A strain of Pseudomonas oryzihabitans D339 and its applications
By using Pseudomonas sausage D339 strain, the problem of insufficient tillering in rice was solved, high yield and stable yield under various conditions were achieved, and the growth performance and stress resistance of rice were improved. It was suitable for the preparation of rice biological agents.
Patent Information
- Application Number
- CN202510473949.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-16
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2045-04-16
AI Technical Summary
The prior art is difficult to effectively promote rice tillering, especially under heavy metal stress and low nitrogen conditions, affecting rice yield and quality.
The strain of Pseudomonas vera D339 has various functions such as phosphorus removal, iron production carrier, and plant hormone production. Through inoculation, rice tillering is promoted and rice stress resistance and growth performance is improved.
Under different growth conditions, the tillering number of rice is significantly promoted, the tillering time is advanced, the growth of above-ground and underground parts is improved, the stress resistance is enhanced, and the yield and quality of rice is improved. It is suitable for multiple rice varieties, with low cost and no toxic side effects.
Smart Images

Figure CN120025944B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of microbial agents, in particular to a Pseudomonas oryzae D339 strain and application thereof. Background Art
[0002] As a major global food crop, rice's tillering period and number of tillers are important indicators for field management and an important way to promote high and high rice yields. Tillering is a natural growth process in which grass plants produce lateral buds from the base or underground stem nodes, which then develop into new branches. Plant tillering can increase the number of plants. In crop production, the more effective tillers there are, the more plants there are, and the higher the number of grain ears produced, which helps directly increase the final yield of the crop. At the same time, plant tillering can increase the photosynthetic area of the plant, allowing the plant to maximize photosynthetic efficiency within a limited growth space and promote plant growth. Plant tillering can also improve plant stress resistance and enhance the plant's ability to resist adverse environments such as disease and adverse stress. Even if some main stems or parts of the plant are damaged, tillers can replace the damaged parts and continue to grow, enhancing overall survival ability. Therefore, promoting rice tillering is an effective way to increase rice yield.
[0003] As a plant's reproductive organ, seeds possess the characteristic of "vertical" transmission, transmitting the entire biological characteristics of a variety, including the beneficial microorganisms residing within them, to future generations. Numerous studies have shown that rice seeds harbor a rich diversity of endophytic fungi and bacteria, and the combined effects of these beneficial endobiotics influence crop yield characteristics such as seed germination, plant growth, and tillering. Summary of the Invention
[0004] The purpose of the present invention is to provide a Pseudomonas oryzae D339 strain and its application, so as to provide a beneficial strain that can significantly promote rice tillering and rooting, and at the same time has multiple functions such as solubilizing phosphate, producing siderophores, and producing plant hormones, thereby contributing to high and stable yields of rice under different growth conditions.
[0005] To achieve the above object, the present invention provides a strain of Pseudomonas oryzae D339, the Latin name of which is Pseudomonas oryzihabitans The 16S rDNA sequence is shown in SEQ ID NO. 1, which was deposited in the Guangdong Provincial Microbiological Culture Collection on December 16, 2024. The deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and the deposit number is GDMCC No: 65646.
[0006] Preferably, the strain has good phosphate solubilization ability, siderophore production ability, and hormone production ability.
[0007] Preferably, the hormone-producing ability includes the ability to produce IAA and the ability to produce JA.
[0008] A use of the Pseudomonas oryzae D339 strain as described above in promoting rice tillering, wherein promoting rice tillering includes promoting the number of tillers and advancing the tillering time.
[0009] Preferably, the Pseudomonas oryzae D339 strain has the ability to promote rice tillering under heavy metal stress conditions; the heavy metal is Cd; and the heavy metal stress concentration is 5 mg / kg.
[0010] Preferably, the Pseudomonas oryzae D339 strain has the ability to promote rice tillering under low nitrogen level and normal nitrogen level conditions; the low nitrogen level is a nitrogen concentration of 7 mg / kg; the normal nitrogen level is a nitrogen concentration of 40 mg / kg.
