Application of LSP1 in treatment of glioma by chimeric antigen receptor macrophages

Abstract

The invention provides application of LSP1 in treatment of glioma by chimeric antigen receptor macrophages, and relates to the field of medicine and medical treatment. The application of the LSP1 in treatment of glioma by the chimeric antigen receptor macrophages comprises the following steps: S1, finding that a group of macrophage subgroup CD44 high-expression subgroups with low-oxygen characteristics exist in GBM through GBM single cell sequencing data analysis and tumor tissue flow sorting, and the macrophage subgroup CD44 high-expression subgroups are closely related to a GBM inhibitory immune microenvironment and a GBM tumor cell malignant phenotype; and S2, in combination with low-oxygen macrophage line transcriptome sequencing and CD44 high-expression macrophage transcriptome sequencing analysis in the GBM, and in combination with a malignant mesenchymal phenotype macrophage MES-MP related gene set, screening and finding that the protein lymphocyte specific protein 1LSP1 is a potential molecule of the macrophage for regulating and controlling the malignant biological progress of the GBM. The dual effects of LSP1 mediating macrophages to remodel an inhibitory immune microenvironment and promoting GBM malignant mesenchymal phenotypic transformation are defined through in-vivo and in-vitro biological experiments.

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to application of LSP1 in chimeric antigen receptor macrophage therapy for glioma. Background Art

[0002] LSP1 (lymphocyte-specific protein 1): is a cytoskeleton-binding protein mainly expressed in immune cells. It plays an important role in regulating the cytoskeleton structure and migration ability of cells, especially the directional movement or residence of immune cells in an inflammatory environment.

[0003] Macrophages are the most abundant immune cells in the GBM tumor microenvironment, accounting for 50% of all GBM tumor cells. They play a crucial role in the interplay between the immunosuppressive TME and the malignant biological progression of GBM. Their primary functions include phagocytosis of cancer cells, secretion of cytokines and chemokines, infiltration of dense tissues, and accumulation in tumors. Furthermore, macrophages are key effector cells in cancer immunotherapy.

[0004] Chimeric antigen receptor (CAR): It is an artificially designed transmembrane receptor that usually consists of a single-chain variable region that recognizes tumor antigens, a hinge region, a transmembrane region and an intracellular signaling region.

[0005] Glioblastoma is the most malignant and prevalent glioma, with a short patient survival and extremely poor prognosis, with a 5-year survival rate of only 5.8%. The complex and interactive tumor microenvironment leads to the plastic malignant phenotypic transformation of GBM tumor cells, which is the main cause of treatment resistance. Within the GBM tumor microenvironment, macrophages constitute the most abundant immune cell population, accounting for 50% of the total GBM tumor cell population. They play a critical role in the interactive ecology between the immunosuppressive tumor microenvironment and the malignant biological progression of GBM. The interaction between macrophages and GBM tumor cells is manifested in: on the one hand, GBM tumor cells recruit macrophages and influence their immune function through intrinsic signaling pathways and secreted factors; on the other hand, macrophages promote the malignant biological progression of GBM through regulation of exosomes, cytokines, and ligand receptor pathways. Therefore, exploring the regulatory role of macrophages in promoting GBM malignant progression within the immunosuppressive tumor microenvironment is of great significance for elucidating the mechanisms of GBM treatment resistance. Therefore, those skilled in the art provide the use of LSP1 in chimeric antigen receptor macrophage therapy for glioma to address the issues raised in the above background technology. Summary of the Invention

[0006] (1) Technical problems solved

[0007] In response to the deficiencies of the existing technology, the present invention provides the application of LSP1 in the treatment of gliomas with chimeric antigen receptor macrophages, which solves the problem of the lack of effective immunotherapy for GBM tumor cells whose complex and interactive tumor suppressive immune microenvironment promotes the malignant phenotypic transformation.

[0008] (2) Technical solution

[0009] To achieve the above objectives, the present invention is implemented through the following technical solutions: Application of LSP1 in chimeric antigen receptor macrophage treatment of gliomas comprises the following steps:

[0010] S1. Analysis of GBM single-cell sequencing data and flow cytometry analysis of tumor tissue revealed the presence of a hypoxic macrophage subpopulation in GBM, which is a CD44-overexpressing subpopulation and is closely associated with the suppressive immune microenvironment of GBM and the malignant phenotype of GBM tumor cells.

[0011] S2. Combined transcriptome sequencing of hypoxic macrophages and CD44-overexpressing macrophages in GBM, combined with a gene panel associated with malignant mesenchymal phenotype macrophages (MES-MPs), identified the protein lymphocyte-specific protein 1 (LSP1) as a potential molecule in macrophage regulation of GBM malignant biological progression.

