A multiple digital PCR detection kit for diagnosing intestinal flora disorder of liver cirrhosis

Abstract

The application discloses a multiple digital PCR detection kit for diagnosing liver cirrhosis intestinal flora disorder. The kit is used for diagnosing pathogens including Soehngenella, Escherichia, Romboutsia, Clostridium, Fusobacterium and Mucispirillum in intestinal flora. By using the kit, specific strains in intestinal microflora in vivo can be detected to diagnose liver cirrhosis, thereby providing a new idea for diagnosis and treatment of liver cirrhosis.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological detection, in particular to a multiple digital PCR detection kit for diagnosing liver cirrhosis intestinal flora imbalance. BACKGROUND

[0002] China is a big country of liver disease, and the patients with liver fibrosis and cirrhosis caused by various causes are as high as more than 200 million. About 1 million people die of liver cirrhosis and liver cancer every year in the world, and China accounts for 45% of the total. At present, the clinical treatment of liver cirrhosis is limited, and the early and middle stage is treated by conservative treatment. Liver transplantation is considered to be the most reliable method in the late stage, but due to the shortage of donors, high cost, many complications and lifelong use of immunosuppressants, its wide application is limited. Therefore, finding new prevention and treatment methods has been the focus of attention in the field of liver disease.

[0003] In recent years, more and more studies have shown that liver cirrhosis and its complications are closely related to intestinal flora imbalance.

[0004] Studies have found that liver cirrhosis causes intestinal barrier damage and flora shift, leading to enterogenous endotoxemia, activation of Toll-like receptor 4 (TLR4) / NF-κB signaling pathway, induction of liver cell apoptosis, imbalance of immune cells, and massive release of pro-inflammatory mediators, causing multiple attacks on the liver and further aggravating intrahepatic inflammation and fibrosis, greatly increasing the incidence of liver cancer. At the same time, endotoxin (LPS) can affect the secretion function of hepatocytes and the activity of adenosine triphosphate (ATP) and mitochondria energy synthesis, and affect bile excretion. The decrease of bile entering the small intestine will affect the intestinal flora structure and further increase the metabolic load of the liver. Adjusting the intestinal flora may be a new direction for the treatment of such diseases. Therefore, it is of great significance to establish an accurate and rapid detection system and method for intestinal flora.

[0005] In the existing intestinal flora detection, the collection of specimens is basically fresh fecal samples. The research methods of intestinal flora mainly include traditional method and molecular biology method. The culture method and mirror method of traditional method are early intestinal flora research methods. Among them, the laboratory culture of bacteria is time-consuming, and the types of intestinal flora are various, which is difficult to culture quickly and efficiently in the laboratory, increasing the difficulty of detection. Molecular biology technology detects bacterial genomic DNA in feces, which is an important method for current research on human intestinal flora. Digital PCR (Digital PCR, dPCR) can realize the absolute counting of target molecules, and has the characteristics of strong specificity, high sensitivity, absolute quantification and good accuracy. SUMMARY

[0006] One aspect of the present application is to provide a primer and probe combination for multiple digital PCR.

[0007] The primer and probe combination provided by the present application comprises: the primer shown in the sequence of SEQ ID NO. 1-2, SEQ ID NO. 4-5, SEQ ID NO. 7-8, SEQ ID NO. 10-11, SEQ ID NO. 13-14, SEQ ID NO. 16-17 in the sequence listing; the probe shown in the sequence of SEQ ID NO. 3, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 12, SEQ ID NO. 15, SEQ ID NO. 16 in the sequence listing.

[0008] In one embodiment, the fluorescent group of the probe is at least one selected from FAM, VIC, ROX, CY5, A425, Cy5.5, Cy7.

[0009] In one embodiment, the primer and probe combination is used for detecting Soehngenella, Escherichia, Romboutsia, Coprococcus, Fusococcus and Mucilaginibacter in the intestinal flora.

[0010] In one embodiment, the primer and probe combination is used for determining the relative abundance of Soehngenella, Escherichia, Romboutsia, Coprococcus, Fusococcus and Mucilaginibacter in the intestinal flora.

[0011] Another aspect of the present application is to provide a method for detecting specific strains in the intestinal flora.

[0012] The method provided by the present application comprises:

[0013] extracting bacterial genomic DNA from a fecal sample;

[0014] using the primer and probe combination to perform multiplex digital PCR with the bacterial genomic DNA as a template;

[0015] determining the concentration of the genomic DNA of the specific strain in the fecal sample.

[0016] In one embodiment, the specific strain is Soehngenella, Escherichia, Romboutsia, Coprococcus, Fusococcus and Mucilaginibacter.

[0017] Another aspect of the present application is to provide a multiplex digital PCR kit for diagnosing liver cirrhosis.

[0018] The multiplex digital PCR kit provided by the present application comprises the primer and probe combination.

