, to control the quality of the sausage fermentation process and improve the safety.

[0022] Biological deposit information

[0023] Leuconostoc mesenteroides LMS.HFUT, classified as Leuconostoc mesenteroides, is deposited in the China Center for Type Culture Collection, the abbreviation of the collection institution is: CCTCC, the collection address is: Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, the collection date is February 24, 2023, and the biological collection number is CCTCC NO: M2023193. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the PCR identification diagram of the FECH gene encoded in the LM strain DNA.

[0025] Figure 2 This is a diagram of SDS-PAGE protein electrophoresis analysis.

[0026] Figure 3 This is the kinetic curve of recombinant FECH.

[0027] Figure 4 The photos of fermented sausages in different treatment groups are shown below. Group C is the control; Group N was added with 100ppm nitrite; Group P was inoculated with 10 7 CFU / g Pediococcus pentosaceus; Group S was inoculated with 10 7 CFU / g Staphylococcus xylosus; Group F was supplemented with 1μ / g FECH.

[0028] Figure 5 The fluorescence spectra of sausages with different treatments during fermentation. Group C was the control; Group N was added with 100 ppm nitrite; Group P was inoculated with 10 7 CFU / g Pediococcus pentosaceus; Group S was inoculated with 10 7 CFU / g Staphylococcus xylosus; Group F was supplemented with 1μ / g FECH. DETAILED DESCRIPTION

[0029] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] Example 1 Leuconostoc mesenteroides LMS.HFUT and plasmid

[0031] A strain of Leuconostoc mesenteroides subsp. (Leuconostoc mesenteroides subsp.) with the best color development effect was isolated from western-style ham and preserved in China Center for Type Culture Collection with biological preservation number of CCTCC NO: M2023193. It is referred to as LM in the following text.

[0032] The expression host used in the experiment of the present invention is Escherichia coli BL21 (DE3), and the expression vector used is pQE-80L plasmid. The coding gene of FECH has been codon-optimized according to the preference of Escherichia coli, and KpnI and BamHI restriction sites are added at the 5' and 3' ends respectively. The optimized coding gene sequence of FECH is shown in SEQ ID NO: 11.

[0033] Example 2 Recombinant expression of FECH

[0034] 1. DNA Extraction

[0035] The LM strain was cultured in MRS liquid medium to the third generation and inoculated into the liquid medium at an inoculum size of 1.0% (v / v), and then cultured at 37°C at a speed of 150-200 rpm for 12-16 hours. Primers were then designed for PCR amplification (primer sequences are shown in SEQ ID NO: 1-10). PCR reaction system: Taq PCR Master Mix 25 μL, 2 μL DNA, 1 μL forward and reverse primers, 21 μL sterile double distilled water. The gradient PCR reaction conditions were: initial denaturation at 95°C for 20 minutes; 34 cycles (95°C for 30 seconds, 56°C for 30 seconds, 72°C for 60 seconds), and finally extension at 72°C for 5 minutes. After amplification, 2% agarose gel electrophoresis was used to observe the PCR product and its size, as shown in FIG. Figure 1 .

[0036] Complete FECH CF948-F:TTAATTTTGTGCAAAATGCC

[0037] CF948-R:ATGAATAAAAAAGGTCTATTATTAGTC

[0038] Complete FECH 948CF-F: TTAATTTTGTGCAAAATGCC

[0039] 948CF-R:ATGAATAAAAAAGGTCTATTATTAGTC

[0040] Partial FECH P723-F:GGCTGGGCAGTGACATTAGT

[0041] P723-R:TAGTCAACCTAGGCACCCCT

[0042] Partial FECH P898-F:CAAAATGCCGGTTCGCAAGA

[0043] P898-R:CCTGACTCCCCACATCCAGA

[0044] Partial FECH P539-F:CAAAGATTTCGCCACCTGCC

[0045] P539-R:GAAAGAAATGCGTCTGGCGG

[0046] 2. Preparation of competent cells

[0047] Pick a single BL21 colony and inoculate it in LB liquid culture medium, and culture it in a 37℃ shaker for 12-16h. Inoculate the cultured bacterial solution into LB liquid culture medium at 1% (v / v), and continue to culture it in a 37℃ shaker until OD600 is about 0.4. Dispense the bacterial solution into centrifuge tubes in the clean bench and let it stand on ice for 20min. After the ice bath, centrifuge at 4℃, 4000g for 5min and remove the supernatant. Add 100μL of pre-cooled 0.1M CaCl to the precipitate. 2 The solution was resuspended by gently blowing, and the solution was placed on ice for 20 min again. Then, the solution was centrifuged again at 4°C, 4000 g for 5 min, and the supernatant was discarded. 100 μL of pre-cooled 0.1 M CaCl was added to the precipitate again. 2 Solution, gently blow to resuspend the liquid, and the competent cells are ready. Store in a -80℃ refrigerator for later use.