[0012] S3. Further analysis of IVY-GAP and TCGA data revealed that LSP1 is closely associated with hypoxia signatures, a malignant mesenchymal phenotype in GBM, and suppressive immune cell infiltration. Furthermore, LSP1 expression is significantly upregulated in hypoxia-treated macrophages, suggesting a potential key role in the polarization of macrophage immunosuppressive phenotypes and the conversion of GBM to a malignant mesenchymal phenotype.

[0013] In vitro cell studies showed that knocking out LSP1 in macrophages blocked hypoxia-induced increases in macrophage immunosuppressive phenotype markers CD274, CD163, and CD206. Furthermore, knocking out LSP1 in macrophages blocked increases in malignant mesenchymal phenotype markers YKL40 and CD44 in glioma cells induced by co-culture of hypoxia-prone macrophages and glioma cells.

[0014] Human monocytic THP1 cells were cultured in RPMI-1640 medium supplemented with 10% FBS. THP1 cells were cultured and passaged in a humidified incubator at 37°C and 5% CO2. THP1 cells were incubated with 100 ng / ml PMA in vitro for 24 hours to induce macrophages.

[0015] The qRT-PCR experimental steps are as follows: macrophages are treated with the lysis buffer in the RNA rapid extraction kit to extract total cellular mRNA, which is then reverse transcribed using a reverse transcription kit to obtain cDNA. Target genes are amplified by real-time fluorescence quantitative PCR using specific primers for CD274, CD163, and CD206. Gene expression is then analyzed using the 2-ΔΔCt relative quantification method to detect mRNA expression levels.

[0016] The Western blot experimental steps were as follows: remove the supernatant of macrophages from the different treatment groups, add RIPA protein lysis buffer to lyse the cells, and extract protein; quantify protein concentration with a BCA kit, add 30-50 μg of protein to a 10% sodium dodecyl sulfate-polyacrylamide gel for electrophoresis, and transfer to a PVDF membrane; after blocking, incubate with primary antibodies anti-YKL40 and anti-CD44 overnight at 4°C, then incubate with specific secondary antibodies, and develop and expose using enhanced chemiluminescence; analyze protein absorbance using the Chemi-docXRS+ image analysis system to confirm the successful construction of the EGFRvIII CAR-M;

[0017] S5. Given that the experiments in step S4 have verified the dual role of LSP1 in mediating macrophage remodeling of the suppressive immune microenvironment and promoting GBM malignant mesenchymal phenotype transformation, we intend to use EGFRvIII-targeted CAR-M therapy to knock out LSP1 expression to block the formation of GBM's immunosuppressive microenvironment and GBM's malignant mesenchymal phenotype transformation, thereby reducing GBM treatment resistance;

[0018] S6. CAR-M was constructed using piggyBac transposon technology. The piggyBac transposon gene expression vector was transfected to construct the EGFRvIII CAR-M, and EGFRvIII expression was verified by western blot. The EGFRvIII-CAR was prepared using the piggyBac transposon gene expression vector and contains a CD8α signal peptide, a scFv single-chain variable region fragment targeting the EGFRvIII antigen, the CD8α hinge and transmembrane domains, and the CD3ζ endodomain.

[0019] Among them, the specific nucleic acid sequence is as follows:

[0020] CD8α signal peptide sequence:

[0021] GCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCCAGGCCG; EGFRvIII

[0022] scFv sequence of antigen:

[0023] GACATCCAGATGACACAGACTACATCCTCCCTGTCTGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAAGTCAGGACATTAGTAAATATTTAAATTGGTATCAGCAGAAACCAGATGGAACTGTTAAACTCCTGATCTACCATACATCAAGATTACACTCAGGAGTCCCATCAAGGTTCAGTGGCAGTGGGTCTGGAACAGATTATTCTCTCACCATTAGCAACCTGGAGCAAGAAGATATTGCCACTTACTTTTGCCAACAGGGTAATACGCTTCCGTACACGTTCGGAGGGGGGACTAAGTTGGAAATAACAGGCTCCACCTCTGGATCCGGCAAGCCCGGATCTGGCGAGGGATCCACCAAGGGCGAGGTGAAACTGCAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCGTCACATGCACTGTCTCAGGGGTCTCATTACCCGACTATGGTGTAAGCTGGATTCGCCAGCCTCCACGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTAGTGAAACCACATACTATAATTCAGCTCTCAAATCCAGACTGACCATCATCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATTTACTACTGTGCCAAACATTATTACTACGGTGGTAGCTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGCGGCCGCA;

[0024] CD8α hinge sequence:

[0025] ACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGAT

[0026] Transmembrane domain sequence:

