A molecular marker for identifying duck body weight traits based on stard13 gene and an identification method and application thereof
By using SNP molecular markers based on the STARD13 gene, and employing PCR amplification and enzyme digestion to detect duck weight traits, the problem of early identification in meat duck breeding has been solved, enabling early selection and efficient breeding.
Patent Information
- Application Number
- CN202510265818.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-07
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2045-03-07
AI Technical Summary
In the current technology, conventional phenotypic breeding of meat ducks for weight traits is progressing slowly, making early identification difficult.
Using SNP molecular markers based on the STARD13 gene, PCR amplification and enzyme digestion were performed with specific amplification primers, followed by agarose gel electrophoresis to identify the weight trait of ducks.
It enables early, simple, rapid, and low-cost selection of duck weight traits, making it suitable for molecular marker-assisted breeding and improving breeding efficiency.
Smart Images

Figure CN120026118B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of molecular markers, and particularly relates to a molecular marker for identifying duck weight traits based on a STARD13 gene, and an identification method and application thereof. BACKGROUND
[0002] Weight is an important indicator for measuring the uniformity of poultry groups, and is also a key factor for determining feed consumption and affecting production costs. With the improvement of people's living standards, the demand for duck meat, eggs and other foods is also increasing, and consumers tend to buy products with larger weight and better meat quality. Therefore, increasing the weight of meat ducks helps to meet market demand and improve product competitiveness. Selecting poultry with excellent growth performance and body characteristics as a source. By continuously optimizing genetic combinations and breeding new varieties, the stable growth and performance improvement of meat duck weight can be achieved, thereby shortening the feeding cycle, reducing feeding costs and improving production efficiency.
[0003] RhoGAP protein STARD13 is an important regulator of pancreatic tissue structure in mammalian embryos, and STARD13 plays a role by regulating Rho signaling in space and time during pancreatic development [PETZOLD K M, NAUMANN H, SPAGNOLI F M. Rho signalling restriction by the RhoGAP Stard13 integrates growth and morphogenesis in the pancreas [J]. Development (Cambridge, England), 2013, 140(1): 126-35.]. As a GTPase-activating protein of RhoA, STARD13 may be involved in the regulation of cytoskeletal reorganization, cell proliferation and cell movement.
[0004] Petzold (PETZOLD K M, NAUMANN H, SPAGNOLI F M. Rho signalling restriction by the RhoGAP Stard13 integrates growth and morphogenesis in the pancreas[J]. Development (Cambridge, England), 2013, 140(1): 126-35.) and others found that STARD13 can play a role in the development of mammalian embryos, which may affect the birth weight of animals. Zhang (ZHANG Y, JIA C, LI S, et al. Comparative genome-wide association study on body weight in Chinese native ducks using four models[J]. Poultry science, 2024, 103(8): 103899.) and others used four models to conduct a genome-wide association study on the Jinlingbai duck population and found that STARD13 is an important candidate gene affecting the BW3 (3-week body weight) and BW5 (7-week body weight) of Jinlingbai ducks. Sun (SUN C, LU J, YI G, et al. Promising Loci and Genes for Yolk and Ovary Weight in Chickens Revealed by a Genome-Wide Association Study[J]. PloS one, 2015, 10(9): e0137145.) and others revealed through a genome-wide association study that STARD13 is an important gene affecting egg yolk and ovary weight, and determined that STARD13 has a reasonable function in yolk and follicle development. Current research on the STARD13 gene has mainly focused on chicken growth and development, and there have been relatively few studies on ducks. In-depth study of the relationship between STARD13 gene variation and expression and meat duck body weight can help reveal the key role of the gene in meat duck growth and development, and is expected to provide theoretical support for precise regulation of meat duck growth and development and provide a scientific basis for meat duck breeding.
[0005] “Qiangying duck” belongs to white meat duck, which is bred for 10 years independently, promotes the localization of meat duck breeds in China, and has fast early growth speed, high feed conversion rate and high survival rate. The commercial generation of “Qiangying duck” is marketed at 40 days of age, with an average body weight of 3.35 kg and an average feed conversion ratio of 1.89:1. Based on the above content, the present application provides a molecular marker for identifying duck body weight traits based on the STARD13 gene, an identification method and application thereof. SUMMARY
[0006] The application aims to provide a duck weight trait identification molecular marker based on STARD13 gene, and an identification method and application thereof.
[0007] The application achieves the above-mentioned purpose through the following technical solutions.
[0008] As a first aspect of the application, a duck weight trait identification molecular marker based on STARD13 gene is provided, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, wherein the base at the 532th position of the nucleotide sequence is C or T.
[0009] As a second aspect of the application, the application of the above-mentioned molecular marker in identifying duck weight traits is further provided.
[0010] As a further optimization scheme of the application, if the molecular marker type of the to-be-tested duck is CC type, the duck weight trait is better; if the molecular marker type of the to-be-tested duck is CT type, the duck weight trait is poorer.
