A β-nicotinamide mononucleotide production system and a method for preparing β-nicotinamide mononucleotide in a coordinated manner using two enzymes

By constructing a coupling reaction of NRK-HS01 and ADK whole-cell catalyst, the problems of low efficiency and high cost of NMN synthesis in the existing technology were solved, and efficient and low-cost NMN synthesis was achieved, which is suitable for industrial applications.

CN120025959BActive Publication Date: 2025-09-23HEFEI UNIV OF TECH
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510182707.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-19
Publication Date
2025-09-23
Estimated Expiration
2045-02-19

AI Technical Summary

Technical Problem

In the existing technology, the Klm-NRK enzyme derived from Kluyveromyces marxii has low catalytic efficiency under industrial conditions, high ATP cost, and the accumulation of byproduct ADP inhibits the reaction, resulting in low NMN synthesis efficiency and high cost, making it difficult to achieve large-scale application.

Method used

NRK-HS01 and ADK whole-cell catalysts were constructed to achieve one-step synthesis of NMN from NR and ATP through a coupled reaction, reducing the accumulation of byproduct ADP and recycling ATP. The catalytic reaction was carried out at room temperature and pressure using a whole-cell method.

Benefits of technology

The efficient synthesis of NMN is achieved, with a molar yield of over 99%, a 50% reduction in ATP cost, and reduced inhibition of by-product ADP accumulation. It is environmentally friendly, reduces production costs, and is suitable for industrial applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120025959B_ABST
    Figure CN120025959B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of biosynthesis technology, and more particularly to a β-nicotinamide mononucleotide production system and a method for preparing β-nicotinamide mononucleotide in a dual-enzyme collaborative manner. The β-nicotinamide mononucleotide production system comprises an NRK-HS01 whole-cell catalyst, an ADK whole-cell catalyst, nicotinamide riboside, adenosine triphosphate, and MgCl2. The present invention couples the NRK-HS01 whole-cell catalyst with an ATP regeneration system (ADK whole-cell catalyst) to catalyze the conversion of nicotinamide riboside and adenosine triphosphate to produce NMN in a single step. This method achieves an NMN molar yield exceeding 99%, reduces ATP costs by 50%, and reduces feedback inhibition of the synthesis reaction caused by the accumulation of the byproduct ADP. This method also enables the recycling of ATP, thereby improving synthesis efficiency and saving production costs. This method is of great significance for the industrial development of biosynthesis of NMN.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biosynthesis, and in particular to a β-nicotinamide mononucleotide production system and a method for preparing β-nicotinamide mononucleotide in a coordinated manner using two enzymes. Background Art

[0002] β-Nicotinamide mononucleotide (NMN), as a substance naturally present in the human body, plays a key role in the production of cellular energy. NMN is one of the important precursors for the synthesis of nicotinamide adenine dinucleotide in mammals. Nicotinamide adenine dinucleotide plays a vital role in maintaining human health. It is mainly involved in electron transfer reactions. However, with age, the total content of nicotinamide adenine dinucleotide will gradually decrease. Since nicotinamide adenine dinucleotide cannot be directly supplemented externally, the role of NMN is particularly important. It can enter the human blood, increase the content of β-nicotinamide mononucleotide in tissues, and then be rapidly converted into nicotinamide adenine dinucleotide in organs to play its important physiological functions.

[0003] Common methods for synthesizing NMN include chemical synthesis and biosynthesis. The chemical synthesis method is relatively complex, with many steps, requires the use of organic reagents for protection and deprotection, is environmentally unfriendly, isomer separation is difficult, and the product yield is low. Compared with chemical synthesis, the advantages of synthesizing NMN using biological methods, namely whole-cell methods, include the following: (1) the reaction is carried out in one step, with few side reactions and relatively simple separation and purification; (2) green synthesis, high atomic utilization rate, and strong economy; (3) simple wastewater treatment after product purification, which is conducive to large-scale application. Nicotinamide riboside and ATP generate NMN under the catalysis of nicotinamide ribokinase, which is considered to be the most promising synthetic route for NMN.