[0027] ATCTACATCTGGGCGCCCTTGGCCGGGACTTGTGGGGTCCTTCTCCTGTCACTGGTTATCACCCTTTACTGC;

[0028] CD3ζ endodomain sequence:

[0029] AGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAA GGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC;

[0030] The specific transfection steps are as follows: THP1-induced macrophages are inoculated into 6-well plates, and the cell plating density is controlled at approximately 70% confluence; the piggyBac transposon vector and the transposase vector are mixed at a mass ratio of 3:1, the DNA dosage is 2 μg / well, and Lipofectamine 3000 and DNA are diluted in serum-free culture medium respectively; the DNA and transfection reagent are mixed gently, and incubated at room temperature for 10-15 minutes to form a transfection complex; the prepared transfection complex is gently added to the cell culture medium, and the cells are placed in a 37°C, 5% CO2 incubator and incubated for 6-8 hours; then, fresh complete culture medium is replaced to remove the transfection reagent, and the cells are cultured at 37°C; 48 hours after transfection, a primary antibody anti-EGFRvIII is used for western blot, and the specific experimental steps are the same as S4 to determine the protein expression level of EGFRvIII;

[0031] S7. LSP1- / -CAR-M was further constructed using CRISPR / Cas9 technology. CRISPR sg-LSP1 was used to selectively knock out LSP1 in EGFRvIII CAR-M. LSP1 expression was then detected by western blot to verify the successful construction of LSP1- / -CAR-M.

[0032] Specific sgRNA-LSP1 design steps: Find the LSP1 gene on NCB, identify the exon region, use the CRISPOR online tool from Zhang Feng's laboratory, input the exon sequence, analyze the target sequence provided by the online tool, and select the sequence with a high specificity score and low off-target rate as the target sequence. The sgRNA-LSP1 sequence is selected as AGGACGAGGGCTTTGGCGAC;

[0033] Annealing primers were designed for the sgRNA-LSP1 sequence and inserted into the plasmid vector. After constructing the expression vector, EGFRvIII CAR-M was transfected with Lipofectamine 3000 using the same transfection steps as in S6. After 48 hours of culture, protein was extracted and western blot was performed to detect LSP1 protein levels using the same Western blot steps as in S4.

[0034] S8. mRNA was extracted from LSP1- / -CAR-M and CAR-M cells, and the expression of macrophage immune phenotype markers was analyzed by qRT-PCR. The results showed that compared with CAR-M cells, LSP1- / -CAR-M cells had significantly upregulated expression of the immune-activating molecules CD80 and CD86, while expression of the immunosuppressive molecules CD206 and CD163 was decreased. Therefore, LSP1- / -CAR-M cells have a stronger ability to activate the immune microenvironment response.

[0035] S9. LSP1- / -CAR-M and CAR-M were co-cultured with glioma cell lines expressing luciferase in 96-well plates for 24 hours. A live-cell luciferase assay was performed, in which 25 μl of D-luciferin was added to each well and fluorescence intensity was analyzed using a microplate reader. The results showed that LSP1- / -CAR-M had a stronger tumor-killing effect than CAR-M; therefore, LSP1- / -CAR-M has a stronger inhibitory effect on glioma cell activity.

[0036] S10. LSP1- / -CAR-M and CAR-M were co-cultured with glioma cells in a hypoxic microenvironment for 48 hours. Glioma cell mRNA was extracted and the expression of CD44, a malignant mesenchymal phenotype marker, was detected by qPCR. The results showed that LSP1- / -CAR-M could not promote the malignant phenotype transformation of glioma in a hypoxic microenvironment.

[0037] S11. The murine GL261 cell line was inoculated intracranially into C57 mice to create orthotopic tumor-bearing mice. Subsequently, murine LSP1- / -CAR-M and CAR-M were injected intratumorally, and radiotherapy was administered concurrently. The tumor growth curves and survival of the mice were monitored and compared using bioluminescence technology. Brain tumor tissues were collected and flow cytometry sorted to compare the infiltration of CD4+ and CD8+ T cells in the brain tumor tissues of the two groups of mice. The results showed that LSP1- / -CAR-M significantly inhibited tumor proliferation and prolonged the survival of the mice. In addition, LSP1- / -CAR-M promoted the infiltration of CD4+ and CD8+ T cells. Therefore, in vivo experiments demonstrated that LSP1- / -CAR-M significantly inhibited tumor proliferation and enhanced immune response, suggesting that it is a potentially effective immunotherapy for GBM.

[0038] AW264.7 murine macrophage cell line was cultured in DMEM plus 10% FBS medium and placed in a saturated humidity incubator at 37°C and 5% CO2 for culture and passage. The construction steps of murine LSP1- / -CAR-M and CAR-M were the same as S6 and S7.