[0011] A use of the Pseudomonas oryzae D339 strain as described above for promoting the dry weight of above-ground and underground parts of rice, wherein the rice is grown under normal conditions, heavy metal stress conditions or low nitrogen conditions.
[0012] A use of the Pseudomonas oryzae D339 strain as described above in the preparation of a rice biological preparation, wherein the biological preparation contains the Pseudomonas oryzae D339 strain; the biological preparation is intended to promote rice tillering, root growth or alleviate the effects of adversity.
[0013] Preferably, the adverse environment includes excessive heavy metals or low nitrogen soil.
[0014] Therefore, the present invention provides a strain of Pseudomonas oryzae D339 and its application, and its specific technical effects are as follows:
[0015] (1) The Pseudomonas oryzae D339 strain provided by the present invention can significantly promote the number of rice tillers and advance the tillering time under normal growth conditions, heavy metal stress conditions, and low nitrogen conditions, and can also promote the growth of both above-ground and underground parts of rice;
[0016] (2) The Pseudomonas oryzae D339 strain provided by the present invention promotes tillering, growth of above-ground and underground parts of rice, regardless of rice variety. Several rice varieties, such as Nipponbare, Xiushui 134, and Y Liangyou No. 1, have been tested, and all have shown significant effects.
[0017] (3) The Pseudomonas oryzae D339 strain provided by the present invention has many excellent properties, such as solubilizing poorly soluble organic and inorganic phosphorus, producing siderophores, producing plant hormones IAA and JA, and tolerating heavy metals;
[0018] (4) The Pseudomonas oryzae D339 strain provided by the present invention can be used to prepare rice biological agents with low cost, good effect and no toxic side effects. It can help to increase and stabilize rice yields under different growth conditions, improve rice quality and ensure food security. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.
[0020] Figure 1 The strain D339 of Pseudomonas oryzae in Example 1 of the present invention ( Pseudomonas oryzihabitans ) Characteristics of colonies formed on LB medium (a) and photos of LB shake flask fermentation culture (b);
[0021] Figure 2 The strain D339 of Pseudomonas oryzae in Example 2 of the present invention ( Pseudomonas oryzihabitans ) Photograph of the culture medium for qualitative evaluation of siderophore production capacity;
[0022] Figure 3 The figures are the statistical results of tiller number (a), dry weight of above-ground and underground parts (b), and a line graph of tiller number over time (c) for the experimental and control groups of rice grown on Nipponbare rice for 50 days in Example 3 of the present invention; the data are mean ± standard error, n = 13;
[0023] Figure 4 The results are as follows: the number of tillers (a) and the dry weight of above-ground and underground parts (b) of rice strain Y Liangyou No. 1 in the experimental and control groups in Example 4 of the present invention after cultivation at 0 and 5 mg / kg cadmium concentrations for 60 days; the data are mean ± standard error, n = 6;
[0024] Figure 5 The figures show photographs (a), statistical results of tiller number (b), statistical results of aboveground and underground dry weight (c), nitrogen content test results (d), and statistical results of nitrogen use efficiency (e) of rice Xiushui 134 in the experimental and control groups cultured for 60 days under low and normal nitrogen levels in Example 5 of the present invention; the data are mean ± standard error, n = 6. DETAILED DESCRIPTION
[0025] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.
[0026] In order to make the purpose, technical solutions and advantages of the present application clearer, more thorough and more complete, the technical solutions of the present invention are clearly and completely described below through the accompanying drawings and Examples. The following detailed description is an explanation of the embodiments and is intended to provide further details of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the application belongs.
[0027] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources.
[0028] The culture medium formula (per liter) used in the examples is as follows:
[0029] LB medium: 5 g yeast powder, 10 g tryptone, and 10 g sodium chloride.
[0030] NRBIP liquid medium: glucose 10.0 g, calcium phosphate 5.0 g, magnesium chloride 5.0 g, magnesium sulfate 0.25 g, potassium chloride 0.2 g, and ammonium sulfate 0.1 g.
[0031] CAS-LB double-layer solid medium: Add 15 mL of CAS dye solution to 180 mL of 1% water agar medium, shake well and pour into the plate as the lower layer medium, and 2% agar LB medium as the upper layer medium.