[0004] In the prior art, some people use Klm-NRK enzyme derived from Kluyveromyces marxianus to catalyze NR to produce NMN. The Klm-NRK enzyme derived from Kluyveromyces marxianus can catalyze 100g / L (0.30M) NR within 8 hours, and the molar yield of NMN is 84.2%. However, Klm-NRK only retains 40% enzyme activity under the commonly used industrial action conditions of 40-65°C and pH 5-8.5, and the catalytic efficiency is seriously lost. In addition, ATP is costly and consumed a lot. The accumulation of the generated byproduct ADP will inhibit the key enzymes in the biocatalytic reaction, causing the conversion efficiency to decrease or proceed in the reverse direction. To solve the above problems, the present invention intends to construct an adenylate kinase (ADK) type ATP regeneration system for catalyzing the one-step synthesis of NMN from NR and ATP, reducing the feedback inhibition of the byproduct ADP accumulation on the synthesis reaction, and at the same time realizing the recycling of ATP to improve the synthesis efficiency and save production costs, which is of great significance to the industrial development of biosynthesis of NMN. Summary of the Invention

[0005] The purpose of the present invention is to provide a β-nicotinamide mononucleotide production system and a method for preparing β-nicotinamide mononucleotide by dual enzyme collaboration to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a β-nicotinamide mononucleotide production system, which includes 20-25U / mL NRK-HS01 whole-cell catalyst, 20-25U / mL ADK whole-cell catalyst, 100-250mM nicotinamide riboside (NR), 100-120mM adenosine triphosphate (ATP) and 40-50mM MgCl2;

[0008] The preparation method of the NRK-HS01 whole-cell catalyst comprises the steps of transferring a recombinant vector containing the NRK-HS01 gene into Escherichia coli, culturing, fermentation induction, and centrifugation to obtain the NRK-HS01 whole-cell catalyst; the nucleotide sequence of the NRK-HS01 gene is shown in SEQ ID NO.6;

[0009] The preparation method of the ADK whole-cell catalyst includes the steps of transferring a recombinant vector containing the ADK enzyme gene into Escherichia coli, culturing, fermentation induction and centrifugation to obtain the ADK whole-cell catalyst; the nucleotide sequence of the ADK enzyme gene is shown in SEQ ID NO.7.

[0010] Preferably, the β-nicotinamide mononucleotide production system comprises 20 U / mL NRK-HS01 whole cell catalyst, 20 U / mL ADK whole cell catalyst, 200-250 mM nicotinamide riboside, 100 mM adenosine triphosphate and 40 mM MgCl2.

[0011] Further preferably, the β-nicotinamide mononucleotide production system comprises 20 U / mL NRK-HS01 whole-cell catalyst, 20 U / mL ADK whole-cell catalyst, 200 mM nicotinamide riboside, 100 mM adenosine triphosphate and 40 mM MgCl2.

[0012] Preferably, when preparing the NRK-HS01 whole-cell catalyst, the fermentation induction temperature is 25° C. and the time is 12 h.

[0013] Preferably, when preparing the ADK whole-cell catalyst, the fermentation induction temperature is 30° C. and the time is 12 h.

[0014] The present invention provides the use of the above-mentioned β-nicotinamide mononucleotide production system in the preparation of β-nicotinamide mononucleotide.

[0015] The present invention provides a method for preparing β-nicotinamide mononucleotide by dual enzyme synergy, comprising the following steps:

[0016] Mixing the NRK-HS01 whole-cell catalyst, the ADK whole-cell catalyst, nicotinamide riboside, adenosine triphosphate, and MgCl2 to obtain a reaction solution; wherein the enzyme activity of the NRK-HS01 whole-cell catalyst is 20-25 U / mL, the enzyme activity of the ADK whole-cell catalyst is 20-25 U / mL, the concentration of nicotinamide riboside is 100-250 mM, the concentration of adenosine triphosphate is 100-120 mM, and the concentration of MgCl2 is 40-50 mM;

[0017] performing a coupling reaction on the reaction solution to obtain the β-nicotinamide mononucleotide;