[0039] (3) Beneficial effects

[0040] The present invention provides the use of LSP1 in chimeric antigen receptor macrophages for the treatment of gliomas. It has the following beneficial effects:

[0041] 1. In the present invention, bioinformatics analysis was performed by combining GBM public database data such as TCGA and IVY-GAP with macrophage transcriptome sequencing data, and LSP1 was screened as a potential molecule for macrophages to regulate the malignant biological progression of GBM. Further in vitro and in vivo biological experiments were conducted to clarify the dual role of LSP1 in mediating macrophage remodeling of the suppressive immune microenvironment and promoting the malignant mesenchymal phenotype transformation of GBM.

[0042] 2. In the present invention, knocking out LSP1 expression can block the formation of GBM immunosuppressive microenvironment and GBM malignant mesenchymal phenotype transformation, thereby enhancing the potential of CAR-M immunotherapy targeting EGFRvIII and reducing GBM radiotherapy sensitivity, providing a new treatment strategy for improving the prognosis of GBM patients and has good clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Schematic diagram of the overall workflow of the present invention;

[0044] Figure 2 Schematic diagram showing the results of GBM single-cell sequencing and GBM tumor flow sorting of the present invention;

[0045] Figure 3 This is a schematic diagram of the combined analysis and screening results of RNA-seq of macrophages with hypoxia characteristics and MES-MP-related genes in GBM in the present invention;

[0046] Figure 4 Schematic diagram of the experimental results of the present invention showing that LSP1 can inhibit the effect of hypoxia on the polarization of the immunosuppressive phenotype of macrophages;

[0047] Figure 5 This is a schematic diagram showing the results of qRT-PCR in the present invention compared with LSP1- / -CAR-M;

[0048] Figure 6 Schematic diagram of the hypoxic microenvironment in the present invention. DETAILED DESCRIPTION

[0049] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0050] Example 1:

[0051] like Figure 1-6 As shown, the embodiment of the present invention provides the use of LSP1 in chimeric antigen receptor macrophages to treat glioma, comprising the following steps:

[0052] S1. Analysis of GBM single-cell sequencing data and flow cytometry analysis of tumor tissue revealed the presence of a hypoxic macrophage subpopulation in GBM, which is a CD44-overexpressing subpopulation and is closely associated with the suppressive immune microenvironment of GBM and the malignant phenotype of GBM tumor cells.

[0053] S2. Combined transcriptome sequencing of hypoxic macrophages and CD44-overexpressing macrophages in GBM, combined with a gene panel associated with malignant mesenchymal phenotype macrophages (MES-MPs), identified the protein lymphocyte-specific protein 1 (LSP1) as a potential molecule in macrophage regulation of GBM malignant biological progression.

[0054] S3. Further analysis of IVY-GAP and TCGA data revealed that LSP1 is closely associated with hypoxia signatures, a malignant mesenchymal phenotype in GBM, and suppressive immune cell infiltration. Furthermore, LSP1 expression is significantly upregulated in hypoxia-treated macrophages, suggesting a potential key role in the polarization of macrophage immunosuppressive phenotypes and the conversion of GBM to a malignant mesenchymal phenotype.

[0055] In vitro cell studies showed that knocking out LSP1 in macrophages blocked hypoxia-induced increases in macrophage immunosuppressive phenotype markers CD274, CD163, and CD206. Furthermore, knocking out LSP1 in macrophages blocked increases in malignant mesenchymal phenotype markers YKL40 and CD44 in glioma cells induced by co-culture of hypoxia-prone macrophages and glioma cells.

[0056] Human monocytic THP1 cells were cultured in RPMI-1640 medium supplemented with 10% FBS. THP1 cells were cultured and passaged in a humidified incubator at 37°C and 5% CO2. THP1 cells were incubated with 100 ng / ml PMA in vitro for 24 hours to induce macrophages.

[0057] The qRT-PCR experimental steps are as follows: macrophages are treated with the lysis buffer in the RNA rapid extraction kit to extract total cellular mRNA, which is then reverse transcribed using a reverse transcription kit to obtain cDNA. Target genes are amplified by real-time fluorescence quantitative PCR using specific primers for CD274, CD163, and CD206. Gene expression is then analyzed using the 2-ΔΔCt relative quantification method to detect mRNA expression levels.

