Application of rice endosperm storage substance gene

Abstract

The invention provides application of a rice endosperm storage substance gene, and belongs to the technical field of biology. According to the application, the RSM gene is used for regulating and controlling the content of the rice endosperm storage substances. According to the application of the rice endosperm storage substance gene provided by the embodiment of the invention, the RSM gene is used for regulating and controlling the content of the rice endosperm storage substance, and the effect is remarkable.

Description

Technical Field

[0001] The present disclosure relates to the field of biotechnology, and in particular to an application of a rice endosperm storage substance gene. Background Art

[0002] Rice is the staple food of more than half of the world's population. For a long time, breeders have been focusing on how to increase rice yields to meet the growing population's demand for food. With the advancement of breeding technology in recent years, especially dwarf breeding and the use of hybrid vigor, grain yields have been greatly improved. However, with the improvement of living standards, people's consumption concepts have also changed, from eating enough to eating nutritiously and healthily, and higher requirements have been placed on the quality of rice. Therefore, cultivating new high-yield and high-quality rice varieties has become the main focus of breeders.

[0003] Rice quality traits mainly include appearance quality, processing quality, cooking and tasting varieties, and nutritional quality. Starch and storage protein are the main components of rice endosperm, of which starch accounts for more than 80% of the dry weight of endosperm. The starch in the endosperm includes amylose and amylopectin. A large number of studies have shown that the ratio of starch content, amylose content, and amylopectin content in the endosperm seriously affects the quality of rice. Protein is the storage substance in rice endosperm second only to starch, accounting for about 5% to 10% of the dry weight of endosperm. It can be roughly divided into four categories: glutenin, albumin, globulin, and alcohol-soluble protein. Their content and ratio can simultaneously affect the nutrition, processing, appearance, and tasting quality of rice.

[0004] At present, the progress of rice quality breeding is relatively slow. The reason is that the mechanism of rice quality formation is unclear, and there are few quality-related genes located and cloned, especially storage material-related genes. Therefore, discovering new storage material-related genes and constructing related mutants are of great significance for analyzing the mechanism of rice quality formation and rice quality breeding.

[0005] Public Content

[0006] In order to solve the problems of the prior art, the present disclosure provides an application of rice endosperm storage material genes. The technical solution is as follows:

[0007] The present disclosure provides an application of rice endosperm storage substance genes, characterized in that the application includes: using the RSM gene to regulate the content of rice endosperm storage substances.

[0008] Specifically, the application includes: knocking out, replacing or changing the amino acid sequence of the RSM gene to reduce the straight-chain starch content of rice and increase the amylopectin content, while keeping the total starch content of the rice unchanged.

[0009] Specifically, the application includes: knocking out, replacing or changing the amino acid sequence of the RSM gene to increase the total protein content and gluten content, and reduce the globulin content, alcohol-soluble protein content and albumin content.

[0010] Specifically, the application includes: selecting RSM-T as a target for gene knockout in the sequence of the RSM gene, wherein the sequence of the RSM-T is shown as SEQ ID NO: 1 in the sequence table;

[0011] A RSM gene knockout vector is constructed according to the RSM-T using a first forward primer, a first reverse primer, a second forward primer and a second reverse primer, wherein the sequence of the first forward primer is shown in SEQ ID NO: 2 in the sequence list, the sequence of the first reverse primer is shown in SEQ ID NO: 3 in the sequence list, the sequence of the second forward primer is shown in SEQ ID NO: 4 in the sequence list, and the sequence of the second reverse primer is shown in SEQ ID NO: 5 in the sequence list;

[0012] The RSM gene knockout vector is transformed into a receptor material to obtain a homozygous knockout mutant of the RSM gene.

[0013] Further, the application includes: using the pYLsgRNA-OsU6a plasmid as a template, using the first forward primer and the first reverse primer to perform a first PCR amplification to obtain a first amplification product of the U6b promoter containing the RSM-T, and using the second forward primer and the second reverse primer to perform a second PCR amplification to obtain a second amplification product containing the guide sgRNA fragment of the RSM-T;

[0014] Purifying and recovering the first amplification product and the second amplification product to obtain purified first amplification product and purified second amplification product;

[0015] Connecting the purified first amplification product and the purified second amplification product by overlapping PCR to obtain a connection product;

[0016] The ligation product is connected to the pYLCRISPR / Cas9Pubi-H vector to obtain the RSM gene knockout vector.