[0019] In one embodiment, the multiplex digital PCR kit further comprises detection reagents, nucleic acid extraction reagents.

[0020] One aspect of the present application is to provide a biomarker for diagnosing liver cirrhosis.

[0021] The biomarker provided by the present application is Sohnia, Escherichia, Romboutsia, Coprococcus, Fusococcus, and Myxococcus in intestinal flora.

[0022] In one embodiment, the biomarker is the relative abundance of Sohnia, Escherichia, Romboutsia, Coprococcus, Fusococcus, and Myxococcus in intestinal flora.

[0023] The kit provided by the present application can be used to diagnose liver cirrhosis by detecting specific strains in intestinal flora, providing a new idea for diagnosis and treatment. In order to the biomarker, the present application provides a primer and probe combination for multiplex digital PCR and a multiplex digital PCR kit, thereby realizing rapid, accurate, high-sensitivity, and high-specificity detection of specific strains in intestinal flora. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 A Venn diagram showing microbial diversity analysis is shown;

[0025] Figure 2 Alpha diversity results of microbial diversity analysis are shown; Observed represents the intuitive statistics of OTUs (operational taxonomic units); Chao1 represents the estimated number of all species in a sample or environment; ACE represents the estimated number of all species in a sample or environment; Shannon index is positively correlated with diversity; Good's coverage represents the number of OTUs with an abundance of 1; Coverage represents the coverage rate of each sample library, and the higher the value, the lower the probability that sequences in the sample are not detected;

[0026] Figure 3 Beta diversity results of microbial diversity analysis are shown;

[0027] Figure 4 The results of microbial composition LEfSe analysis are shown. DETAILED DESCRIPTION

[0028] The present application finds, through sequencing of intestinal fecal genomes of healthy people and liver cirrhosis patients, that the intestinal flora of liver cirrhosis patients is significantly imbalanced. Therefore, it is of great significance to use intestinal flora to diagnose and treat liver cirrhosis. On the one hand, the characteristics of intestinal flora can be used as a biomarker for the progression and prognosis of liver cirrhosis; on the other hand, by adjusting the balance of intestinal flora, new ideas and methods can be provided for the diagnosis and treatment of liver cirrhosis.

[0029] This invention identified marker bacteria associated with cirrhosis: Solomon's seal bacteria, *Escherichia coli*, *Romebutzella*, *Factococcus*, *Fusobacterium*, and *Mycobacterium*. Analysis showed that the relative abundance of Solomon's seal bacteria, *Escherichia coli*, *Romebutzella*, *Factococcus*, *Fusobacterium*, and *Mycobacterium* was significantly decreased in the gut microbiota of patients with cirrhosis.

[0030] To detect Solomonella, Escherichia spp., Rombutzella, Factococcus spp., Fusobacterium spp., and Myxobacterium spp. in the intestinal flora, this invention provides a primer and probe combination for multiplex digital PCR. The primer and probe combination includes: primers shown in SEQ ID NO.:1-2 and probe shown in SEQ ID NO.:3 for detecting Solomonella; primers shown in SEQ ID NO.:4-5 and probe shown in SEQ ID NO.:6 for detecting Escherichia spp.; primers shown in SEQ ID NO.:7-8 and probe shown in SEQ ID NO.:9 for detecting Rombutzella; primers shown in SEQ ID NO.:10-11 and probe shown in SEQ ID NO.:12 for detecting Factococcus spp.; primers shown in SEQ ID NO.:13-14 and probe shown in SEQ ID NO.:15 for detecting Fusobacterium spp.; and primers shown in SEQ ID NO.:16-17 and probe shown in SEQ ID NO.:18 for detecting Myxobacterium spp.

[0031] To make the technical solution of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. The test materials used in this invention are all common commercially available products, and are readily available in the market. The invention will be further illustrated below with examples:

[0032] Inclusion criteria for cirrhosis:

[0033] (1) Histological findings are consistent with the diagnosis of cirrhosis;

[0034] (2) Endoscopic findings show esophageal and gastric varices or ectopic varices in the digestive tract, excluding non-cirrhotic portal hypertension;

[0035] (3) Imaging examinations such as ultrasound, liver stiffness measurement (LSM) or CT show characteristics of cirrhosis or portal hypertension, such as splenomegaly, portal vein ≥1.3cm, and LSM meets the diagnostic threshold for cirrhosis of different etiologies.

[0036] (4) For those without histological, endoscopic, or imaging examinations, abnormalities in the following indicators suggest the presence of cirrhosis (must meet 2 out of 4 criteria). ① PLT < 100 × 109 / L, and no other cause can be explained; ② serum albumin < 35 g / L, excluding malnutrition or kidney disease and other causes; ③ INR > 1.3 or PT prolongation (discontinue thrombolytic or anticoagulant drugs for more than 7 days); ④ adult AST / PLT ratio index (APRI) score > 2. Note the influence of factors such as enzyme-reducing drugs on APRI.

