Multiple digital PCR (Polymerase Chain Reaction) detection kit for diagnosing intestinal dysbacteriosis of cirrhosis

Abstract

The invention discloses a multiple digital PCR (Polymerase Chain Reaction) detection kit for diagnosing intestinal dysbacteriosis of cirrhosis. The pathogens used for diagnosis by the kit comprise Soxhlet anaerobe, Escherichia, Brucella Romummii, Fecal coccus, fusiform bacillus and Eubacterium transmucus in the intestinal flora. By utilizing the kit, the liver cirrhosis can be diagnosed by detecting the specific strains in the in-vivo intestinal microflora, and a new thought is provided for diagnosis and treatment of the liver cirrhosis.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and in particular to a multiplex digital PCR detection kit for diagnosing enterobacterial imbalance in liver cirrhosis. Background Art

[0002] my country is a country with a high incidence of liver diseases. There are more than 200 million patients with liver fibrosis and cirrhosis caused by various causes. About 1 million people die from cirrhosis and liver cancer every year in the world, and my country accounts for 45% of the global total. At present, the clinical treatment of cirrhosis is limited. In the early and middle stages, conservative medical treatment is used. In the late stage, liver transplantation is considered the most reliable method. However, its widespread application is limited by the shortage of donors, high costs, many complications, and lifelong use of immunosuppressants. Therefore, finding new prevention and treatment methods has always been the focus of attention in the field of liver disease.

[0003] In recent years, more and more studies have shown that cirrhosis and its complications are closely related to the imbalance of intestinal flora.

[0004] Studies have found that cirrhosis causes intestinal barrier damage and flora displacement, leading to enterogenic endotoxemia, activating Toll-like receptor 4 (TLR4) / NF-κB and other signaling pathways to induce hepatocyte apoptosis, imbalance of immune cell ratio, and massive release of proinflammatory mediators, causing multiple blows to the liver and further aggravating intrahepatic inflammation and fibrosis, greatly increasing the incidence of liver cancer. At the same time, endotoxin (LPS) can affect the secretory function of hepatocytes, adenosine triphosphate (ATP) enzyme activity, and mitochondrial energy synthesis, thereby affecting bile secretion. The reduction of bile entering the small intestine will affect the structure of the intestinal flora and increase the metabolic load of the liver. Adjusting the intestinal flora may be a new direction for the treatment of such diseases. Therefore, it is of great significance to establish an accurate and rapid intestinal flora detection system and method.

[0005] In the existing intestinal flora detection, the specimens collected are basically fresh fecal samples. The research methods of intestinal flora mainly include traditional methods and molecular biology methods. Traditional culture method and microscopic method are early methods for intestinal flora research. Among them, laboratory culture of bacteria is time-consuming, and there are many types of intestinal flora, which are difficult to culture quickly and efficiently in the laboratory, which increases the difficulty of detection. Molecular biology technology is an important method for studying human intestinal flora to detect bacterial genomic DNA in feces. Digital PCR (Digital PCR, dPCR) can achieve absolute counting of target molecules, and has the characteristics of strong specificity, high sensitivity, absolute quantification and good accuracy. Summary of the invention

[0006] One aspect of the present invention is to provide a primer and probe combination for multiplex digital PCR.

[0007] The primer and probe combination provided by the present invention includes: primers shown in the sequences SEQ ID NO.: 1-2, SEQ ID NO.: 4-5, SEQ ID NO.: 7-8, SEQ ID NO.: 10-11, SEQ ID NO.: 13-14, and SEQ ID NO.: 16-17 in the sequence list; and probes shown in the sequences SEQ ID NO.: 3, SEQ ID NO.: 6, SEQ ID NO.: 8, SEQ ID NO.: 12, SEQ ID NO.: 15, and SEQ ID NO.: 16 in the sequence list.

[0008] In one embodiment, the fluorescent group of the probe is selected from at least one of FAM, VIC, ROX, CY5, A425, Cy5.5, and Cy7.