[0011] As a third aspect of the application, a method for identifying duck weight traits by using the above-mentioned molecular marker is further provided, which comprises the following steps.
[0012] (1) Extracting total DNA of duck wing vein blood;
[0013] (2) Designing specific amplification primers with the sequence composed of the site where the molecular marker is located and the upstream and downstream bases thereof as a target sequence, using the total DNA as a template, performing PCR amplification by using the specific amplification primers, and obtaining an amplification product;
[0014] (3) Performing genotyping detection and sequencing on the amplification product, and obtaining the molecular marker type of the to-be-tested duck;
[0015] (4) Judging the duck weight trait according to the molecular marker type.
[0016] As a further optimization scheme of the application, the genotyping detection method is to obtain enzyme digestion products by enzyme digestion of the amplification product, to detect the enzyme digestion products by using agarose gel electrophoresis, to perform genotyping according to the image, and to determine the type as follows:
[0017] If the enzyme digestion products contain 1 band, it is CC type;
[0018] If the enzyme digestion products contain 3 bands, it is CT type.
[0019] As a further optimization of the present application, the amplified product is digested with HPY188I restriction enzyme.
[0020] The present application has the beneficial effect that the present application establishes a poultry weight rate early selection breeding method by identifying the type of the molecular marker present in the duck genome, and selecting the duck weight trait according to the genotype, which is simple, fast, low cost, does not require special instruments, and is suitable for the needs of molecular marker assisted breeding experiments. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 An agarose gel electrophoresis diagram of part of the sample PCR amplification product provided by the present application is shown in the following figure:
[0022] Figure 2 An agarose gel electrophoresis diagram of part of the sample PCR amplification product provided by the present application is shown in the following figure:
[0023] Figure 3 The genotype verification sequencing results of the C183627302T site (the 532th site in SEQ ID NO. 1) in the duck STARD13 gene provided by the present application are shown in the following figure: DETAILED DESCRIPTION
[0024] The following detailed description of the present application will be further described in conjunction with the accompanying drawings, it is necessary to point out here that the following detailed description is only used to further illustrate the present application, and cannot be understood as limiting the scope of protection of the present application, and those skilled in the art can make some non-essential improvements and adjustments to the present application according to the above application content.
[0025] 1. Materials
[0026] The methods used in this example are conventional methods known to those skilled in the art, and the reagents and other materials used are commercially available products, unless otherwise specified.
[0027] 2. Methods
[0028] 2.1 Primer design
[0029] The DNA partial sequence of the STARD13 gene shown as SEQ ID NO. 1 is found in the duck genome database, and the specific amplification primer is designed with the DNA partial sequence of the STARD13 gene (the sequence composed of the site and the upstream and downstream bases of the molecular marker) as the template, and the sequence information of the specific amplification primer is as follows:
[0030] SEQ ID NO. 2: Forward primer: AATAGCGATGATTAGCAGGG;
[0031] SEQ ID NO.3: Reverse primer: CTCAACGCACCATTTACAGA.
[0032] The amplifiable region of the primer pair is 477 bp in length, and the sequence is shown in SEQ ID NO.4. It contains a molecular marker of the T / C site mutation at the C183627302T site (site 532 in SEQ ID NO.1).
[0033] 2.2 Extraction of total DNA from blood
[0034] 420 Qiangying ducks were selected, and blood was collected from their wing veins. Total DNA was extracted from the blood. The total DNA was extracted from the duck wing vein blood samples using a blood DNA extraction kit produced by Tiangen Biotech Co., Ltd. The extraction steps were performed according to the kit instructions.
[0035] 2.3 PCR Amplification
[0036] Using Mix produced by Shanghai Yisheng Biotechnology Co., Ltd., PCR amplification of the target fragment of the STARD13 gene was performed using synthesized sequencing-specific primers. The PCR amplification system is shown in Table 1.
[0037] Table 1. PCR amplification system
[0038]
[0039] The PCR reaction conditions were as follows: 95℃ pre-denaturation for 5 min; first step denaturation at 95℃ for 45 s; second step annealing at 64.8℃ for 45 s (annealing temperature is set according to the primers); third step extension at 72℃ for 30 s. The second and third steps were repeated 31 times, for a total of 32 cycles; the extension at 72℃ was completed for 10 min.
[0040] 2.4 Detection and Sequencing of PCR Amplification Products
[0041] PCR amplification products were detected using 2% agarose gel electrophoresis, such as... Figure 1 As shown, after imaging with a gel imaging system, a band of approximately 477 bp in length was obtained, which is consistent with the predicted length, indicating that the target fragment was obtained. The PCR product was sent to Beijing Qingke Biotechnology Co., Ltd. (Nanjing), and the sequence is shown in SEQ ID NO.4, which is consistent with the predicted result.
[0042] 2.5 Genotyping
[0043] First, the enzyme cutting system as shown in Table 2 was configured, and the enzyme cutting condition was 37℃ water bath for 1 hour. The PCR amplification product was cut by HPY188I restriction endonuclease purchased from NEB (Beijing) Co., Ltd.