[0048] 3. Competent Cell Transformation

[0049] Take out the prepared BL21 competent cells on ice, add the product PQE-80L-FECH connected with the target gene and PQE-80L vector, and let it stand in the ice box for 30 minutes. Then put it in a 42℃ water bath for heat shock for 90 seconds, then immediately take it out and cool it on ice for 3 minutes, then add 900μL of 37℃ preheated non-resistant LB liquid culture medium, gently blow and mix, and put it in a 37℃ constant temperature shaker to recover for 30 minutes. After recovery, take 100μL of bacterial solution and add it to the LB solid plate containing 100μg / mL ampicillin solution, and culture it in a 37℃ constant temperature incubator for 12-18h.

[0050] 4. Inducible Expression of Recombinant FECH

[0051] From the LB liquid medium containing the recombinant bacteria, culture at 37°C, 170-220rpm for 8-10h to obtain the seed solution. Inoculate 1% (v / v) of the seed solution into the LB medium and culture at 37°C, 170-220rpm. When the bacterial concentration OD600 reaches 0.6, add a final concentration of 0.5mM IPTG for induction. Continue to ferment at 37°C, 150-200rpm for 12-16h, collect the fermentation liquid, centrifuge, and the supernatant is the extracellular recombinant FECH crude enzyme solution.

[0052] 5. Collection and Purification of Recombinant FECH

[0053] After induction, the fermentation broth was centrifuged at 10000g and 4°C for 10-15min to collect the bacterial precipitate. Subsequently, the bacterial cells were resuspended in Tris-HCl buffer and centrifuged again, and this operation was repeated twice to wash the bacterial cells. Subsequently, the washed bacterial resuspension was subjected to ice bath ultrasonic crushing, and the parameters were set as follows: power 200-300W, working time 2-4s, interval time 3-5s, working time 10-15min, and cycled 2-3 times. After ultrasonic crushing until the bacterial liquid became clear, centrifuged at 12000g for 10-15min at 4°C, and the supernatant was collected, i.e., the crude enzyme liquid. The obtained crude enzyme liquid was purified by nickel affinity chromatography. After washing and balancing the gravity nickel column containing nickel filler, the crude enzyme liquid was flowed through three times, and then the nickel column loaded with FECH was eluted with Tris-HCl buffer, and the eluate was collected.

[0054] 6. Polyacrylamide Gel Electrophoresis Analysis

[0055] The purity and molecular weight of the recombinant enzyme were analyzed by polyacrylamide gel electrophoresis. The crude enzyme solution and purified enzyme were mixed evenly with the protein loading buffer, and then heated in a boiling water bath for 2 to 5 minutes before loading. Prepare the concentrated gel and separation gel, and set the electrophoresis voltage to 70 to 100 V. After the experiment, the gel was immersed in Coomassie Brilliant Blue staining solution for 1 hour, and then decolorized by shaking in the decolorizing solution until the blue background of the gel faded. Finally, the gel imaging system was used to take pictures and record the electrophoresis results. The recombinant FECH purified and eluted by the nickel column showed a single protein band at 33KD ( Figure 2 ), and the protein expression level was significantly higher than that of the crude enzyme solution, proving that the recombinant protein was successfully purified.

[0056] 7. Enzyme Activity Assay

[0057] The enzyme activity of recombinant FECH is determined by measuring the conversion rate of ZnPP. The system includes: Mb, ascorbic acid and zinc sulfate, which are added to phosphate buffer and mixed. Then the diluted enzyme solution is added, and the mixture is incubated at 24-26°C in the dark for 12-16 hours. EDTA is added to terminate the reaction. The absorption peak of the sample to be tested at about 402nm is measured using an ultraviolet spectrophotometer, and the maximum absorption peak is read to determine the content of generated ZnPP. Under the analytical conditions, the amount of enzyme required for recombinant FECH to degrade Mb to generate 1μmol of ZnPP per minute is one unit of enzyme activity.