[0018] The preparation method of the NRK-HS01 whole-cell catalyst comprises the steps of transferring a recombinant vector containing the NRK-HS01 gene into Escherichia coli, culturing, fermentation induction, and centrifugation to obtain the NRK-HS01 whole-cell catalyst; the nucleotide sequence of the NRK-HS01 gene is shown in SEQ ID NO.6;

[0019] The preparation method of the ADK whole-cell catalyst includes the steps of transferring a recombinant vector containing the ADK enzyme gene into Escherichia coli, culturing, fermentation induction and centrifugation to obtain the ADK whole-cell catalyst; the nucleotide sequence of the ADK enzyme gene is shown in SEQ ID NO.7.

[0020] Preferably, the enzyme activity of the NRK-HS01 whole-cell catalyst in the reaction solution is 25 U / mL, the enzyme activity of the ADK whole-cell catalyst is 25 U / mL, the concentration of nicotinamide riboside is 200-250 mM, the concentration of adenosine triphosphate is 100 mM, and the concentration of MgCl2 is 40 mM.

[0021] Further preferably, the enzyme activity of the NRK-HS01 whole-cell catalyst in the reaction solution is 25 U / mL, the enzyme activity of the ADK whole-cell catalyst is 25 U / mL, the concentration of nicotinamide riboside is 200 mM, the concentration of adenosine triphosphate is 100 mM, and the concentration of MgCl2 is 40 mM.

[0022] Preferably, the coupling reaction time is 3-5 h, the temperature is 35-40° C., the pH is 7-8, and the rotation speed is 200-220 rpm.

[0023] Preferably, when preparing the NRK-HS01 whole-cell catalyst, the fermentation induction temperature is 25° C. and the time is 12 h.

[0024] Preferably, when preparing the ADK whole-cell catalyst, the fermentation induction temperature is 30° C. and the time is 12 h.

[0025] The present invention discloses the following technical effects:

[0026] The present invention couples the NRK-HS01 whole-cell catalyst with an ATP regeneration system (ADK whole-cell catalyst) to catalyze NR and ATP to synthesize NMN in one step. The NMN molar yield is above 99%, the ATP cost is reduced by 50%, and the feedback inhibition of the synthesis reaction caused by the accumulation of the byproduct ADP is reduced. At the same time, the recycling of ATP is realized to improve the synthesis efficiency and save production costs, which is of great significance to the industrial development of biosynthesis of NMN.

[0027] The present invention also has the following technical effects:

[0028] 1. The present invention constructs a new recombinant Escherichia coli NRK-HS01 and significantly improves the enzyme activity of the recombinant bacteria through site-directed mutagenesis, thereby achieving efficient synthesis of NMN.

[0029] 2. The present invention will construct a new recombinant Escherichia coli ADK, which not only provides raw materials for NMN synthesis through continuous ATP regeneration, but also reduces the feedback inhibition of the synthesis reaction caused by the accumulation of byproduct ADP.

[0030] 3. The present invention uses two whole-cell catalysts prepared from recombinant Escherichia coli to react with the substrate. Under high substrate concentrations, dual enzymes can synergistically catalyze the efficient synthesis of NMN. The NRK-HS01 whole-cell catalyst is used to catalyze the synthesis of NMN from NR and ATP; the ADK whole-cell catalyst is used to catalyze the cyclic regeneration of ATP in the system. It does not require a phosphate donor, greatly reducing the reaction cost, reducing the generation of the byproduct ADP, and increasing the NMN yield.

[0031] 4. The present invention discloses a method for producing β-nicotinamide mononucleotide using a whole-cell method. The entire catalytic reaction is carried out at room temperature and pressure, which is environmentally friendly. No toxic or harmful organic solvents are used, reducing environmental pollution. The entire catalytic process is a one-step reaction, which has the advantages of high conversion rate, concise purification steps and simple process, thereby better saving production costs.