[0037] (5) On the basis of cirrhosis, portal hypertension complications and / or liver function decline. Portal hypertension-related complications, such as ascites, esophageal varices rupture and bleeding, sepsis, hepatic encephalopathy, hepatorenal syndrome, etc.

[0038] Exclusion criteria for subjects:

[0039] 1) Patients with severe heart, lung, and kidney dysfunction; 2) Patients with severe hypertension and cerebrovascular accidents; 3) Patients with liver cancer and active infection; 4) Patients with mental and language disorders; 4) Patients with prehepatic or posthepatic portal hypertension.

[0040] Collection, preservation and processing of samples:

[0041] Select cirrhosis patients and healthy people, and ensure that they understand the experiment and sign the informed consent form. Let the subjects excrete feces into a clean container, avoiding contamination by urine, toilet walls, etc. Collect fresh feces (collect the middle part of the excretion), and try to dig the middle part of the feces as a sample. Use a sterile spoon to dig about 1g of fecal sample and put it into a sterile storage tube. The collected sample should be immediately placed in a -80℃ freezer for low-temperature storage. Do not freeze-thaw repeatedly during sample freezing. Ensure low-temperature conditions during transportation when sending samples. Mix the fecal bacterial extract with glycerol at a ratio of 3:1 by volume, freeze with liquid nitrogen, and then store in a -80℃ freezer.

[0042] 16S rRNA gene sequencing and processing

[0043] DNA extraction and quality control: Use OMEGA Soil DNA kit (M5635-02) to efficiently extract bacterial genomic DNA from fecal samples. Verify the integrity and purity of the DNA by agarose gel electrophoresis, and detect the quality of the genomic DNA by Nanodrop 2000.

[0044] PCR amplification and purification: For qualified sample detection area, perform high-fidelity PCR amplification, set up 3 repeated experiments, and use standard bacterial / fungal genomic DNA Mix as positive control. Amplification primers are determined according to the selected detection area, and the primer information for this project is as follows:

[0045] Target region: 16S V3V4

[0046] Primer F = Illumina adapter sequence 1 + ACTCCTACGGGAGGCAGCA

[0047] Primer R = Illumina adapter sequence 2 + GGACTACHVGGGTWTCTAAT

[0048] Illumina adapter sequence 1 =

[0049] AATGATACGGCGACCACCGAGATCTACACXXXXXXXXTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

[0050] Illumina adapter sequence 2 =

[0051] CTGTCTCTTATACACATCTCCGAGCCCACGAGACXXXXXXXXATCTCGTATGCCGTCTTCTGCTTG

[0052] wherein, XXXXXXXX is a tag sequence for identifying the sample.

[0053] Agarose gel electrophoresis to detect whether the amplification product is single and specific: mix 3 parallel amplification products of the same sample, add equal volume of Agencourt AMpure XP nucleic acid purification magnetic beads to the product for purification.

[0054] Adding specific tag sequence: using primers with index sequence, introducing specific tag sequence to the end of the library by high-fidelity PCR. So that multiple samples can be mixed when sequencing downstream, and subsequent bioinformatics processing can distinguish samples with different tag sequences. After amplification, the product is detected by agarose gel electrophoresis, and nucleic acid purification magnetic beads are used to purify the amplification product to obtain the original library of a sample.

[0055] Library quality detection and Illumina sequencing: the mixed library is detected by Agilent 2100 Bioanalyzer to detect the size of the sequencing library insert, confirm that there is no non-specific amplification between 120-200 bp, and accurately quantify the sequencing library concentration. Adopt NovaSeq 6000 platform, SP-Xp (PE250) double-end sequencing strategy to sequence the library, and subsequent bioinformatics analysis to obtain diversity and composition analysis results.

[0056] Baseline characteristics of the study population:

[0057] Table 1 Biochemical indicators of cirrhotic patients and healthy people

[0058]

[0059] Analysis of correlation between cirrhosis and intestinal microorganisms

[0060] Microbial diversity analysis:

[0061] The fecal samples of the subjects were analyzed in depth by 16S rRNA gene sequencing.

[0062] (1) OTU-based Venn diagram: The Venn diagram reflects the overlap between the OTUs of healthy controls and cirrhotic patients. As shown in Figure 1 , the number of OTUs of healthy people is 2400, the number of OTUs of cirrhotic patients is 1148, and the number of common OTUs is 524, indicating that the relative abundance of specific flora in the feces of cirrhotic patients is decreased.

[0063] (2) Alpha diversity: Figure 2 The figure shows the 6 diversity indices of each group of samples. The horizontal axis represents different groups, and the vertical axis represents the community diversity index value of the sample group. Different groups are distinguished by different colors. The results show that there is a significant difference in the richness and diversity of intestinal microorganisms between the healthy control group and the cirrhotic group.