[0044] Table 2, enzyme cutting system
[0045]
[0046]
[0047] Subsequently, 1.5% mass ratio low voltage agarose gel electrophoresis detection was used to obtain the results (part of the results) as shown in Figure 2 ; wherein, if the enzyme cutting product contains 1 band, it is CC type; contains 3 bands, it is CT type.
[0048] 2.6, enzyme cutting sequencing verification
[0049] The gene enzyme cutting typing agarose gel electrophoresis chart was counted to obtain CC and CT two types, and one individual of each type was selected for sequencing alignment, and the sequencing alignment chart is as shown in Figure 3 . In the sequencing result, T mutates into C, and the mutation position is marked by an arrow, which is consistent with the enzyme cutting typing result.
[0050] 2.7, effect verification
[0051] In order to determine the association between T / C polymorphism of duck STARD13 gene C183627302T site and important phenotypic traits of duck, 420 Qiangying ducks in step 2.2 were used as test materials, and 1-day-old body weight (BW1), 21-day-old body weight (BW 21 ), 42-day-old body weight (BW 42 ), 21-day-old average daily gain (ADG 21 ) and 42-day-old average daily gain (ADG 42 ) of 1-42 day-old ducks were counted. The genotyping method shown in step 2.5 was used to genotype 420 Qiangying ducks, and the results are shown in Table 3.
[0052] Table 3, genotyping results of individuals with different phenotypes
[0053]
[0054] Experimental conclusion: the chi-square test result shows that the genotype of the test duck population is in Hardy-Weinberg equilibrium (P>0.05).
[0055] 2.8, statistical analysis
[0056] The correlation between the two genotypes and the body weight traits of the duck was analyzed by using the least square analysis method in SAS9.4 software, and the correlation analysis results between different genotypes and various traits are shown in Table 4.
[0057] Table 4, correlation analysis of duck STARD13 genotypes and duck body weight traits
[0058]
[0059] Note: The same row and different lowercase letters represent significant differences (P<0.05), and the same row and different capital letters represent extremely significant differences (P<0.01).
[0060] Experimental conclusion: As can be seen from Table 4, for the C183627302T site of the STARD13 gene, the 1-day-old body weight (BW1), 21-day-old body weight (BW21), and 21-day-old daily weight gain (ADG21) of the CC type individual are extremely significantly higher than those of the CT type individual (P<0.01), the 42-day-old body weight (BW42) of the CC type individual is significantly higher than that of the CT type individual (P<0.05), and there is no significant difference in the 42-day-old daily weight gain (ADG42) between the two genotypes, so it can be concluded that the body weight traits of the CC genotype individual are better, and the body weight traits of the CT genotype individual are worse. 21 21 42 42
[0061] The above-described embodiments only express several embodiments of the present application, and the description is more specific and detailed, but it should not be understood as limiting the scope of the patent of the present application. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are all within the protection scope of the present application.
Claims
1. A method for identifying a duck with a high body weight trait, comprising the steps of: STARD13 The application of the molecular marker for identifying the duck body weight trait based on the gene in identifying the strong duck body weight trait, characterized in that, The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein the base at position 532 of the nucleotide sequence is C or T; if the type of the molecular marker of the duck to be tested is CC, the duck has better body weight trait; if the type of the molecular marker of the duck to be tested is CT, the duck has poorer body weight trait.
2. A method for identifying the body weight trait of strong English duck by using molecular markers, characterized in that, The method comprises the following steps: (1) extracting total DNA of wing vein blood of Qiangying duck; (2) taking the sequence composed of the site of the molecular marker and the upstream and downstream bases thereof as a target sequence to design specific amplification primers, using the total DNA as a template to perform PCR amplification by using the specific amplification primers to obtain an amplification product, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein the base at position 532 of the nucleotide sequence is C or T; (3) performing genotyping detection and sequencing on the amplification product to obtain the type of the molecular marker of the Qiangying duck to be tested; (4) judging the body weight trait of the Qiangying duck according to the type of the molecular marker.
3. The method for identifying the body weight trait of duck by using molecular marker according to claim 2, characterized in that, The sequence of the specific amplification primer is as follows: SEQ ID NO. 2: Forward primer: AATAGCGATGATTAGCAGGG; SEQ ID NO. 3: Reverse primer: CTCAACGCACCATTTACAGA.
4. The method for identifying the body weight trait of duck by using molecular marker according to claim 2, characterized in that, The genotyping detection method is to obtain enzyme digestion products by using HPY188I restriction endonuclease to digest the amplification product, to detect the enzyme digestion products by using agarose gel electrophoresis, to perform genotyping according to the image, and to determine that the enzyme digestion products are: if 1 band is contained, the type is CC; if 3 bands are contained, the type is CT.
Citation Information
Patent Citations
Molecular marker for identifying duck feed utilization rate character based on ELOVL2 gene as well as identification method and application thereof
CN116574812A
Molecular marker for identifying duck feed utilization rate character based on ACSL6 gene as well as identification method and application thereof
CN118272519A