[0017] Furthermore, each 50 μL of the first PCR amplification reaction system includes: 5 μL of 10×PCR Buffer; 5 μL of 2.5 mM dNTP; 25 mM MgSO 43μL; 1.5μL of the first forward primer at a concentration of 10μM; 1.5μL of the first reverse primer at a concentration of 10μM; 1μL of 50-100ng / μL template DNA; 1μL of KOD-Plus-Neo high-fidelity polymerase at a concentration of 1U / μL; ddH 2 O 32 μL.

[0018] Furthermore, each 50 μL of the second PCR amplification reaction system includes: 5 μL of 10×PCR Buffer; 5 μL of 2.5 mM dNTP; 25 mM MgSO 4 3μL; 1.5μL of the second forward primer at a concentration of 10μM; 1.5μL of the second reverse primer at a concentration of 10μM; 1μL of 50-100ng / μL template DNA; 1μL of KOD-Plus-Neo high-fidelity polymerase at a concentration of 1U / μL; ddH 2 O 32μL,.

[0019] Furthermore, the reaction system of the recombination amplification per 50 μL includes: 5 μL of 10×Pfu Buffer; 4 μL of 2 mM dNTP; 4 μL of the first forward primer with a concentration of 10 μM; 4 μL of the second reverse primer with a concentration of 10 μM, 50 ng of the promoter U6a, 50 ng of the guide fragment sgRNA; 0.25 μL of KOD-Plus-Neo high-fidelity polymerase with a concentration of 5 U / μL; supplemented with ddH 2 0 to a total volume of 50 μL.

[0020] Furthermore, each 15 μL of the ligated reaction system includes: 10×CutSmart Buffer 1.5 μL; 10 mM ATP mixture 1.5 μL; 200 ng / μL pYLCRISPR / Cas9Pubi-H vector 0.5 μL; 50 ng / μL sgRNA expression cassette fragment 1 μL; 20 U / μL BsaI-HF endonuclease 0.5 μL; 400 U / μL T4 DNA ligase 0.2 μL; ddH 2 O 9.8 μL.

[0021] The beneficial effects brought about by the technical solution provided by the embodiments of the present disclosure are as follows: the embodiments of the present invention provide an application of rice endosperm storage substance genes, and the RSM gene is used to regulate the content of rice endosperm storage substances with significant effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0023] Figure 1 It is a statistical result diagram of the total starch content in the endosperm of the control group Nip and the RSM-KO-9 group and the RSM-KO-10 group provided in the embodiments of the present disclosure.

[0024] Figure 2 These are the statistical results of the amylose content in the endosperm of the control group Nip and the RSM-KO-9 and RSM-KO-10 groups provided in the embodiments of the present disclosure. Asterisks indicate significant differences compared with the control group (p value calculated by one-way ANOVA, *p<0.05, **p<0.01).

[0025] Figure 3 These are the statistical results of the amylopectin content in the endosperm of the control group Nip and the RSM-KO-9 and RSM-KO-10 groups provided in the embodiments of the present disclosure. Asterisks indicate significant differences compared with the control group (p value calculated by one-way ANOVA, *p<0.05, **p<0.01).

[0026] Figure 4 It is the statistical result of the total protein content in the endosperm of the control group Nip and the RSM-KO-9 group and the RSM-KO-10 group provided in the embodiments of the present disclosure. The asterisk indicates a significant difference compared with the control group (p value calculated by one-way ANOVA, *p<0.05, **p<0.01).

[0027] Figure 5 It is the statistical result of albumin content in endosperm of the control group Nip and RSM-KO-9 group and RSM-KO-10 group provided in the examples of the present disclosure. The asterisk indicates a significant difference compared with the control group (p value calculated by one-way ANOVA, **p<0.01).