[0058] The Western blot experimental steps were as follows: remove the supernatant of macrophages from the different treatment groups, add RIPA protein lysis buffer to lyse the cells, and extract protein; quantify protein concentration with a BCA kit, add 30-50 μg of protein to a 10% sodium dodecyl sulfate-polyacrylamide gel for electrophoresis, and transfer to a PVDF membrane; after blocking, incubate with primary antibodies anti-YKL40 and anti-CD44 overnight at 4°C, then incubate with specific secondary antibodies, and develop and expose using enhanced chemiluminescence; analyze protein absorbance using the Chemi-docXRS+ image analysis system to confirm the successful construction of the EGFRvIII CAR-M;

[0059] S5. Given that the experiments in step S4 have verified the dual role of LSP1 in mediating macrophage remodeling of the suppressive immune microenvironment and promoting GBM malignant mesenchymal phenotype transformation, we intend to use EGFRvIII-targeted CAR-M therapy to knock out LSP1 expression to block the formation of GBM's immunosuppressive microenvironment and GBM's malignant mesenchymal phenotype transformation, thereby reducing GBM treatment resistance;

[0060] S6. CAR-M was constructed using piggyBac transposon technology. The piggyBac transposon gene expression vector was transfected to construct the EGFRvIII CAR-M, and EGFRvIII expression was verified by western blot. The EGFRvIII-CAR was prepared using the piggyBac transposon gene expression vector and contains a CD8α signal peptide, a scFv single-chain variable region fragment targeting the EGFRvIII antigen, the CD8α hinge and transmembrane domains, and the CD3ζ endodomain.

[0061] The specific transfection steps are as follows: THP1-induced macrophages are inoculated into 6-well plates, and the cell plating density is controlled at approximately 70% confluence; the piggyBac transposon vector and the transposase vector are mixed at a mass ratio of 3:1, the DNA dosage is 2 μg / well, and Lipofectamine 3000 and DNA are diluted in serum-free culture medium respectively; the DNA and transfection reagent are mixed gently, and incubated at room temperature for 10-15 minutes to form a transfection complex; the prepared transfection complex is gently added to the cell culture medium, and the cells are placed in a 37°C, 5% CO2 incubator and incubated for 6-8 hours; then, fresh complete culture medium is replaced to remove the transfection reagent, and the cells are cultured at 37°C; 48 hours after transfection, a primary antibody anti-EGFRvIII is used for western blot, and the specific experimental steps are the same as S4 to determine the protein expression level of EGFRvIII;

[0062] Among them, the specific nucleic acid sequence is as follows:

[0063] CD8α signal peptide sequence:

[0064] GCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCCAGGCCG; EGFRvIII

[0065] scFv sequence of antigen:

[0066] GACATCCAGATGACACAGACTACATCCTCCCTGTCTGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAAGTCAGGACATTAGTAAATATTTAAATTGGTATCAGCAGAAACCAGATGGAACTGTTAAACTCCTGATCTACCATACATCAAGATTACACTCAGGAGTCCCATCAAGGTTCAGTGGCAGTGGGTCTGGAACAGATTATTCTCTCACCATTAGCAACCTGGAGCAAGAAGATATTGCCACTTACTTTTGCCAACAGGGTAATACGCTTCCGTACACGTTCGGAGGGGGGACTAAGTTGGAAATAACAGGCTCCACCTCTGGATCCGGCAAGCCCGGATCTGGCGAGGGATCCACCAAGGGCGAGGTGAAACTGCAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCGTCACATGCACTGTCTCAGGGGTCTCATTACCCGACTATGGTGTAAGCTGGATTCGCCAGCCTCCACGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTAGTGAAACCACATACTATAATTCAGCTCTCAAATCCAGACTGACCATCATCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGCAAACTGATGACACAGCCATTTACTACTGTGCCAAACATTATTACTACGGTGGTAGCTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGCGGCCGCA;

[0067] CD8α hinge sequence:

[0068] ACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGCCCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGAT

[0069] Transmembrane domain sequence:

[0070] ATCTACATCTGGGCGCCCTTGGCCGGGACTTGTGGGGTCCTTCTCCTGTCACTGGTTATCACCCTTTACTGC;

[0071] CD3ζ endodomain sequence:

[0072] AGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAA GGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC;

[0073] S7. LSP1- / -CAR-M was further constructed using CRISPR / Cas9 technology. CRISPR sg-LSP1 was used to selectively knock out LSP1 in EGFRvIII CAR-M. LSP1 expression was then detected by western blot to verify the successful construction of LSP1- / -CAR-M.

[0074] Specific sgRNA-LSP1 design steps: Find the LSP1 gene on NCB, identify the exon region, use the CRISPOR online tool from Zhang Feng's laboratory, input the exon sequence, analyze the target sequence provided by the online tool, and select the sequence with a high specificity score and low off-target rate as the target sequence. The sgRNA-LSP1 sequence is selected as AGGACGAGGGCTTTGGCGAC;

[0075] Annealing primers were designed for the sgRNA-LSP1 sequence and inserted into the plasmid vector. After constructing the expression vector, EGFRvIII CAR-M was transfected with Lipofectamine 3000 using the same transfection steps as in S6. After 48 hours of culture, protein was extracted and western blot was performed to detect LSP1 protein levels using the same Western blot steps as in S4.