[0058] 8. Kinetic study of recombinant FECH

[0059] The kinetic parameters of FECH were determined in reaction systems with different substrate concentrations using Mb as the substrate. The reaction system included ascorbic acid, zinc sulfate, and recombinant FECH dissolved in phosphate buffer. The concentration of the substrate Mb ranged from 15 to 200 μM. The reaction was carried out at 25°C for 12 to 16 hours, and the effect of different Mb concentrations on the FECH enzyme activity was determined. Figure 3 This is the kinetic curve of recombinant FECH.

[0060] Example 3 Fermented Sausage Preparation

[0061] 1. Experimental Grouping

[0062] The experiment was divided into five groups: natural fermentation group (C); nitrite group (N): only 100ppm nitrite was added; commercial bacteria group (P): only 10 7 CFU / g P. pentosaceus (Pediococcus pentosaceus) from SACCO, Italy; Commercial bacteria group (S): only 10 7CFU / g commercial starter culture S. xylosus (Staphylococcus xylosus) from SACCO, Italy; Ferrochelatase group (F): only 1 μg / g of recombinant FECH prepared in Example 2 was added.

[0063] 2. Process

[0064] First, remove the fascia, fat and connective tissue of fresh pork hind leg meat, cut it into small pieces, and evenly mince it with a meat grinder, add sodium chloride, glucose and ascorbic acid, and add nitrite, commercial starter or recombinant FECH respectively, and mix them thoroughly. Use collagen casing for enema to ensure that the sausage is full and there are no bubbles. Finally, hang the sausage in a constant temperature and humidity chamber and ferment it for 72 hours at 30°C and 85% relative humidity; then air-dry it at 15°C and 45% relative humidity for 9 days to obtain the finished product. Sausage samples were collected on the 1st, 3rd, 7th and 12th days of the fermentation and maturation process to measure relevant indicators.

[0065] 3. Sensory evaluation

[0066] The sensory evaluation panel consisted of six meat researchers. The sausages were cut into 5mm thick samples and each evaluator evaluated them individually. The samples were scored based on color, flavor and texture, with a full score of 5.

[0067] The appearance characteristics of each group of sausages during fermentation and air drying are as follows: Figure 4 After air drying, the sausages in each group became shriveled and faded to varying degrees. The color of the sausages in groups N and F gradually changed from red to brown-red.

[0068] As shown in Table 1, the sensory evaluation change trend of sausages in group F was similar to that of groups N and S, and they all significantly improved their quality compared with group C. On day 1, sausages in all groups performed well in color, texture and odor scores, showing bright color, no odor, firm meat and high freshness. Obvious changes occurred after the 7th day, when the color of sausages in groups C and P became significantly darker and the scores were significantly lower than those in other groups (P<0.05). At the same time, group C had a slightly rancid smell. As the fermentation time went on, the quality of sausages in group C further declined, and the color, odor and texture became unsatisfactory.

[0069] Table 1 Sensory evaluation of sausage fermentation process

[0070]

[0071] Note: a, b, c indicate that different lowercase letters indicate that there are significant differences between different treatment samples (P<0.05). Group C is the control; Group N was added with 100 ppm nitrite; Group P was inoculated with 10 7CFU / g Pediococcus pentosaceus; Group S was inoculated with 10 7 CFU / g Staphylococcus xylosus; Group F was supplemented with 1μ / g FECH.

[0072] 4. Color

[0073] The prepared fermented sausage was cut into 20 mm high cylinders, and the color parameters of the pasteurized ham surface were evaluated using a colorimeter. L* represents brightness, a* represents redness, and b* represents yellowness. Before the test, a standard black and white plate was used for calibration, with an observation angle of 10°, a light source of D65, and an aperture of 8 mm. In the reflection mode, three readings were taken at three randomly selected locations for each sample. Chroma (C*) and hue (h°) were calculated according to the following formulas:

[0074]

[0075] h o =tan -1 (b * / a * )

[0076] The changes in color parameters of each group of sausages during processing are shown in Table 2. At the end of sausage drying, there was no significant difference in L* and b* values ​​among the groups (P>0.05). The a* value of group F was the highest, with no significant difference compared with group N (P>0.05); the C* value of group F was significantly higher than that of the other four groups (P<0.05); the h° value was lower than that of group C, which proved that the addition of FECH can effectively improve the color of sausages.