[0028] Figure 6 It is the statistical result of the globulin content in the endosperm of the control group Nip and the RSM-KO-9 group and the RSM-KO-10 group provided in the embodiments of the present disclosure. The asterisk indicates a significant difference compared with the control group (p value calculated by one-way ANOVA, **p<0.01).

[0029] Figure 7It is the statistical result of the alcohol-soluble protein content in the endosperm of the control group Nip and the RSM-KO-9 group and the RSM-KO-10 group provided in the embodiments of the present disclosure. The asterisk indicates a significant difference compared with the control group (p value calculated by one-way ANOVA, **p<0.01).

[0030] Figure 8 It is the statistical result of gluten content in endosperm of the control group Nip and RSM-KO-9 group and RSM-KO-10 group provided in the examples of the present disclosure. The asterisk indicates a significant difference compared with the control group (p value calculated by one-way ANOVA, **p<0.01). DETAILED DESCRIPTION

[0031] In order to make the objectives, technical solutions and advantages of the present disclosure more clear, the embodiments of the present disclosure will be further described in detail below with reference to the accompanying drawings.

[0032] Example

[0033] The present disclosure provides an application of a rice endosperm storage substance gene, and the application includes: using the RSM gene to regulate the content of rice endosperm storage substances.

[0034] Specifically, the application includes: knocking out, replacing or changing the amino acid sequence of the RSM gene (LOC_Os03g08850) to reduce the straight-chain starch content of rice and increase the amylopectin content, while keeping the total starch content of rice unchanged.

[0035] Specifically, the application includes: knocking out, replacing or changing the amino acid sequence of the RSM gene to increase the total protein content and gluten content, and reduce the globulin content, alcohol-soluble protein content and albumin content

[0036] In this example, the sequence of the RSM gene can be obtained from the Rice Genome Annotation Project (uga.edu) website, and the coding sequence is shown as SEQ ID NO: 6 in the sequence listing.

[0037] Specifically, the application includes: selecting RSM-T as a target for gene knockout in the sequence of the RSM gene, the sequence of RSM-T is shown in SEQ ID NO: 1 in the sequence table, specifically: GTCCAGGTCGTCGTCGGTGACGG; in this embodiment, according to the obtained RSM coding sequence, the CRISPR-P 2.0 tool is used to design the knockout target of the RSM gene to obtain RSM-T.

[0038] The RSM gene knockout vector was constructed based on RSM-T;

[0039] The RSM gene knockout vector is transformed into the recipient material to obtain the SM gene homozygous knockout mutant, that is, the mutant with loss of RSM gene function.

[0040] Furthermore, the application includes: using the pYLsgRNA-OsU6a plasmid (donated by the team of Academician Liu Yaoguang, prepared using existing technology) as a template, using a first forward primer and a first reverse primer to perform a first PCR amplification to obtain a first amplification product of the U6b promoter containing RSM-T, using a second forward primer and a second reverse primer to perform a second PCR amplification to obtain a second amplification product of the guide sgRNA fragment containing RSM-T, the sequence of the first forward primer (UF) is as shown in SEQ ID NO: 2 in the sequence list, specifically: CTCCGTTTTACCTGTGGAATCG, the first reverse primer (RSM-U6aT) is as shown in SEQ ID NO: 3 in the sequence list, specifically: TCACCGACGACGACCTGGACGGCAGCCAAGCCAGCA, the sequence of the second forward primer (RSM-gT) is as shown in SEQ ID NO: 4 in the sequence list, specifically: TCCAGGTCGTCGTCGGTGAGTTTTAGAGCTAGAAAT, the second reverse primer (gR-R) is as shown in SEQ ID NO: 5 in the sequence list, specifically: TCCAGGTCGTCGTCGGTGAGTTTTAGAGCTAGAAAT As shown in NO: 5, specifically: CGGAGGAAAATTCCATCCAC, the amplification product of the U6b promoter containing RSM-T and the guide sgRNA fragment containing RSM-T was obtained;

[0041] Purifying and recovering the first amplification product and the second amplification product to obtain a purified first amplification product and a purified second amplification product;

[0042] Connecting the purified first amplification product and the purified second amplification product by overlapping PCR to obtain a connection product;

[0043] The ligation product was connected to the pYLCRISPR / Cas9Pubi-H vector to obtain the RSM gene knockout vector.