[0009] In one embodiment, the primer and probe combination is used to detect Anaerobic Sordellii, Escherichia, Rombutzia, Coprococcus, Fusobacterium, and Eubacterium vicifolium in intestinal flora.

[0010] In one embodiment, the primer and probe combination is used to determine the relative abundance of Anaerobic Sordellii, Escherichia, Rombutzia, Coprococcus, Fusobacterium, and Eubacterium vicifolium in the intestinal flora.

[0011] Another aspect of the present invention is to provide a method for detecting a specific strain in intestinal flora.

[0012] The method provided by the present invention comprises: Extraction of bacterial genomic DNA from stool samples; Using the primer and probe combination, multiplex digital PCR is performed using the bacterial genomic DNA as a template; The concentration of genomic DNA of the specific strain in the stool sample is determined.

[0013] In one embodiment, the specific strains are Anaerobic Sordellii, Escherichia, Rombutzia, Coprococcus, Fusobacterium, and Eubacterium muciniphilum.

[0014] Another aspect of the present invention is to provide a multiplex digital PCR kit for diagnosing liver cirrhosis.

[0015] The multiplex digital PCR kit provided by the present invention comprises the primer and probe combination.

[0016] In one embodiment, the multiplex digital PCR kit further comprises a detection reagent and a nucleic acid extraction reagent.

[0017] One aspect of the present invention is to provide a biomarker for diagnosing liver cirrhosis.

[0018] The biomarkers provided by the present invention are anaerobic bacteria of the intestinal flora, Escherichia, Rombutsiella, Coprococcus, Fusobacterium and Eubacterium spp.

[0019] In one embodiment, the biomarker is the relative abundance of Anaerobic Sordellii, Escherichia, Rombutzia, Coprococcus, Fusobacterium, and Eubacterium mucosum in the intestinal flora.

[0020] The kit provided by the present invention can be used to diagnose liver cirrhosis by detecting specific strains in the intestinal flora, providing a new idea for its diagnosis and treatment. For biomarkers, the present invention provides a primer and probe combination for multiplex digital PCR and a multiplex digital PCR kit, thereby achieving rapid, accurate, highly sensitive and highly specific detection of specific strains in the intestinal flora. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Venn diagram of microbial diversity analysis is shown; Figure 2 The Alpha diversity results of microbial diversity analysis are shown; Observed represents the intuitive statistics of OTUs (operational taxonomic units); Chao1 represents the estimated number of all species in a sample or environment; ACE represents the estimated number of all species in a sample or environment; Shannon index is positively correlated with diversity; Good's coverage represents the number of OTUs with an abundance of 1; Coverage refers to the coverage of each sample library. The higher the value, the lower the probability that the sequence in the sample has not been detected. Figure 3 Beta diversity results of microbial diversity analysis are shown; Figure 4 Shown are the results of LEfSe analysis of microbial composition. DETAILED DESCRIPTION

[0022] The present invention found through intestinal fecal genome sequencing of healthy people and patients with cirrhosis that the intestinal flora of patients with cirrhosis is significantly unbalanced. Therefore, it is of great significance to use intestinal flora to diagnose and treat cirrhosis. On the one hand, the characteristics of intestinal flora can be used as biomarkers for the progression and prognosis of cirrhosis; on the other hand, by regulating the balance of intestinal flora, it can provide new ideas and methods for the diagnosis and treatment of cirrhosis.

[0023] The present invention identifies the characteristic bacteria associated with liver cirrhosis: Anaerobic Sordellii, Escherichia, Rombutzia, Coprococcus, Fusobacterium, and Eubacterium. After analysis, the relative abundance of Anaerobic Sordellii, Escherichia, Rombutzia, Coprococcus, Fusobacterium, and Eubacterium in the intestinal flora of patients with liver cirrhosis decreased significantly.