[0076] S8. mRNA was extracted from LSP1- / -CAR-M and CAR-M cells, and the expression of macrophage immune phenotype markers was analyzed by qRT-PCR. The results showed that compared with CAR-M cells, LSP1- / -CAR-M cells had significantly upregulated expression of the immune-activating molecules CD80 and CD86, while expression of the immunosuppressive molecules CD206 and CD163 was decreased. Therefore, LSP1- / -CAR-M cells have a stronger ability to activate the immune microenvironment response.

[0077] S9. LSP1- / -CAR-M and CAR-M were co-cultured with glioma cell lines expressing luciferase in 96-well plates for 24 hours. A live-cell luciferase assay was performed, in which 25 μl of D-luciferin was added to each well and fluorescence intensity was analyzed using a microplate reader. The results showed that LSP1- / -CAR-M had a stronger tumor-killing effect than CAR-M; therefore, LSP1- / -CAR-M has a stronger inhibitory effect on glioma cell activity.

[0078] S10. LSP1- / -CAR-M and CAR-M were co-cultured with glioma cells in a hypoxic microenvironment for 48 hours. Glioma cell mRNA was extracted and the expression of CD44, a malignant mesenchymal phenotype marker, was detected by qPCR. The results showed that LSP1- / -CAR-M could not promote the malignant phenotype transformation of glioma in a hypoxic microenvironment.

[0079] S11. The murine GL261 cell line was inoculated intracranially into C57 mice to create orthotopic tumor-bearing mice. Subsequently, murine LSP1- / -CAR-M and CAR-M were injected intratumorally, and radiotherapy was administered concurrently. The tumor growth curves and survival of the mice were monitored and compared using bioluminescence technology. Brain tumor tissues were collected and flow cytometry sorted to compare the infiltration of CD4+ and CD8+ T cells in the brain tumor tissues of the two groups of mice. The results showed that LSP1- / -CAR-M significantly inhibited tumor proliferation and prolonged the survival of the mice. In addition, LSP1- / -CAR-M promoted the infiltration of CD4+ and CD8+ T cells. Therefore, in vivo experiments demonstrated that LSP1- / -CAR-M significantly inhibited tumor proliferation and enhanced immune response, suggesting that it is a potentially effective immunotherapy for GBM.

[0080] AW264.7 murine macrophage cell line was cultured in DMEM plus 10% FBS medium and placed in a saturated humidity incubator at 37°C and 5% CO2 for culture and passage. The construction steps of murine LSP1- / -CAR-M and CAR-M were the same as S6 and S7.

[0081] in, Figure 2Figure A shows that GBM single-cell sequencing and GBM tumor flow cytometry results showed the presence of a macrophage subpopulation characterized by high CD44 expression in TAMs, which was positively correlated with the number of CD44-expressing tumor cells with a malignant mesenchymal phenotype. Figure B shows that transcriptomic analysis suggested that the CD44-high-expressing macrophage subpopulation had hypoxia characteristics and a higher immunosuppression score.

[0082] Figure 3 Figure A shows RNA-seq of hypoxic macrophages. Joint analysis of RNA-seq of hypoxic macrophages and MES-MP-related genes in GBM screened out LSP1. Figure B shows that IVY-GAP data showed that LSP1 expression was closely associated with hypoxic necrosis. Figure C shows that GSEA enrichment results showed that LSP1 expression was positively correlated with the malignant mesenchymal phenotype of GBM. Figure D shows that immune score showed that LSP1 expression was positively correlated with the infiltration of immunosuppressive phenotype macrophages. Figure E shows that LSP1 expression was increased in macrophages treated with hypoxia.

[0083] Figure 4 Figure A shows that knocking down LSP1 can inhibit the effect of hypoxia on the polarization of the immunosuppressive phenotype of macrophages; Figure B shows that knocking down LSP1 can inhibit the promotion of hypoxic macrophages on the malignant mesenchymal phenotype transformation of GBM cells; Figure C shows that Western blot analysis showed that human and mouse LSP1- / -CAR-Ms expressed EGFRVIII but did not express LSP1, indicating that LSP1- / -CAR-Ms were successfully constructed;