[0044] Furthermore, the reaction system of each 50 μL first PCR amplification includes: 10×PCR Buffer 5 μL; 2.5 mM dNTP 5 μL; 25 mM MgSO 4 3μL; 1.5μL of the first forward primer at a concentration of 10μM; 1.5μL of the first reverse primer at a concentration of 10μM; 1μL of 50-100ng / μL template DNA; 1μL of KOD-Plus-Neo high-fidelity polymerase at a concentration of 1U / μL; ddH 2 O 32 μL, total volume 50 μL.

[0045] Further, the first PCR amplification program is:

[0046]

[0047] Furthermore, the reaction system for the second PCR amplification per 50 μL includes: 10×PCR Buffer 5 μL; 2.5 mM dNTP 5 μL; 25 mM MgSO 4 3μL; 1.5μL of the second forward primer at a concentration of 10μM; 1.5μL of the second reverse primer at a concentration of 10μM; 1μL of 50-100ng / μL template DNA; 1μL of KOD-Plus-Neo high-fidelity polymerase at a concentration of 1U / μL; ddH 2 O 32 μL, total volume 50 μL.

[0048] Further, the second PCR amplification procedure is:

[0049]

[0050] Furthermore, the reaction system for each 50 μL of recombination amplification includes: 10×PCR Buffer 5 μL; 2 mM dNTP 5 μL; 25 mM MgSO 4 3μL; 1.5μL of the first forward primer (UF) with a concentration of 10μM; 1.5μL of the second reverse primer (gR-R) with a concentration of 10μM, 0.5μL of 50-100ng / μL promoter U6a, 0.5μL of 50-100ng / μL guide fragment sgRNA; 1μL of KOD-Plus-Neo high-fidelity polymerase with a concentration of 1U / μL; ddH 2 HO 32 μL to make a total volume of 50 μL.

[0051] Further, the overlapping PCR amplification procedure is:

[0052]

[0053] After the overlapping PCR amplification reaction was completed, the amplification product was recovered using 1% agarose gel. The target amplification product was about 700 bp in length, which was the sgRNA expression cassette. The sgRNA expression cassette was then connected to the pYLCRISPR / Cas9Pubi-H vector using the Golden Gate ligation method.

[0054] The ligation reaction system includes: 10×CutSmart Buffer 1.5μL; 10mM ATP mixture 1.5μL; 200ng / μL pYLCRISPR / Cas9Pubi-H vector 0.5μL; 50ng / μL sgRNA expression cassette fragment 1μL; 20U BsaI-HF endonuclease 0.5μL; 400U / μL T4 DNA ligase 0.2μL; ddH 2 HO 9.8 μL to make a total volume of 15 μL.

[0055] The reaction procedure for the connection is:

[0056]

[0057] After the ligation reaction is completed, a ligation product is obtained. After the ligation product is sequenced to verify that the sequence is correct, the construction of the RSM gene knockout vector is completed.

[0058] The RSM gene knockout vector was transformed into Agrobacterium EHa105 (purchased from Shanghai Weidi Biotechnology Co., Ltd.) by electroporation. The specific steps are as follows:

[0059] 1. Take a tube of EHA105 Agrobacterium competent cells (100 μL) stored at -80°C and melt it in ice;

[0060] 2. Add 1 μg of RSM gene knockout vector to the thawed EHA105 Agrobacterium competent cells and mix well by shaking the bottom of the tube;

[0061] 3. Place EHA105 Agrobacterium competent cells on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes.

[0062] 4. Add 700 μL of liquid LB medium without antibiotics to the EHA105 Agrobacterium competent cells and culture them in a 28°C constant temperature shaking incubator at 150 rpm for 2 to 3 hours;

[0063] 5. Centrifuge at 6000 rpm for 1 minute, discard the supernatant, collect the precipitate (bacteria), add 100 μL of LB liquid medium without antibiotics to the bacteria, mix by pipetting, resuspend the bacteria, and then spread the resuspended bacteria on LB solid medium containing 50 μg / mL kanamycin and 10 μg / mL rifampicin, and culture inverted at 28°C in the dark for 3 days;

[0064] 6. Pick a single colony and use primers UF and gR-R to detect positive strains, and expand the culture.