[0024] In order to detect Anaerobic Sordellii, Escherichia, Rombutziac, Coprococcus, Fusobacterium, and Eubacterium in intestinal flora, the present invention provides a primer and probe combination for multiplex digital PCR. The primer and probe combination includes: primers shown in SEQ ID NO.: 1-2 and probe shown in SEQ ID NO.: 3 for detecting Anaerobic Sordellii; primers shown in SEQ ID NO.: 4-5 and probe shown in SEQ ID NO.: 6 for detecting Escherichia; primers shown in SEQ ID NO.: 7-8 and probe shown in SEQ ID NO.: 9 for detecting Rombutziac; primers shown in SEQ ID NO.: 10-11 and probe shown in SEQ ID NO.: 12 for detecting Coprococcus; primers shown in SEQ ID NO.: 13-14 and probe shown in SEQ ID NO.: 15 for detecting Fusobacterium; primers shown in SEQ ID NO.: 16-17 and probe shown in SEQ ID NO.: 18 for detecting Eubacterium.

[0025] In order to make the technical solution of the present invention clearer, the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments. The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is explained in detail below in conjunction with examples:

[0026] Inclusion criteria for liver cirrhosis: (1) Histology consistent with the diagnosis of liver cirrhosis; (2) Endoscopy showed esophageal and gastric varices or ectopic varices in the digestive tract, excluding non-cirrhotic portal hypertension; (3) Imaging examinations such as ultrasound, liver stiffness measurement (LSM) or CT suggest features of cirrhosis or portal hypertension, such as splenomegaly and portal vein ≥1.3 cm, and LSM meets the diagnostic cutoffs for cirrhosis of different etiologies; (4) For patients without histological, endoscopic or imaging examinations, abnormalities in the following examination indicators indicate the presence of liver cirrhosis (must meet 2 of the 4 items). ①PLT < 100 × 10 9 / L, and there is no other explanation; ② serum albumin <35 g / L, excluding other causes such as malnutrition or kidney disease; ③ INR>1.3 or PT prolonged (discontinuation of thrombolytic or anticoagulant drugs for more than 7 days); ④ adult AST / PLT ratio index (APRI) score>2. Attention should be paid to the impact of enzyme-lowering drugs and other factors on APRI.

[0027] (5) On the basis of liver cirrhosis, complications of portal hypertension and / or decreased liver function occur. Complications related to portal hypertension include ascites, esophageal and gastric varicose vein bleeding, sepsis, hepatic encephalopathy, hepatorenal syndrome, etc.

[0028] Subject exclusion criteria: 1) Patients with severe heart, lung, and kidney dysfunction; 2) Patients with severe hypertension and cerebrovascular accident; 3) Patients with liver cancer and active infection; 4) Patients with intellectual, language, and mental disorders; 4) Patients with pre- or post-hepatic causes of portal hypertension.

[0029] Sample collection, storage and processing: Select patients with cirrhosis and healthy people, and make sure they understand the content of the experiment and sign the informed consent. Ask the subjects to excrete feces into a clean container to avoid contamination by urine, toilet walls, etc. Collect fresh feces (collect feces in the middle and rear part of the excretion), and try to dig out feces on the inner side of the middle as a sample. Use a sterile spoon to scoop about 1g of fecal sample and put it in a sterile preservation tube. The collected samples should be immediately placed in a -80℃ refrigerator for low-temperature storage. During the freezing of the samples, do not freeze and thaw repeatedly. When sending samples, low temperature conditions must be ensured during transportation. Mix the fecal bacterial extract with glycerol in a volume ratio of 3:1, freeze it quickly with liquid nitrogen, and then store it in a -80℃ refrigerator.

[0030] 16S rRNA gene sequencing and processing DNA extraction and quality control: OMEGA Soil DNA Kit (M5635-02) was used to efficiently extract bacterial genomic DNA from stool samples. Agarose gel electrophoresis was used to verify the integrity and purity of the DNA, and Nanodrop 2000 was used to detect the quality of the genomic DNA.