[0084] Figure 5 Figure A shows that qRT-PCR results showed that compared with CAR-M, LSP1- / -CAR-M had significantly upregulated expression of immune-activating molecules CD80 and CD86, while downregulated expression of immune-suppressive molecules CD206 and CD163; Figure B shows that live cell luciferase assay indicated that LSP1- / -CAR-M had a stronger killing effect on GBM tumor cells; Figure C shows that co-culture experiments showed that LSP1- / -CAR-M could not induce malignant mesenchymal phenotype transformation of GBM tumor cells under hypoxia; Figures D and E show that in vivo experiments in mice showed that LSP1- / -CAR-M combined with radiotherapy could significantly inhibit tumor proliferation and prolong the survival of mice; Figure F shows that LSP1- / -CAR-M treatment could promote the infiltration of CD4+ T cells and CD8+ T cells;

[0085] Figure 6The method is described as constructing CAR-M for the hypoxia-characteristic CD44 high-expressing macrophage subpopulation and knocking out LSP1 through gene editing technology. As a result, LSP1- / -CAR-M blocks the malignant mesenchymal phenotype transformation of glioma cells in the hypoxic tumor microenvironment and presents an immune activation state. Combined with radiotherapy, it has a strong effect in killing GBM tumor cells.

[0086] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. Application of LSP1 in chimeric antigen receptor macrophages for the treatment of glioma, characterized in that: The following steps are involved: S1. Through GBM single-cell sequencing data analysis and tumor tissue flow sorting, it was found that there is a group of macrophage subpopulations with hypoxia characteristics (CD44 high expression subpopulation) in GBM, which is closely related to the suppressive immune microenvironment of GBM and the malignant phenotype of GBM tumor cells; S2. Combined transcriptome sequencing of hypoxic macrophage cell lines and transcriptome sequencing analysis of macrophages with high CD44 expression in GBM, combined with the gene set associated with malignant mesenchymal phenotype macrophages (MES-MP), the protein lymphocyte-specific protein 1 (LSP1) was screened and found to be a potential molecule for macrophages to regulate the malignant biological progression of GBM; S3. Further screening by IVY-GAP data and TCGA data analysis showed that LSP1 was closely associated with hypoxia characteristics, GBM malignant mesenchymal phenotype, and suppressive immune cell infiltration; in addition, LSP1 expression was significantly upregulated in hypoxia-treated macrophages, and LSP1 played a potential key role in the regulation of macrophage immunosuppressive phenotype polarization and GBM malignant mesenchymal phenotype transformation; S4. In vitro cell experiments showed that knocking out LSP1 in macrophages could block the increase of macrophage immunosuppressive phenotype markers (CD274, CD163 and CD206) induced by hypoxia. In addition, knocking out LSP1 in macrophages could block the increase of malignant mesenchymal phenotype markers (YKL40, CD44) of glioma cells induced by co-culture of hypoxia-characteristic macrophages and glioma cells. Human monocytic cell line (THP1) cells were cultured in RPMI-1640 medium plus 10% FBS. THP1 cells were cultured and passaged in a saturated humidity incubator at 37°C and 5% CO2. THP1 cells were cultured in vitro with 100ng / ml PMA for 24 hours to induce macrophages. The qRT-PCR experimental steps are as follows: using the lysis solution in the RNA rapid extraction kit to treat macrophages, extracting total cell mRNA, reversely transcribing the extracted mRNA to obtain cDNA using a reverse transcription kit, using CD274, CD163 and CD206 specific primers to perform fluorescent real-time quantitative PCR amplification of the target gene, and using the 2-△△Ct relative quantitative method to analyze the gene expression and detect the expression level of mRNA; The experimental steps of Western blot were as follows: remove the supernatant of macrophages in different treatment groups, add RIPA protein lysis buffer to lyse the cells, and extract protein; quantify the protein concentration using the BCA kit, take 30-50 μg of protein and add it to 10% sodium dodecyl sulfate-polyacrylamide gel for electrophoresis and transfer it to the PVDF membrane; after blocking, incubate with primary antibodies (anti-YKL40, anti-CD44) at 4°C overnight, then incubate with specific secondary antibodies, and use enhanced chemiluminescence for color development and exposure; use Chemi-docXRS+ image analysis system to analyze protein absorbance to confirm that EGFRvIII CAR-M was successfully constructed; S5. Considering that the experiments in step S4 verified the dual role of LSP1 in mediating macrophage remodeling of the suppressive immune microenvironment and promoting the malignant mesenchymal phenotype transformation of GBM, we intend to block the formation of GBM immunosuppressive microenvironment and GBM malignant mesenchymal phenotype transformation through CAR-M therapy targeting EGFRvIII by knocking out LSP1 expression, thereby