[0065] Then, the RSM gene knockout vector was transformed into the recipient material Nipponbare by Agrobacterium-mediated genetic transformation. The specific steps are as follows:

[0066] 1. Induction of callus tissue:

[0067] Select 300 mature and plump Nipponbare seeds, remove the outer husk with a small thresher, and then put them into a 50mL centrifuge tube. Wash them with tap water and distilled water three times each, then sterilize them with a 75% alcohol solution for 5 minutes, then wash them with sterile water three times, and finally add 30mL of a 1% sodium hypochlorite (NaClO) solution on the clean bench and sterilize them for 18 minutes. After sterilization, pour out the NaClO solution on the clean bench, wash them with sterile water five times, then spread the seeds on sterile filter paper and dry them on the clean bench. Finally, transfer the dried seeds to N6 solid induction medium and culture them at a constant temperature of 28°C in the dark for about 4 weeks to obtain callus tissue.

[0068] 2. Subgeneration:

[0069] Select calli with good growth, yellow color and density, transfer to new N6 solid culture medium and continue to culture at 28°C in the dark for about two weeks.

[0070] 3. Cultivation and suspension of Agrobacterium:

[0071] The EHA105 strain containing the RSM gene knockout vector that was cultured was collected by centrifugation at 6000 rpm, and the bacterial concentration was adjusted to about OD600=0.8 with 1 / 2N6 liquid culture medium to obtain a suspension.

[0072] 4. Infection:

[0073] Transfer fresh callus with good growth to the above suspension and culture for 15-20 minutes. After the culture is completed, pour out the suspension, transfer the callus to sterile filter paper and dry it on a clean bench for 1-2 hours. Then transfer it to 1 / 2N6 solid culture medium containing 150uMAS, and culture it in a 20℃ incubator in the dark for 1-2 days to obtain callus infected with Agrobacterium.

[0074] 5. Removal of Agrobacterium

[0075] Wash the infected callus with sterile water until the liquid is clear. Then continue sterilization with N6 liquid medium containing 500 mg / L cephalosporin, repeat 3 times. After sterilization, place the callus in a clean bench until it is dry.

[0076] 6. Screening of callus tissue

[0077] The dried callus tissue was transferred to N6 solid culture medium containing 250 mg / L cephalosporin and 50 mg / L hygromycin, and cultured in a 28°C incubator in the dark for 30 days to screen the callus tissue.

[0078] 7. Differentiation

[0079] Select well-growing calli and transfer them to MS solid culture medium. Culture them in an incubator at 8°C under light for 4 weeks. Green shoots of about 1 to 2 cm in length will grow.

[0080] 8. Rooting

[0081] Transfer the callus with green buds to 1 / 2MS rooting medium and culture at 28℃ under light for about two weeks, then the seedlings will grow roots.

[0082] 9. Hardening and transplanting

[0083] Take the seedlings with roots out of the 1 / 2MS medium, wash off the medium, remove the lateral roots and dead roots, put them in tap water, change the water every other day, and transplant them into the soil after one week. At this point, the seedlings are T0 generation plants, and after two generations of self-pollination, T2 generation strains can be obtained for subsequent experiments.

[0084] The phenotype of the homozygous knockout mutants of the RSM gene was observed. Specifically, in this embodiment, two homozygous knockout mutants of the RSM gene were selected, namely RSM-KO-9 group and RSM-KO-10 group as experimental groups, and the receptor material Nipponbare was used as the control group Nip.

[0085] The seeds of the control group, RSM-KO-9 group and RSM-KO-10 group were raised normally. When the seedlings were 4 weeks old, they were transplanted to the field with a spacing of 16.7 cm between plants and 26.7 cm between rows. Each material was planted in 5 rows, with 12 plants per row, for a total of 60 plants. Normal field water and fertilizer management was performed. The mature seeds were harvested, the husks of the seeds were removed with a brown rice machine, and then ground into polished rice, and finally ground into polished rice flour with a grinder to measure the content of storage substances in the endosperm.