[0031] PCR amplification and purification: For qualified sample detection areas, high-fidelity PCR amplification was performed, and 3 replicates were set up. Standard bacterial / fungal genomic DNA Mix was used as a positive control. Amplification primers were determined according to the selected detection area. The primer information for this project is as follows: Destination area: 16S V3V4 Primer F=Illumina adapter sequence 1+ ACTCCTACGGGAGGCAGCA Primer R=Illumina adapter sequence 2+ GGACTACHVGGGTWTCTAAT Ilumina adapter sequence 1= AATGATACGGCGACCACCGAGATCTACACXXXXXXXXTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG Illumina adapter sequence 2= CTGTCTCTTATACACATCTCCGAGCCCACGAGACXXXXXXXXATCTCGTATGCCGTCTTCTGCTTG Among them, XXXXXXXX is the label sequence of the identification sample.

[0032] Agarose gel electrophoresis was used to detect whether the amplified product was single and specific: three parallel amplified products of the same sample were mixed, and an equal volume of Agencourt AMpure XP nucleic acid purification magnetic beads was added to each sample to purify the product.

[0033] Adding specific tag sequences: Use primers with index sequences to introduce specific tag sequences to the end of the library through high-fidelity PCR. This allows multiple samples to be mixed during downstream sequencing, and subsequent bioinformatics processing can distinguish samples with different tag sequences. After amplification, the product is detected by agarose gel electrophoresis, and the amplified product is purified using nucleic acid purification magnetic beads to obtain the original library of a sample.

[0034] Library quality detection and Illumina sequencing: The mixed library was tested for the size of the insert fragment of the sequencing library by Agilent 2100 Bioanalyzer to confirm that there was no non-specific amplification between 120-200 bp, and the concentration of the sequencing library was accurately quantified. The library was sequenced using the NovaSeq 6000 platform and the SP-Xp (PE250) double-end sequencing strategy, and bioinformatics analysis was performed to obtain results such as diversity and composition analysis.

[0035] Baseline characteristics of the study population: Table 1 Biochemical indicators of patients with liver cirrhosis and healthy subjects

[0036] Correlation analysis between liver cirrhosis and intestinal microorganisms Microbial diversity analysis: The subjects' stool samples were deeply analyzed by 16S rRNA gene sequencing.

[0037] (1) OTU-based Venn diagram: The Venn diagram reflects the overlap between OTUs in healthy controls and patients with cirrhosis. Figure 1 As shown, the OTU of healthy people was 2400, the OTU of patients with cirrhosis was 1148, and the total OTU was 524, indicating that the relative abundance of specific bacterial flora in the feces of patients with cirrhosis decreased.

[0038] (2) Alpha Diversity: Figure 2 The figure shows six diversity indices for each group of samples. The horizontal axis represents different groups, and the vertical axis represents the diversity index value of the sample community in the group. Different groups are distinguished by different colors. The results show that there are significant differences in the richness and diversity of intestinal microorganisms between the healthy control group and the cirrhosis group.

[0039] (3) Beta diversity: Figure 3 As shown in the figure, both PCoA analysis and Unifra-based UPGMA method showed that there were differences in the intestinal flora structure between cirrhotic and healthy people (PC1 contribution was 15.22%, PC3 contribution was 7.57%).

[0040] Microbial composition analysis: The signature bacteria associated with liver cirrhosis were identified by LEfSe (Linear discriminant analysis effect size). Figure 4 As shown, the levels of Anaerobic Sordellii, Escherichia, Rombutzia, Coprococcus, Fusobacterium, and Eubacterium mucosum were significantly decreased in patients with cirrhosis.

[0041] Based on the 16S rRNA genes of Anaerobic Bacteria, Escherichia, Rombutzia, Coprococcus, Fusobacterium, and Eubacterium, primerEXpress3.0 was used to design specific primers and probes for the corresponding sites. The specific sequence information is as follows: Table 2. Primers and probes

[0042] The system was verified using the artificially synthesized plasmid of the detection marker sequence in Example 1 as a template. Amplification was performed using the multiplex digital PCR system and amplification program in Table 3 below.

[0043] Table 3

[0044] Note: F is the forward primer, R is the reverse primer, P is the probe, the numbers represent the primer numbers, and IC is the internal reference.

[0045] The test results are shown in Table 4 below (test value unit: copy number / μl).