[0064] (3) Beta diversity: As shown in Figure 3 , PCoA analysis and Unifra-based UPGMA method both show that there is a difference in intestinal flora structure between cirrhotic and healthy people (PC1 contribution is 15.22%, and PC3 contribution is 7.57%).

[0065] Microbial composition analysis:

[0066] The LEfSe (Linear discriminant analysis effect size) analysis identified the marker bacteria associated with cirrhosis. The results are shown in Figure 4 , the content of Anaerotruncus colihominis, Escherichia, Romboutsia, Coprococcus, Fusobacterium, and Mucispirillum in cirrhotic patients decreased significantly.

[0067] According to the 16S rRNA gene of Anaerotruncus colihominis, Escherichia, Romboutsia, Coprococcus, Fusobacterium, and Mucispirillum, the specific primers and probes for the corresponding sites were designed by primerEXpress3.0. The specific sequence information is as follows:

[0068] Table 2. Primers and probes

[0069]

[0070] The plasmid synthesized artificially by detecting the marker sequence in Example 1 was used as a template for system verification. The multiplex digital PCR system and amplification program in Table 3 below were used for amplification.

[0071] Table 3

[0072]

[0073] Note: F is a forward primer, R is a reverse primer, P is a probe, and the number represents the primer number, and IC is an internal reference.

[0074] The detection results are shown in Table 4 below (detection value unit: copy number / μl).

[0075] Table 4

[0076]

[0077] The detection results show that the above-mentioned multiplex digital PCR system can be used to detect whether a sample contains S. sohii, E. coli, Romboutsia, Coprococcus, Fusobacterium, and Myxococcus.

[0078] Specificity test

[0079] Other common pathogenic bacteria, such as Cryptococcus, Staphylococcus aureus, and Candida albicans, were used for specificity. The commercially available Tiangen DP710 kit was used to extract DNA according to the instructions. The primers and probes in Table 2 were used for multiple digital PCR reactions with the extracted sample DNA, positive control, and negative control, respectively. The PCR reaction system is shown in Table 5 below.

[0080] Table 5

[0081]

[0082] The PCR reaction conditions were: 95℃ for 5 minutes of pre-denaturation, 95℃ for 15 seconds→60℃ for 30 seconds, for a total of 45 cycles. After the reaction program ended, the droplet chip was subjected to signal interpretation by the matching equipment.

[0083] The specificity detection results are shown in Table 6.

[0084] Table 6

[0085]

[0086] The results show that the primers and probes in Table 3 have no cross-reaction for detecting the above-mentioned pathogenic bacteria and have good specificity.

[0087] Sensitivity test

[0088] The plasmid synthesized artificially with the marker sequence detected in Example 1 as a template was amplified using the multiplex digital PCR system and amplification program of Table 3, with the final concentration of the template set to 20 copies / mL.

[0089] The detection results are shown in Table 7, and the sensitivity of the multiplex digital PCR kit for diagnosing liver cirrhosis reaches 20 copies / mL.

[0090] Table 7

[0091]

[0092] The above examples only express several embodiments of the present application, and the description is more specific and detailed, but it cannot be understood as a limitation on the scope of the patent of the present application. It should be noted that for ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the present application, which are all within the protection scope of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims.

Claims

1. A primer and probe combination for multiplex digital PCR, comprising: The primers shown in the sequence listing are SEQ ID NO:1-2, SEQ ID NO:4-5, SEQ ID NO:7-8, SEQ ID NO:10-11, SEQ ID NO:13-14, and SEQ ID NO:16-17; The probes shown in the sequence list are SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:12, SEQ ID NO:15, and SEQ ID NO:

16.

2. The primer and probe combination according to claim 1, characterized in that, The fluorescent group of the probe is selected from at least one of FAM, VIC, ROX, CY5, A425, Cy5.5, and Cy7.

3. The primer and probe combination according to claim 1 or 2, characterized in that, The primer and probe combination is used to detect Solomonella, Escherichia coli, Rombutzella, Fecalococcus, Fusobacterium, and Myxobacterium in the intestinal flora.

4. The primer and probe combination according to claim 1 or 2, characterized in that, The primer and probe combination was used to determine the relative abundance of Solomon's anaerobic bacteria, Escherichia coli, Rombutzella, Fecal cocci, Fusobacterium, and Myxobacterium in the intestinal flora.

5. A multiplex digital PCR kit for detecting specific strains of gut microbiota, characterized in that, The multiplex digital PCR kit comprises the primer and probe combination as described in claim 1 or 2.

6. The multiplex digital PCR kit according to claim 5, characterized in that, The multiplex digital PCR kit also includes detection reagents and nucleic acid extraction reagents.

Images