weakening GBM treatment tolerance; S6. CAR-M was constructed using piggyBac transposon technology, piggyBac transposon gene expression vector was transfected, EGFRvIII CAR-M was constructed, and the expression of EGFRvIII was verified by western blot; EGFRvIII-CAR was prepared using piggyBac transposon gene expression vector, containing CD8α signal peptide, scFv (single-chain variable region fragment) targeting EGFRvIII antigen, CD8α hinge and transmembrane domains, and CD3ζ endodomain; The specific transfection steps are as follows: THP1-induced macrophages are inoculated in a 6-well plate, and the cell plating density is controlled at about 70% confluence; piggyBac transposon vector and transposase vector are mixed at a mass ratio of 3:1, the DNA dosage is 2 μg / well, and Lipofectamine 3000 and DNA are diluted in serum-free culture medium respectively; DNA and transfection reagent are mixed, gently mixed, and incubated at room temperature for 10-15 minutes to form a transfection complex; the prepared transfection complex is gently added to the cell culture medium, and the cells are placed in a 37°C, 5% CO2 incubator for 6-8 hours; then replaced with fresh complete culture medium to remove the transfection reagent, and continued to culture at 37°C; 48 hours after transfection, the primary antibody anti-EGFRvIII is used for western blot, and the specific experimental steps are the same as S4 to determine the protein expression level of EGFRvIII; S7. LSP1- / -CAR-M was further constructed using crispr / cas9 technology, and CRISPR sg-LSP1 was used to selectively knock out LSP1 in EGFRvIIICAR-M. The expression of LSP1 was then detected by western blot to verify that LSP1- / -CAR-M was successfully constructed. Specific sgRNA-LSP1 design steps: Find the LSP1 gene on NCB, identify the exon region, use the CRISPOR online tool of Zhang Feng's laboratory, input the exon sequence, analyze the target sequence provided by the online tool, select the sequence with a high specificity score and a low off-target rate as the target sequence, and select the sgRNA-LSP1 sequence as AGGACGAGGGCTTTGGCGAC; The sgRNA-LSP1 sequence was designed with annealing primers and inserted into the plasmid vector. After constructing the expression vector, EGFRvIII CAR-M was transfected with Lipofectamine3000 (transfection steps were the same as S6). After culturing for 48 hours, the protein was extracted and the protein level of LSP1 was detected by western blot (Western blot steps were the same as S4). S8. The mRNA of LSP1- / -CAR-M and CAR-M was extracted, and the expression of macrophage immune phenotype markers was detected by qRT-PCR. The results showed that compared with CAR-M, the expression of immune activation molecules CD80 and CD86 in LSP1- / -CAR-M was significantly upregulated, while the expression of immune inhibition molecules CD206 and CD163 was decreased; therefore, LSP1- / -CAR-M has a stronger ability to activate the immune microenvironment response; S9. After LSP1- / -CAR-M and CAR-M were co-cultured with glioma cell lines expressing luciferase in a 96-well plate for 24 h, 25 μl of D-luciferin was added to each well by a live cell luciferase assay, and the fluorescence intensity was analyzed by a microplate reader. The results showed that compared with CAR-M, LSP1- / -CAR-M had a stronger tumor killing effect; therefore, LSP1- / -CAR-M had a stronger effect in inhibiting the activity of glioma cells; S10. LSP1- / -CAR-M and CAR-M were co-cultured with glioma cells in a hypoxic microenvironment for 48 h, and glioma cell mRNA was extracted. The expression of malignant mesenchymal phenotype markers (CD44) was detected by qPCR. The results showed that LSP1- / -CAR-M in a hypoxic microenvironment could not promote the malignant phenotype transformation of glioma; S11. The mouse GL261 cell line was inoculated into the skull of C57 mice to construct intracranial orthotopic tumor-bearing mice, and then the mouse LSP1- / -CAR-M and CAR-M were injected into the tumor, respectively, and radiotherapy was performed in parallel; the growth curve of the mouse tumor and the survival period of the mouse were monitored and compared by using bioluminescence technology; the brain tumor tissues of the mice were taken for flow cytometry sorting, and the infiltration of CD4+ and CD8+T cells in the brain tumor tissues of the two groups of mice were compared; the results showed that LSP1- / -CAR-M could significantly inhibit the proliferation of tumors and prolong the survival of mice; in addition, LSP1- / -CAR-M could promote the infiltration of CD4+T cells and CD8+T cells; therefore, in vivo experiments showed that LSP1- / -CAR-M had the effect of significantly inhibiting tumor proliferation and enhancing immune response, suggesting that it is a potential and effective immunotherapy for GBM; AW264.7 (mouse macrophage cell line) cells were cultured in DMEM plus 10% FBS medium and placed in a saturated humidity incubator at 37°C and 5% CO2 for culture and passage; the construction steps of mouse LSP1- / -CAR-M and CAR-M were the same as S6 and S7.

Images