[0046] Table 4

[0047] The test results show that the multiplex digital PCR system can be used to detect whether a sample contains Anaerobic Bacillus, Escherichia, Rombutsiella, Coprococcus, Fusobacterium, and Eubacterium mucosum at the same time.

[0048] Specificity test Other common pathogens were used for specificity: Cryptococcus, Staphylococcus aureus, Candida albicans, etc. The commercially available Tiangen DP710 kit was used to extract DNA according to the instructions. Using the primers and probes in Table 2, multiple digital PCR reactions were performed with the extracted DNA of the sample to be tested, the positive control, and the negative control, respectively. The PCR reaction system is shown in Table 5 below.

[0049] Table 5

[0050] The PCR reaction conditions are: 95°C for 5 minutes of pre-denaturation, 95°C for 15 seconds → 60°C for 30 seconds, for a total of 45 cycles. After the reaction program is completed, the droplet chip passes through the supporting equipment for signal interpretation.

[0051] The specificity test results are shown in Table 6.

[0052] Table 6

[0053] The results showed that the primers and probes in Table 3 had no cross-reaction and good specificity when used to detect the above pathogens.

[0054] Sensitivity test The artificially synthesized plasmid of the detection marker sequence in Example 1 was used as a template, the final concentration of the template was set to 20 copies / mL, and the multiplex digital PCR system and amplification program in Table 3 were used for amplification.

[0055] The test results are shown in Table 7 , and the sensitivity of the multiplex digital PCR kit for diagnosing liver cirrhosis reached 20 copies / mL.

[0056] Table 7

[0057] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A primer and probe combination for multiplex digital PCR, comprising: Primers shown in the sequence SEQ ID NO.: 1-2, SEQ ID NO.: 4-5, SEQ ID NO.: 7-8, SEQ ID NO.: 10-11, SEQ ID NO.: 13-14, and SEQ ID NO.: 16-17 in the sequence listing; The probes shown in the sequence listing are SEQ ID NO.:3, SEQ ID NO.:6, SEQ ID NO.:8, SEQ ID NO.:12, SEQ ID NO.:15, and SEQ ID NO.:

16.

2. The primer and probe combination according to claim 1, characterized in that: The fluorescent group of the probe is selected from at least one of FAM, VIC, ROX, CY5, A425, Cy5.5, and Cy7.

3. The primer and probe combination according to claim 1 or 2, characterized in that: The primer and probe combination is used to detect Anaerobic Sordellii, Escherichia, Rombutzia, Coprococcus, Fusobacterium and Eubacterium mucosum in intestinal flora.

4. The primer and probe combination according to claim 1 or 2, characterized in that: The primer and probe combination is used to determine the relative abundance of Anaerobic Sordellii, Escherichia, Rombutzia, Coprococcus, Fusobacterium, and Eubacterium mucosum in the intestinal flora.

5. A method for detecting a specific strain in intestinal flora, comprising: Extraction of bacterial genomic DNA from stool samples; Using the primer and probe combination described in any one of claims 1 to 4, multiplex digital PCR is performed using the bacterial genomic DNA as a template; The concentration of genomic DNA of the specific strain in the stool sample is determined.

6. The method according to claim 5, characterized in that The specific strains are Anaerobic Sordellii, Escherichia, Rombutzia, Coprococcus, Fusobacterium and Eubacterium vicifolium.

7. A multiplex digital PCR kit for diagnosing liver cirrhosis, characterized in that: The multiplex digital PCR kit comprises the primer and probe combination of claim 1 or 2.

8. The multiplex digital PCR kit according to claim 7, characterized in that: The multiplex digital PCR kit also includes a detection reagent and a nucleic acid extraction reagent.

9. A biomarker for diagnosing liver cirrhosis, characterized in that: The biomarkers are anaerobic Sordellii, Escherichia, Rombutsiella, Coprococcus, Fusobacterium and Eubacterium mucosum in the intestinal flora.

10. The biomarker according to claim 9, characterized in that The biomarkers are the relative abundance of Anaerobic Bacteria, Escherichia, Rombacillus, Coprococcus, Fusobacterium and Eubacterium in the intestinal flora.

Images