[0032] In summary, the present invention solves the problem of byproduct accumulation and feedback inhibition during NMN biosynthesis by rationally combining nicotinamide ribokinase and adenylate kinase, meeting the requirements for efficient catalytic synthesis of NMN with high substrate concentrations while effectively reducing costs. The method of using nicotinamide ribokinase with an ATP regeneration system provided by the present invention has important application prospects for the efficient synthesis of β-nicotinamide mononucleotide. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0034] Figure 1 Schematic diagram of the process for constructing recombinant Escherichia coli;

[0035] Figure 2 is the NMN standard curve measured at a wavelength of 260 nm in Example 3;

[0036] Figure 3 This is the reaction HPLC detection diagram of NRK-HS01 whole cell catalyst;

[0037] Figure 4 This is the liquid chromatography peak diagram of β-nicotinamide mononucleotide standard;

[0038] Figure 5 A diagram showing the process of synthesizing NMN using the synergistic catalytic activity of the NRK-HS01 whole-cell catalyst and the ADK whole-cell catalyst.

[0039] Figure 6 This is a graph showing the changes in various components during the 3 h coupling reaction under the optimal conditions in Example 7. DETAILED DESCRIPTION

[0040] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0041] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0042] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0043] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0044] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0045] In the following examples or comparative examples, Escherichia coli DH5α and Escherichia coli BL21 (DE3) were purchased from Quanshijin Biotechnology Co., Ltd.; and the vector pET-28a-(+) was purchased from Novagen.

[0046] The components and concentrations in LB medium are: yeast extract 5 g / L, tryptone 10 g / L, and sodium chloride 10 g / L.

[0047] The specific method for determining enzyme activity is as follows: 5 mL of 100 mmol / L nicotinamide riboside and 100 mmol / L adenosine triphosphate were prepared with Tris-HCl buffer, and 20 mmol / L magnesium chloride was added. The pH was adjusted to 7.5 with Tris, 1 mL of enzyme solution was added, and the reaction was carried out at 37°C for 1 hour. 1 mL of the reaction solution was aspirated and heated in a 100°C water bath for 5 minutes. The concentration of β-nicotinamide mononucleotide was detected by high performance liquid chromatography. The amount of enzyme required to catalyze the reaction of 500 μmol nicotinamide riboside to produce 1 μmol β-nicotinamide mononucleotide within 1 hour at 37°C was defined as one enzyme activity unit (U).

[0048] Example 1

[0049] The gene (KPH72847.1) from Haemophilus influenzae was codon-optimized to synthesize the NRK1 gene. According to the sequences of the NRK1 gene and the pET-28a-(+) plasmid, primers were designed using Primer Premier 5.0. The forward primer was 5'-TTGCATCCAGCGCAGACGATCTTGCACG-3' (SEQ ID NO. 1), and the reverse primer was 5'-TCGTCTGCGCTGGATGCAACAGATTTTCAA-3' (SEQ ID NO. 2). By PCR amplification, a truncated gene clone fragment NRK-HI01 (SEQ ID NO. 5) containing BamH I and Xho I restriction sites was obtained. The above gene clone fragment NRK-HI01 was digested with double enzymes (BamH I and Xho I). I restriction enzyme cutting site) was ligated into the pET-28a-(+) plasmid to obtain the recombinant plasmid pET-28a-(+)-NRK-HI01 (pET-28a--NRK-HI01), and the recombinant plasmid was introduced into BL21(DE3) competent cells. The plasmid was extracted and used as a template to mutate the 8th amino acid using a forward primer (SEQ ID NO.3: 5'-AGCCGTGAATTTCGCCCAGCGCTGCGCAT-3') and a reverse primer (SEQ ID NO.4: 5'-CTGGGCGAAATTCACGGCTGGTGGTAAAGC-3'), so that the codon encoding glycine (GGC) was mutated to the codon encoding serine (AGC), and the mutated gene NRK-HS01 (SEQ ID NO.6), introduced into DMT competent cells to extract plasmids and sequence verification. After verification, the plasmids were introduced into BL21 (DE3) competent cells and screened on kanamycin-resistant plates to obtain recombinant E. coli NRK-HS01 producing nicotinamide ribokinase. The schematic diagram of the process for constructing recombinant E. coli NRK-HS01 is shown in the figure. Figure 1 shown.