[0032] Preparation of CAS dye solution (200 mL): weigh 0.121 g of chrome azurol S and dissolve it in deionized water to make up to 100 mL. 3+ Solution (1 mM FeCl3·6H2O, 10 mM HCl) was added to 100 mL of chrome azuro blue S solution and mixed thoroughly to prepare solution A. 0.1458 g of CTAB was weighed and dissolved in deionized water to a volume of 80 mL to prepare solution B. Solution A was slowly added to solution B and mixed thoroughly to prepare CAS staining solution.
[0033] MKB liquid medium: 5 g casamino acids, 15 ml glycerol, 2.5 g magnesium sulfate heptahydrate, 2.5 g potassium hydrogen phosphate, adjust pH to 7.2.
[0034] Example 1
[0035] Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ), screening colonies grown on LB plates from a homogenate of Dejing No. 6 rice seeds with completely sterilized seed coats. On the LB plates, Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) In the early stage of growth, the colony surface is smooth, round, light yellow, and generally 1 to 2 mm in diameter ( Figure 1 a). The later stage showed wrinkles and serrated edges. Pseudomonasoryzihabitans ) is shown in SEQ ID NO.1, and was deposited in Guangdong Provincial Microbiological Culture Collection on December 16, 2024. The deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and the deposit number is GDMCCNo: 65646.
[0036] SEQ ID NO.1:
[0037] TGAGAGGAGCTTGCTCCTCGATTCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTAGTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAAGTGGGGGATCTTCGGACCTCACGCTATTAGATGAGCCTAGGTCGGATTAGCTAGTTGGTAGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCCCTCGGGTCGTAAAGCACTTTAAGTTGGGAGGAAGGGCTCATAGCGAATACCTGTGAGTTTTGACGTTACCAACAGAATAAGCACCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGCTTGATAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGTCTGGCTAGAGTGCGGTAGAGGGTAGTGGAATTTCCAGTGTAGCGGTGAAATGCGTAGATATTGGAAGGAACACCAGTGGCGAAGGCGACTACCTGGACTGACACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCAACTAGCCGTTGGGATCCTTGAGATCTTAGTGGCGCAGCTAACGCATTAAGTTGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCC
[0038] Example 2
[0039] Investigate the effects of Pseudomonas oryzihabitans strain D339 ( Pseudomonas oryzihabitans ) on the plant growth-promoting functional characteristics, as follows:
[0040] S21. Evaluation of phosphate-solubilizing ability:
[0041] 0.5 mL of Pseudomonas oryzae D339 bacterial solution (OD 600 = 0.8) was inoculated into 50 mL of NRBIP liquid medium, which contained the insoluble organic phosphorus calcium phytate and inorganic phosphorus tricalcium phosphate as the sole phosphorus source. Cultures were maintained at 37°C and 180 rpm for 5 days, with three replicates per treatment. Uninoculated NRBIP liquid medium was also used as a blank control. The fermentation broth was then filtered into a 50 mL centrifuge tube and centrifuged at 5000 rpm for 10 minutes. The soluble phosphorus content of the supernatant was determined using the molybdenum antimony colorimetric method, and the pH of the fermentation broth was measured using a pH meter.
[0042] S22. Siderophore production evaluation:
[0043] 1) Qualitative evaluation: Use CAS-LB double-layer solid medium. Under sterile conditions, filter the CAS dye solution through a sterile filter with a pore size of 0.22μm, then add it to a 1% agar sterile medium at 60℃ at a volume ratio of 10%. Mix well and pour it into the plate as the lower layer of the medium. After cooling and solidification, pour an equal amount of iron-free LB medium into the plate as the upper layer. Then, add 2μL of Pseudomonas oryzae D339 bacterial solution (OD 600 = 0.8) was inoculated into a CAS-LB double-layer solid culture medium and cultured in a 37°C constant temperature incubator in the dark for five days. The formation of a color change zone around the strain and the range of the color change were observed to qualitatively evaluate the siderophore production capacity of the strain.