[0077]

[0078]

[0079] Table 2 Changes in color parameters of sausages treated with different methods during fermentation

[0080] Note: Different capital letters indicate that different treatment samples have significant differences in the same fermentation period (P<0.05); different lowercase letters indicate that the same treatment samples have significant differences in different fermentation periods (P<0.05). Group C is the control; Group N was added with 100 ppm nitrite; Group P was inoculated with 10 7 CFU / g Pediococcus pentosaceus; Group S was inoculated with 10 7 CFU / g Staphylococcus xylosus; Group F was supplemented with 1μ / g FECH.

[0081] 5. Fluorescence spectrum

[0082] Accurately weigh 5.0g of the sample to be tested, chop it and add it to 25mL of 75% (v / v) ice acetone, and homogenize it using a high-speed disperser for 1min. Then place the mixture on ice in the dark for 30min, then centrifuge it at 4℃, 8000g for 10min, take the supernatant and filter it through a 0.45μm filter membrane to obtain a pigment extract. Use a UV-visible spectrophotometer to analyze the pigment extract, and scan the absorption from 350 to 650nm at intervals of 1nm. The excitation wavelength and emission wavelength of Znpp are set to 420nm and 590nm, respectively.

[0083] Fluorescence spectra of sausages in different treatment groups Figure 5 Fluorescence spectroscopy analysis proved that a large amount of ZnPP was generated in the sausage of group F, while the pigments of the other four groups were mainly nitrosoheme; at the end of air-drying, the potential of using FECH to generate ZnPP in fermented meat products to replace nitrite for color development was verified.

[0084] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A Leuconostoc mesenteroides, characterized in that: Leuconostoc mesenteroides LMS.HFUT was deposited in the China Center for Type Culture Collection on February 24, 2023, and the biological deposit number is CCTCC NO: M2023193.

2. The method for recombinant expression of ferrochelatase by Leuconostoc mesenteroides according to claim 1, characterized in that: The following steps are involved: (1) DNA extraction; (2) preparation of competent cells; (3) transformation of competent cells; (4) induction of expression of recombinant FECH; (5) collection and purification of recombinant FECH; (6) analysis of the purity and molecular weight of the recombinant enzyme by polyacrylamide gel electrophoresis.

3. The method for recombinant expression of ferrochelatase by Leuconostoc mesenteroides according to claim 2, characterized in that: The step (1) specifically comprises culturing the Leuconostoc mesenteroides LMS.HFUT strain in an MRS liquid medium to the third generation and inoculating the liquid medium at an inoculum amount of 1.0% v / v, and then culturing at 37° C. at a speed of 150 to 200 rpm for 12 to 16 hours; then designing primers for PCR amplification, wherein the primer sequences are shown in SEQ ID NOs: 1-10; PCR reaction system: Taq PCR Master Mix 25 μL, 2 μL DNA, 1 μL forward and reverse primers, 21 μL sterile double distilled water; The gradient PCR reaction conditions were: initial denaturation at 95°C for 20 min; 34 cycles: 95°C for 30 s, 56°C for 30 s, and 72°C for 60 s; and a final extension at 72°C for 5 min; After amplification, PCR products and their sizes were observed using 2% agarose gel electrophoresis.

4. The method for recombinant expression of ferrochelatase by Leuconostoc mesenteroides according to claim 3, characterized in that: The step (2) specifically comprises the following steps: picking a single BL21 colony and inoculating it into LB liquid culture medium, and culturing it in a shaking incubator at 37°C for 12 to 16 hours; inoculating the cultured bacterial solution into LB liquid culture medium at 1% v / v, and continuing to culture it in a shaking incubator at 37°C until OD600 is 0.4; dispensing the bacterial solution into centrifuge tubes in a clean bench, and standing on ice for 20 minutes; after the ice bath, centrifuging at 4°C, 4000g for 5 minutes, and removing the supernatant; adding 100 μL of pre-cooled 0.1M CaCl2 solution to the precipitate, gently blowing to resuspend the liquid, ice bathing it again for 20 minutes, and then centrifuging it at 4°C, 4000g for 5 minutes, and discarding the supernatant; adding 100 μL of pre-cooled 0.1M CaCl2 solution to the precipitate again, gently blowing to resuspend the liquid, and the competent cells are prepared; and storing it in a -80°C refrigerator for later use.