[0050] The nucleotide sequence of NRK-HI01 is shown in SEQ ID NO. 5, specifically:

[0051] GGATCCATGGGCTTTACCACC GGC

[0052] The nucleotide sequence of NRK-HS01 is shown in SEQ ID NO.6, specifically:

[0053] GGATCCATGGGCTTTACCACC AGC

[0054] Example 2

[0055] The recombinant E. coli NRK-HS01 constructed in Example 1 was inoculated into 50 mL of LB medium containing 100 μg / mL kanamycin sulfate and cultured at 37°C and 220 rpm for 12 h until the absorbance OD 600 4.0, to obtain seed solution; take 1 mL of seed solution to 50 mL of LB medium, and culture at 37 ° C, 220 rpm for 6 h until the absorbance OD 600 The pH value was 4.0, and IPTG inducer with a concentration of 62.5 μg / mL was added. The fermentation was induced at 25°C for 12 h, and the mixture was centrifuged at 4°C and 8000 rpm for 15 min. The supernatant was removed, and Tris-HCl buffer with a pH of 7.5 was added to prepare a 0.1 g / mL whole-cell suspension of the bacteria with an enzyme activity of 100 U / mL, which was recorded as NRK-HS01 whole-cell catalyst.

[0056] Example 3

[0057] Six groups of standard solutions of 0.3, 0.84, 1.12, 1.4, 2.8, and 5.6 mg / mL were prepared using NMN standard. The peak areas were recorded by high performance liquid chromatography (detection conditions: chromatographic column was an amide column (4.6 mm × 250 mm, 5 μm); mobile phase was 0.05MKH2PO4 (pH 4.0): acetonitrile = 35:65; flow rate was 0.9 mL / min, detection wavelength was 260 nm). The data processing software was used to perform linear regression on the experimental data with concentration as the horizontal axis and the corresponding peak area in the chromatogram as the vertical axis to obtain the standard curve of NMN ( Figure 2 The NMN standard curve is y=8892357.5026x+680215.2531, R 2 =0.9997.

[0058] Example 4

[0059] A 100 mmol / L NR and 100 mmol / L ATP mixed solution was prepared using a Tris-HCl buffer solution with a pH of 7.5, and 20 mmol / L magnesium chloride was added. The pH of the substrate solution was adjusted to 7.5 using a Tris solution, and the whole cell suspension (NRK-HS01 whole cell catalyst) prepared in Example 2 was added to make the enzyme activity of the NRK-HS01 whole cell catalyst in the reaction system 20 U / mL to obtain a reaction solution. The pH of the reaction solution was maintained within 7.5±0.05. When the pH of the reaction solution no longer changed, it indicated that the reaction was complete. The reaction was terminated by heating at 100°C for 5 minutes, and the reaction solution was diluted 5 times using a Tris-HCl buffer solution. The precipitate was removed by centrifugation, and the supernatant was filtered using a 0.22 μm filter membrane. The filtered supernatant was detected by high performance liquid chromatography. The liquid chromatographic peak diagram of the reaction solution was as shown below. Figure 3 As shown; 4g / L β-nicotinamide mononucleotide standard solution was prepared using Tris-HCl solution, and the HPLC detection was also performed. The liquid chromatogram of the β-nicotinamide mononucleotide standard was as shown Figure 4 The results showed that the NRK-HS01 whole-cell catalyst was able to catalyze the synthesis of β-nicotinamide mononucleotide.

[0060] Example 5

[0061] A mixed solution of 100 mmol / L nicotinamide riboside and 100 mmol / L adenosine triphosphate was prepared using Tris-HCl buffer at pH 7.5, and 20 mmol / L magnesium chloride was added. The pH of the substrate solution was adjusted to 7.5 using Tris solution, and the whole-cell suspension (NRK-HS01 whole-cell catalyst) prepared in Example 2 was added to achieve an enzyme activity of 20 U / mL for the NRK-HS01 whole-cell catalyst in the reaction system. The mixture was stirred at 37°C for 3 h to catalyze the synthesis of β-nicotinamide mononucleotide with a conversion rate of 92.37%.