[0044] 2) Quantitative evaluation: 0.5 mL of Pseudomonas oryzae D339 bacterial solution (OD 600 = 0.8) was inoculated into 50 mL of sterile MKB liquid medium and cultured at 37°C and 180 rpm for 3 days. Three replicates were used for each treatment. At the same time, an uninoculated MKB liquid medium was set as a blank control. The OD value of the fermentation liquid was measured. 600 After the fermentation broth was centrifuged (5000 rpm, 10 min), the supernatant was filtered through a 0.22 μm sterile filter. 1 mL of the filtrate was mixed with 1 mL of CAS quantitative detection solution in equal proportions. After reacting at room temperature for 1 h, the OD was measured. 630 , the siderophore unit (%) was calculated using the following formula = 100 × (Ar-AS) / Ar, where As represents the OD of the inoculated sample. 630 value, Ar represents the OD of blank control 630 The bacterial siderophore production capacity is the ratio of siderophore units to bacterial OD 600 ratio.
[0045] S23. Hormone production capacity evaluation
[0046] (1) Evaluation of IAA production capacity
[0047] 1 mL of Pseudomonas oryzae D339 bacterial solution (OD 600 =0.8) was inoculated into 100 mL of sterile LB liquid medium (containing 100 mg / L L-tryptophan) and cultured at 37°C and 180 rpm for 2 days. Each treatment was replicated in triplicate, and uninoculated LB liquid medium was used as a blank control. After the incubation period, the fermentation broth was centrifuged (5000 rpm, 10 minutes). The supernatant was then mixed with an equal volume of Salkowski colorimetric solution and developed in the dark for 30 minutes. The absorbance at 530 nm was measured, and the IAA production of the strain was calculated using an IAA standard curve.
[0048] (2) Evaluation of JA production capability
[0049] 0.5 mL of Pseudomonas oryzae D339 bacterial solution (OD 600 = 0.8) were inoculated into 50 mL of sterile LB liquid medium and cultured at 37°C and 180 rpm for two days. Five replicates were used for each treatment, and uninoculated LB liquid medium was set up as a blank control. After the culture period, the absorbance at 450 nm was measured using a jasmonic acid (JA) enzyme-linked immunosorbent assay (ELISA) kit, and JA production was calculated using a JA standard curve.
[0050] Test results
[0051] Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitan The results of the growth-promoting function test of s) are shown in Table 1. The Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitan s) has a positive effect on its phosphate solubility, siderophore production, and hormone production. Pseudomonas oryzihabitan s) was used to qualitatively evaluate the iron carrier production capacity of the bacteria. The treatment without inoculation was the negative control CK, and its inoculated plate showed color, which was consistent with the quantitative evaluation results ( Figure 2 ).
[0052] Table 1
[0053] ;
[0054] Note: The ability to produce siderophores is determined by the As / Ar value: from 1.0 to 0 in intervals of 0.2. A "+" is added for every 0.2 decrease. Generally, bacteria with an As / Ar value below 0.5 and an SU value greater than 0.5 are considered to have a high ability to produce siderophores.
[0055] Example 3
[0056] Investigation of the Pseudomonas oryzae D339 strain (Pseudomonas oryzihabitans ) on rice tillering. The specific steps are as follows:
[0057] 1) Test materials
[0058] The model plant Nipponbare ( Oryza. Sativa L. spp. japonica ) as the host plant, and the Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) is a microbial inoculant.
[0059] 2) Soil inoculants
[0060] Pick up Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) A single colony was inoculated into a 250 mL conical flask containing 100 mL LB medium, cultured at 37°C and 180 rpm for 2 days, and the bacterial fermentation broth was centrifuged (5000 rpm, 10 min) to obtain a bacterial agent. Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitan s) Characteristics of colonies formed on LB medium Figure 1 As shown in part a of the figure, the LB shake flask fermentation broth (bacterial agent) of the strain is as follows Figure 1 As shown in part b.
[0061] The above-mentioned bacterial agent was mixed with sterilized vermiculite, dried in the shade, and balanced for 7 days as an active bacterial inoculant. The inoculant for the non-inoculated control was mixed with sterilized vermiculite after being sterilized at 121℃ for 20 minutes and dried in the shade, and balanced for 7 days.