[0086] The total starch content in the endosperm was measured using a plant starch content kit (Shanghai Qiyi Biotechnology Co., Ltd., QYS-234027) and the results were as follows: Figure 1 As shown. Figure 1 It can be seen that there is no significant difference in the total starch content in the endosperm of the Nip and RSM-KO-9 groups and the RSM-KO-10 groups. The amylose content in the endosperm was measured using an amylose content kit (Shanghai Qiyi Biotechnology Co., Ltd., QYS-234044). The results are as follows Figure 2 As shown in Figure 2, the amylose content in the endosperm of the RSM-KO-9 group and the RSM-KO-10 group was significantly lower than that in the Nip endosperm. The amylopectin content in the endosperm was measured using a branched starch content kit (Shanghai Qiyi Biotechnology Co., Ltd., QYS-234046). The results are shown in Figure 2. Figure 3As shown, the amylopectin content in the endosperm of RSM-KO-9 and RSM-KO-10 groups was significantly higher than that in the endosperm of Nip.

[0087] The total protein content in the endosperm was measured using the BCA protein content determination kit (Shanghai Qiyi Biotechnology Co., Ltd., QYS-237013). Figure 4 As shown, the total protein content in the endosperm of the RSM-KO-9 group and the RSM-KO-10 group was significantly higher than that in the Nip endosperm. Weigh 0.1g of rice flour in a 1.5mL centrifuge tube, add 1mL of distilled water, shake on a shaker for 2h, and then centrifuge at 10000r / min for 10min. Pour the supernatant into a 10mL graduated test tube, repeat the extraction 3 times, combine the extracts, add 1mL of 0.1% Coomassie Brilliant Blue-G250 colorimetric solution and make up to 10mL, then use a UV-754 spectrophotometer to measure the absorbance at 595nm. In addition, a working curve was made using a bovine serum albumin standard solution, and the albumin content was calculated based on the working curve. The results are shown in Figure 5 As shown in Figure 1, the albumin content in the endosperm of the RSM-KO-9 group and the RSM-KO-10 group was significantly lower than that in the Nip endosperm. 1 mL of 5% NaCl solution was added to the rice flour precipitate from which albumin was extracted to extract globulin. The extraction process was the same as the albumin content measurement method. The results are shown in Figure 1. Figure 6 As shown in the figure, the globulin content in the endosperm of the RSM-KO-9 group and the RSM-KO-10 group was significantly lower than that in the Nip endosperm. 1 mL of 70% ethanol solution was added to the rice flour precipitate from which globulin was extracted to extract alcohol-soluble protein. The extraction process was the same as the albumin content measurement method. The results are shown in the figure. Figure 7 As shown, the alcohol-soluble protein content in the endosperm of the RSM-KO-9 group and the RSM-KO-10 group was significantly lower than that in the Nip endosperm. 1 mL of a 0.2% NaOH solution was added to the rice flour precipitate from which alcohol-soluble protein had been extracted, and the mixture was shaken on a shaker for 2 hours, then centrifuged at 12000 r / min for 10 minutes to obtain the supernatant, which was poured into a 50 mL volumetric flask, and the extraction was repeated 3 times. The extracts were combined and fixed to 50 mL, 3 mL was drawn from the fixed solution into a 10 mL graduated tube, 1 mL of a 0.1% Coomassie Brilliant Blue-G250 colorimetric solution was added and fixed to 10 mL, and then the absorbance was measured at 595 nm using a UV-754 spectrophotometer. The gluten content was calculated based on the working curve. The results are shown in Figure 8 As shown, the glutenin content in the endosperm of RSM-KO-9 and RSM-KO-10 groups was significantly higher than that in the endosperm of Nip.

[0088] The above description is only an optional embodiment of the present disclosure and is not intended to limit the present disclosure. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present disclosure shall be included in the protection scope of the present disclosure.

Claims

1. An application of rice endosperm storage substance gene, characterized in that: The application includes: using the RSM gene to regulate the content of rice endosperm storage substances.