[0062] Example 6

[0063] After optimizing the codon preference of E. coli, the ADK enzyme gene (adenylate kinase gene) was added with BamH I and Xol I restriction sites at both ends to obtain the final ADK enzyme gene (SEQ ID NO. 7). This gene was inserted into the plasmid pET-28a-(+) to construct the recombinant plasmid pET-28a-(+)-ADK. The recombinant plasmid was synthesized by Shenggong (Shanghai) Biotechnology Co., Ltd. The transformation of the recombinant plasmid and the screening and culture of the recombinant E. coli were the same as in Example 1.

[0064] The positive clones after colony PCR verification were picked and inoculated into LB liquid medium and cultured at 37°C and 220 rpm for 12 h until the absorbance OD 6004.0, to obtain seed solution; take 1 mL of seed solution to 50 mL of LB medium, and culture at 37 ° C, 220 rpm for 6 h until the absorbance OD 600 The pH value was 4.0, and IPTG inducer with a concentration of 62.5 μg / mL was added. The fermentation was induced at 30°C for 12 h, and the mixture was centrifuged at 8000 rpm at 4°C for 15 min. The supernatant was removed, and Tris-HCl buffer with a pH of 7.5 was added to prepare a 0.1 g / mL whole-cell suspension of the bacteria with an enzyme activity of 100 U / mL, which was recorded as ADK whole-cell catalyst.

[0065] The nucleotide sequence of the ADK enzyme gene finally used is shown in SEQ ID NO.7, specifically:

[0066] .

[0067] Example 7

[0068] The ability of the NRK-HS01 whole-cell catalyst coupled with the ATP regeneration system (ADK whole-cell catalyst) to synthesize NMN was preliminarily verified by sequentially adding 20U / mL NRK-HS01 whole-cell catalyst, 20U / mL ADK whole-cell catalyst, 100mM NR, and 20mMMgCl2. The initial ATP addition amount was 100mM. The reaction was carried out at 37°C, pH 7.5, and 220rpm for 3h. The NMN molar yield was 97.27%. The process of synergistic catalytic synthesis of NMN by NRK-HS01 whole-cell catalyst and ADK whole-cell catalyst is as follows Figure 5 shown.

[0069] By properly adjusting the substrate-to-enzyme ratio, while maintaining the same enzyme dosage, increasing the NR dosage to 200mM, the ATP dosage to 100mM, and the MgCl2 dosage to 20mM, the molar yield of NMN increased to 99.14%. The introduction of an ATP regeneration system reduced the ATP dosage by 50% compared to the initial conditions, significantly reducing costs.

[0070] The optimal dosage is: 20U / mL NRK-HS01 whole cell catalyst, 20U / mL ADK whole cell catalyst, 200mM NR, 100mM ATP and 40mM MgCl2. Under this optimal dosage, the coupling reaction was carried out at 37℃ and pH 7.5 for 3h. The changes of each component during the 3h coupling reaction are as follows: Figure 6 The results showed that under the above conditions, the NMN concentration after 3 hours of reaction was 199.36 mM (66.63 g / L), achieving efficient synthesis of NMN by dual enzyme synergistic catalysis under high substrate concentration.

[0071] The above results show that after coupling the NRK-HS01 whole-cell catalyst with the ATP regeneration system, the synthesis of NMN can be more efficiently catalyzed at a lower cost.

[0072] Comparative Example 1

[0073] Same as Example 5, except that the NRK-HS01 whole-cell catalyst prepared in Example 2 was replaced with the crude enzyme solution prepared by the following method:

[0074] Using the NRK-HI01 gene (SEQ ID NO. 6), recombinant Escherichia coli NRK-HI01 was constructed, and then fermented to produce nicotinamide ribokinase, resulting in a whole-cell suspension with an enzyme activity of 45 U / mL. The construction method and enzyme production fermentation method are described in the application document with publication number "CN107603936A".

[0075] The molar yield of NMN in this comparative example was 72.41%.

[0076] Comparative Example 2

[0077] The optimal dosage and reaction conditions were the same as those in Example 7, except that the NRK-HS01 whole-cell catalyst prepared in Example 2 was replaced by the crude enzyme solution prepared in Comparative Example 1.