[0062] 3) Design and training of experimental and control groups
[0063] The rice variety Nipponbare was used as the host plant. The experimental group used the active bacterial inoculant obtained in step 2) as the culture medium. The roots were inoculated with the Pseudomonas oryzae D339 strain using the root dipping method. The control group (CK) used the control inoculant as the culture medium and was not inoculated with the Pseudomonas oryzae D339 strain at the time of planting. The plants were cultured in a greenhouse for 45 days, with 50 mL of water applied every two days. The number of tillers was observed and recorded daily to determine the activity of the Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) Whether there is a phenomenon of promoting tillering.
[0064] 4) Detection indicators
[0065] Before sampling, the number of tillers in the experimental and control groups was measured and the average was calculated for statistical comparison. When collecting samples, the aboveground and underground parts of the plants were separated. The underground roots were washed and dried, and the fresh weight of the aboveground and underground parts was measured. The roots were then oven-dried at 65°C to a constant weight, and the dry weight was determined.
[0066] 5) Test results
[0067] The results are as followsFigure 3 As shown in the figure, compared with the control group CK without inoculation, the tiller numbers of the inoculated groups increased significantly ( Figure 3 The dry weight of aboveground and underground parts also increased significantly ( Figure 3 At the same time, the time of tillering was also advanced. The inoculated group started tillering on the 19th day, while the CK group started tillering on the 22nd day ( Figure 3 In summary, it can be seen that the D339 strain ( Pseudomonas oryzihabitans ) While increasing the number of rice tillers, it also advances the time of tillering appearance.
[0068] Example 4
[0069] The results of the study on the effect of Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) on rice tillering, as follows:
[0070] 1) Test materials
[0071] The sterile seedlings of the rice variety Y Liangyou 1, which has low cadmium accumulation, were used as host plants. The Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) is a microbial inoculant.
[0072] 2) Design and training of experimental groups
[0073] Sterile vermiculite was used as the cultivation medium and Y Liangyou No. 1 sterile seedlings were used as the host plants. Each sterile seedling was inoculated with the Pseudomonas oryzae D339 strain prepared in Example 3 ( Pseudomonas oryzihabitans ) bacteria. At the same time, an equal amount of inactivated Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) microbial agent (121℃, sterilization for 20min) was used as the uninoculated control group. Plants were cultured in a Cd stress environment (Cd content 5mg / kg) for 60 days. At the same time, the Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) and the non-inoculated group served as the control group (CK). Six replicates were set for each treatment group.
[0074] 3) Detection indicators
[0075] By measuring the tiller number, biomass and other indicators of rice in different treatment groups, the effect of Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) on the growth characteristics of plants under heavy metal pollution conditions.
[0076] 4) Test results
[0077] like Figure 4As shown in Figure 2, compared with the control group CK without inoculation, the tiller number of the inoculated group increased significantly under no Cd stress and 5 mg / kg Cd stress ( Figure 4 The dry weight of aboveground and underground parts also increased significantly ( Figure 4 Part b). Description of Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) are resistant to heavy metals.
[0078] Example 5
[0079] The results of the study on the activity of Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) on rice tillering, as follows:
[0080] 1) Test materials
[0081] Using sterile seedlings of rice variety Xiushui 134 as host plants, Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) is a microbial inoculant.
[0082] 2) Design and training of experimental groups
[0083] Using sterile vermiculite as the cultivation medium and sterile Xiushui 134 seedlings as the host plants, each sterile seedling was inoculated with the inoculum prepared in Example 3 via root irrigation and cultured for 60 days in a low-nitrogen stress environment (nitrogen concentration of 7 mg / kg). A normal nitrogen environment (nitrogen concentration of 40 mg / kg) served as a control group. Six replicates were used for each treatment group. During the culture period, rice plants in the low-nitrogen and normal-nitrogen treatment groups were supplemented with equal amounts of low-nitrogen and normal-nitrogen nutrient solutions, respectively, to maintain normal growth.