5. The method for recombinant expression of ferrochelatase by Leuconostoc mesenteroides according to claim 4, characterized in that: The step (3) specifically comprises taking out the prepared BL21 competent cells on ice, adding the product PQE-80L-FECH obtained by connecting the target gene and the PQE-80L vector, and placing the cells in an ice box for 30 minutes; then placing the cells in a 42°C water bath for heat shock for 90 seconds, immediately taking the cells out for cooling on ice for 3 minutes, then adding 900 μL of 37°C preheated non-resistant LB liquid culture medium, gently blowing and mixing, and placing the cells in a 37°C constant temperature shaker for recovery for 30 minutes; after recovery, taking out 100 μL of the bacterial solution and adding it to an LB solid plate containing 100 μg / mL ampicillin solution, and culturing the cells in a 37°C constant temperature incubator for 12 to 18 hours; wherein the sequence of the target gene is shown in SEQ ID NO:

11.

6. The method for recombinant expression of ferrochelatase by Leuconostoc mesenteroides according to claim 5, characterized in that: The step (4) specifically comprises: adding the recombinant bacteria to the LB liquid culture medium, culturing at 37° C. and 170-220 rpm for 8-10 hours to obtain a seed solution; inoculating 1% v / v of the seed solution into the LB culture medium, and culturing at 37° C. and 170-220 rpm; when the bacterial concentration OD600 reaches 0.6, adding IPTG with a final concentration of 0.5 mM for induction; continuing to ferment at 37° C. and 150-200 rpm for 12-16 hours, collecting the fermentation solution, centrifuging, and obtaining the supernatant as the extracellular recombinant FECH crude enzyme solution.

7. The method for recombinant expression of ferrochelatase by Leuconostoc mesenteroides according to claim 6, characterized in that: The step (5) is specifically as follows: after the induction is completed, the fermentation liquid is centrifuged at 10000g and 4°C for 10-15 minutes to collect the bacterial precipitate; the bacterial cells are then resuspended in Tris-HCl buffer and centrifuged again, and this operation is repeated twice to wash the bacterial cells; the washed bacterial resuspension is then subjected to ice bath ultrasonic crushing, and the parameters are set as follows: power 200-300W, working time 2-4s, interval time 3-5s, working time 10-15min, and the cycle is repeated 2-3 times; After ultrasonic disruption until the bacterial solution becomes clear, centrifuge at 12000g for 10 to 15 minutes at 4°C to collect the supernatant, i.e., the crude enzyme solution; purify the obtained crude enzyme solution by nickel affinity chromatography; wash and balance a gravity nickel column containing nickel filler, flow through it three times with the crude enzyme solution, then elute the nickel column loaded with FECH using Tris-HCl buffer, and collect the eluate.

8. The method for recombinant expression of ferrochelatase by Leuconostoc mesenteroides according to claim 7, characterized in that: The step (6) specifically comprises: uniformly mixing the crude enzyme solution and the purified enzyme with the protein loading buffer, and then heating them in a boiling water bath for 2 to 5 minutes before loading; preparing a concentrated gel and a separation gel, and setting the electrophoresis voltage to 70 to 100 V; after the experiment, immersing the gel in a Coomassie brilliant blue staining solution for staining for 1 hour, and then decolorizing by shaking in a decolorizing solution until the blue background of the gel fades, and finally taking pictures using a gel imaging system to record the electrophoresis results.

9. Ferrochelatase obtained by the method for recombinant expression of ferrochelatase by Leuconostoc mesenteroides according to any one of claims 2 to 8.

10. The method for recombinant expression of ferrochelatase by Leuconostoc mesenteroides according to any one of claims 2 to 8 or the use of the ferrochelatase according to claim 9 in the preparation of a meat coloring agent or in the coloring of meat products.

Images