[0078] The molar yield of NMN in this comparative example was 86.41%.

[0079] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A β-nicotinamide mononucleotide production system, characterized in that: The β-nicotinamide mononucleotide production system is 20 U / mL NRK-HS01 whole cell catalyst, 20 U / mL ADK whole cell catalyst, 200-250 mM nicotinamide riboside, 100 mM adenosine triphosphate and 40 mM MgCl2; The preparation method of the NRK-HS01 whole-cell catalyst comprises the steps of transferring a recombinant vector containing the NRK-HS01 gene into Escherichia coli, culturing, fermentation induction, and centrifugation to obtain the NRK-HS01 whole-cell catalyst; the nucleotide sequence of the NRK-HS01 gene is shown in SEQ ID NO.6; The preparation method of the ADK whole-cell catalyst includes the steps of transferring a recombinant vector containing the ADK enzyme gene into Escherichia coli, culturing, fermentation induction and centrifugation to obtain the ADK whole-cell catalyst; the nucleotide sequence of the ADK enzyme gene is shown in SEQ ID NO.

7.

2. The β-nicotinamide mononucleotide production system according to claim 1, characterized in that When preparing the NRK-HS01 whole-cell catalyst, the fermentation induction temperature is 25° C. and the time is 12 h.

3. The β-nicotinamide mononucleotide production system according to claim 1, characterized in that When preparing the ADK whole-cell catalyst, the fermentation induction temperature is 30° C. and the time is 12 h.

4. Use of the β-nicotinamide mononucleotide production system according to any one of claims 1 to 3 in the preparation of β-nicotinamide mononucleotide.

5. A method for preparing β-nicotinamide mononucleotide by dual enzyme synergy, characterized in that: The following steps are involved: Mixing the NRK-HS01 whole-cell catalyst, the ADK whole-cell catalyst, nicotinamide riboside, adenosine triphosphate, and MgCl2 to obtain a reaction solution; wherein the enzyme activity of the NRK-HS01 whole-cell catalyst is 25 U / mL, the enzyme activity of the ADK whole-cell catalyst is 25 U / mL, the concentration of nicotinamide riboside is 200-250 mM, the concentration of adenosine triphosphate is 100 mM, and the concentration of MgCl2 is 40 mM; performing a coupling reaction on the reaction solution to obtain the β-nicotinamide mononucleotide; The preparation method of the NRK-HS01 whole-cell catalyst comprises the steps of transferring a recombinant vector containing the NRK-HS01 gene into Escherichia coli, culturing, fermentation induction, and centrifugation to obtain the NRK-HS01 whole-cell catalyst; the nucleotide sequence of the NRK-HS01 gene is shown in SEQ ID NO.6; The preparation method of the ADK whole-cell catalyst includes the steps of transferring a recombinant vector containing the ADK enzyme gene into Escherichia coli, culturing, fermentation induction and centrifugation to obtain the ADK whole-cell catalyst; the nucleotide sequence of the ADK enzyme gene is shown in SEQ ID NO.

7.

6. The method according to claim 5, characterized in that The coupling reaction time is 3-5 hours, the temperature is 35-40° C., the pH is 7-8, and the rotation speed is 200-220 rpm.

7. The method according to claim 5, characterized in that When preparing the NRK-HS01 whole-cell catalyst, the fermentation induction temperature is 25° C. and the time is 12 h.

8. The method according to claim 5, characterized in that When preparing the ADK whole-cell catalyst, the fermentation induction temperature is 30° C. and the time is 12 h.

Citation Information

Patent Citations

  • Recombinant engineering bacterium expressing alpha-amino acid ester acyltransferase as well as construction method and application of recombinant engineering bacterium

    CN107603936A

  • Method for efficiently preparing nicotinamide mononucleotide and fusion protein

    CN115637262A

  • Recombinant escherichia coli for producing nicotinamide ribokinase as well as construction method and application of recombinant escherichia coli

    CN119060982A

  • Method for producing nicotinamide mononucleotide through double-enzyme'one-pot method 'catalysis

    CN119177264A