[0084] 3) Detection indicators
[0085] By measuring the tiller number, biomass, nitrogen use efficiency and other indicators of rice in different treatment groups, the effect of different nitrogen levels on the growth of Pseudomonas oryzae D339 strain ( Pseudomonas oryzihabitans ) on the tillering of rice variety Xiushui 134. The nitrogen concentrations in the aboveground and underground parts of rice were determined by the Kjeldahl method.
[0086] 4) Test results
[0087] like Figure 5 As shown in Figure 2, under both normal and low nitrogen conditions, the tiller number of the inoculated group increased significantly compared with the uninoculated control group (CK). Figure 5 Part b), the growth condition is better ( Figure 5 (a part), above-ground and underground dry weight also increased significantly ( Figure 5 At the same time, the nitrogen content above and below ground in the two nitrogen level inoculation groups decreased significantly, but the nitrogen use efficiency increased significantly ( d and e). This shows that no matter under normal nitrogen level or low nitrogen stress level, Pseudomonas oryzae D339 strain ( Figure 5 Pseudomonas oryzihabitans ) can promote the tillering of Xiushui 134 and significantly improve the nitrogen use efficiency of rice.
[0088] Therefore, the oryzanose D339 strain provided by the present invention has multiple excellent characteristics such as solubilizing insoluble organic phosphorus and inorganic phosphorus, producing siderophores, producing plant hormones IAA and JA, and tolerating heavy metals; under normal growth conditions, heavy metal stress conditions, and low nitrogen conditions, it can significantly promote the number of rice tillers and advance the tillering time, and at the same time promote the growth of the above-ground and underground parts of rice; the promoting effect on rice tillering and the growth of the above-ground and underground parts is not affected by the rice variety, and multiple rice varieties such as Nipponbare, Xiushui 134, and Y Liangyou No. 1 have been tested, all of which have significant effects; it can be used to prepare rice biological preparations, with low cost, good effect, and no toxic side effects, and can contribute to high and stable yields of rice under different growth conditions, improved rice quality, and food security.
[0089] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. A strain of Pseudomonas oryzihabitans D339, characterized in that, The Latin name of the strain is Pseudomonas oryzihabitans The 16S rDNA sequence is shown in SEQ ID NO.
1. It was deposited in the Guangdong Provincial Microbiological Culture Collection Center on December 16, 2024. The deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, and the deposit number is GDMCCNo:65646.
2. Use of a strain of Pseudomonas oryzihabitans D339 as described in claim 1 in promoting rice tillering, characterized in that: The promotion of rice tillering includes promoting the tiller number and advancing the tillering time.
3. Use of a strain of Pseudomonas oryzihabitans D339 according to claim 2 in promoting tillering of rice, characterized in that: The Pseudomonas oryzihabitans strain D339 has the ability to promote rice tillering under heavy metal stress conditions; the heavy metal is Cd; the heavy metal stress concentration is 5 mg / kg.
4. Use of a strain of Pseudomonas oryzihabitans D339 according to claim 2 in promoting rice tillering, characterized in that: The Pseudomonas oryzihabitans strain D339 has the ability to promote rice tillering under low-nitrogen level and normal-nitrogen level conditions; the low-nitrogen level is a nitrogen concentration of 7 mg / kg; the normal-nitrogen level is a nitrogen concentration of 40 mg / kg.
5. Use of a strain of Pseudomonas oryzihabitans D339 as described in claim 1 in promoting the increase in the dry weights of the above-ground and underground parts of rice, characterized in that: The rice is rice grown under normal conditions, under heavy metal Cd stress conditions or under low-nitrogen conditions.
6. Use of a strain of Pseudomonas oryzihabitans D339 as claimed in claim 1 in the preparation of a biological agent for rice, characterized in that: The biological agent contains the Pseudomonas oryzihabitans strain D339; the purpose of the biological agent is to promote rice tillering, root growth or alleviate the effects caused by adversity; the adversity is Cd stress or low nitrogen.
Citation Information
Patent Citations
Bacillus isolates and uses thereof
CN110637082A
Compositions and methods comprising endophytic bacterium for application to target plants to increase plant growth, and increase resistance to abiotic and biotic stressors
WO2019028355A1