2. The use according to claim 1, characterized in that: The application includes: knocking out, replacing or changing the amino acid sequence of the RSM gene to reduce the straight-chain starch content of rice and increase the amylopectin content, while keeping the total starch content of the rice unchanged.

3. The use according to claim 1, characterized in that: The application includes: knocking out, replacing or changing the amino acid sequence of the RSM gene to increase the total protein content and gluten content, and reduce the globulin content, alcohol-soluble protein content and albumin content.

4. The use according to claim 1, characterized in that: The applications include: RSM-T is selected as a target for gene knockout in the sequence of the RSM gene, and the sequence of the RSM-T is shown in SEQ ID NO: 1 in the sequence table; A RSM gene knockout vector is constructed according to the RSM-T using a first forward primer, a first reverse primer, a second forward primer and a second reverse primer, wherein the sequence of the first forward primer is shown in SEQ ID NO: 2 in the sequence list, the sequence of the first reverse primer is shown in SEQ ID NO: 3 in the sequence list, the sequence of the second forward primer is shown in SEQ ID NO: 4 in the sequence list, and the sequence of the second reverse primer is shown in SEQ ID NO: 5 in the sequence list; The RSM gene knockout vector is transformed into a receptor material to obtain a homozygous knockout mutant of the RSM gene.

5. The use according to claim 4, characterized in that: The application includes: using the pYLsgRNA-OsU6a plasmid as a template, using the first forward primer and the first reverse primer to perform a first PCR amplification to obtain a first amplification product of the U6b promoter containing the RSM-T, and using the second forward primer and the second reverse primer to perform a second PCR amplification to obtain a second amplification product containing the guide sgRNA fragment of the RSM-T; Purifying and recovering the first amplification product and the second amplification product to obtain purified first amplification product and purified second amplification product; Connecting the purified first amplification product and the purified second amplification product by overlapping PCR to obtain a connection product; The ligation product is connected to the pYLCRISPR / Cas9Pubi-H vector to obtain the RSM gene knockout vector.

6. The use according to claim 5, characterized in that: The reaction system of the first PCR amplification per 50 μL includes: 5 μL of 10×PCR Buffer; 5 μL of 2 mM dNTP; 1.5 μL of the first forward primer with a concentration of 10 μM; 1.5 μL of the first reverse primer with a concentration of 10 μM; 1 μL of template DNA; 1 μL of KOD-Plus-Neo high-fidelity polymerase with a concentration of 5 U / μL; and 35 μL of ddH2O.

7. The use according to claim 5, characterized in that: The reaction system of the second PCR amplification per 50 μL includes: 5 μL of 10×PCR Buffer; 5 μL of 2 mM dNTP; 1.5 μL of the second forward primer with a concentration of 10 μM; 1.5 μL of the second reverse primer with a concentration of 10 μM; 1 μL of template DNA; 1 μL of KOD-Plus-Neo high-fidelity polymerase with a concentration of 5 U / μL; and 35 μL of ddH2O.

8. The use according to claim 5, characterized in that: The reaction system of the recombination amplification per 50 μL includes: 5 μL of 10×PCR Buffer; 5 μL of 2 mM dNTP; 1.5 μL of the first forward primer with a concentration of 10 μM; 1.5 μL of the second reverse primer with a concentration of 10 μM, 0.5 μL of the promoter U6a, 0.5 μL of the guide fragment sgRNA; 1 μL of KOD-Plus-Neo high-fidelity polymerase with a concentration of 1 U / μL; and 35 μL of ddH2O.

9. The use according to claim 5, characterized in that: Each 15 μL of the ligation reaction system includes: 10×CutSmart Buffer 1.5 μL; 10 mM ATP mixture 1.5 μL; 200 ng / μL pYLCRISPR / Cas9Pubi-H vector 0.5 μL; 50 ng / μL sgRNA expression cassette fragment 1 μL; 20 U / μL BsaI-HF endonuclease 0.5 μL; 400 U / μL T4 DNA ligase 0.2 μL; ddH2O 9.8 μL.

Images