Indel molecular marker for identifying Anhui Yugui petals and application of Indel molecular marker

Abstract

The invention relates to the technical field of molecular markers, in particular to an Indel molecular marker of Wanxu old graffiti petals and application of the Indel molecular marker. The Indel molecular marker disclosed by the invention is as shown in SEQ ID NO.1-3. The Indel molecular marker can be used for identifying the Anhui Yugui petals, and can be used for identifying the Anhui Yugui petals through electrophoresis, multi-sequence alignment or reads alignment of high-pass sequencing.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to Indel molecular markers of plants of the genus Corvina and applications thereof, and specifically is a DNA barcode for identifying Corvina spp. Background Art

[0002] Amana wanyuensis BXHan, SYYi et XWSong is mainly produced in the Dabie Mountain area of ​​Anhui and Henan provinces. It is a recently identified new species of Amana genus. It grows on the edge of forests, ditches, and roadsides, at an altitude of more than 600m. This species is similar to Amana edulis (Miq.) Honda, but the difference is that the bulbs of Amana edulis (Miq.) Honda are densely covered with pubescent hairs, while the bulbs of this species are smooth and not covered with pubescent hairs; the leaves of Amana edulis in the flowering and fruiting stages are narrower, while the leaves of this species are narrower in the flowering stage, and the leaves in the fruiting stage are twice as wide as those in the flowering stage; the perianth segments of Amana edulis are red and slightly wider, while the perianth segments of this species are white and slightly narrower. Although the two have some phenotypic differences, due to the overlapping habitats of the two and the influence of the environment, the phenotypes often converge, and they are often mixed with Amana edulis for medicinal purposes in the Dabie Mountain area. Even professionals still find it difficult to clearly identify them through phenotypes. In addition, other species of the genus Psoralea distributed in the area include Dabie Psoralea, Tianmu Psoralea, and Anhui Psoralea. Some of their phenotypes are similar to those of Anhui and Henan Psoralea, which affects the identification of Anhui and Henan Psoralea. Summary of the invention

[0003] The present invention mainly aims at the above technical problems, provides a simple molecular marker method to realize the identification of the petals of the old crow in Wanyu, and specifically provides an Indel molecular marker for identifying the petals of the old crow in Wanyu and its application.

[0004] Specifically, the present invention provides the following technical solutions:

[0005] In a first aspect, the present invention provides an Indel molecular marker of the Wanyu old crow petal, and the sequence of the Indel molecular marker is shown as SEQ ID NO.1 to SEQ ID NO.3.

[0006] The present invention utilizes a high-throughput sequencing method to assemble contigs sequences from the whole genome sequence of the Wanyu old crow petal, and compares the sequences with the Polygonatum species published on NCBI. It is found that 3 sequences contain Indel mutation sites, which are suitable as Indel molecular markers for identifying the Wanyu old crow petal.

[0007] On the other hand, the present invention provides a primer set for amplifying the above-mentioned molecular markers, and the primer set is shown in the following table:

[0008]

[0009]

[0010] In another aspect, the present invention provides a method for identifying the petals of the Chinese yew tree, comprising:

[0011] (1) Extracting DNA from the plant to be identified;

[0012] (2) sequencing the total DNA to obtain sequencing reads;

[0013] (3) aligning the reads described in step 2) to the Indel molecular marker described in claim 1;

[0014] (4) The species of the sample to be tested is determined according to the coverage of the sequencing reads on the Indel molecular marker. If SEQ ID NO: 1 can be completely covered without any gap, the species of the sample to be tested is determined to include the species of the Wanyu Laoyaban. Otherwise, the sample to be tested is determined not to include the species of the Wanyu Laoyaban.

[0015] On the other hand, the present invention provides another method for identifying the petal of the old crow petal of Anhui and Henan, comprising:

[0016] (1) Extracting DNA from the plant to be identified;

[0017] (2) sequencing the total DNA to obtain sequencing reads;

[0018] (3) The reads in step 2 are assembled. If the assembled contigs contain any of the aforementioned Indel molecular markers, it is determined that the species of the sample to be tested includes the Wanyu Laoyaban. Otherwise, it is determined that the sample to be tested does not include the Wanyu Laoyaban.

[0019] On the other hand, the present invention provides another method for identifying the petal of the old crow petal of Anhui and Henan, comprising:

[0020] (1) Extracting DNA from the plant to be identified;

[0021] (2) performing PCR amplification using any pair of primers described in claim 2 or 3;

[0022] (3) Sequencing the PCR product in step 2). If the sequencing result is consistent with any of the aforementioned Indel molecular marker sequences, it is determined that the species of the sample to be tested includes the Wanyu Lao Yaban. Otherwise, it is determined that the sample to be tested does not include the Wanyu Lao Yaban.

[0023] Preferably, the sequencing in the aforementioned method is first-generation sequencing, second-generation sequencing or third-generation sequencing.

[0024] Preferably, reads are aligned using any of Geneious, Bowtie, Tophat, bwa or HISAT software.

[0025] On the other hand, the present invention provides another method for identifying the petal of the old crow petal of Anhui and Henan, comprising:

[0026] (1) Extracting DNA from the plant to be identified;

[0027] (2) using SEQ ID NO. 4 to SEQ ID NO. 5 and / or SEQ ID NO. 8 to SEQ ID NO. 9 as described in claim 2 or 3 for PCR amplification;

[0028] (3) electrophoresing the amplified product together with the aforementioned Indel molecular marker SEQ ID NO.1 and / or SEQ ID NO.2, and determining the sample species based on the electrophoresis results;

[0029] (4) If the sample contains a band with the same length as the Indel molecular marker, it is judged that the species of the sample to be tested includes the Wanyu Laoya petal, otherwise it is judged that the sample to be tested does not contain the Wanyu Laoya petal.

[0030] Preferably, in the aforementioned method, if the sample to be tested is a single sample, it is directly determined that the sample to be tested is the petal of the Wanyu old crow petal.

[0031] On the other hand, another object of the present invention is to provide any of the following applications of the above-mentioned molecular markers, primers or methods:

[0032] (1) Application in identification of old crow petals in Anhui and Henan;

[0033] (2) Application in identification, improvement or molecular marker-assisted breeding of Corynebacterium germplasm resources;

[0034] (3) Application in the screening of hybrid breeding of the genus Aglaonema or in the creation of different Aglaonema varieties;

[0035] (4) Application in the DNA fingerprint database of the genus Coriolus;

[0036] (5) Application in the quality inspection of Coriolus seedlings.

[0037] The single molecular marker of the present invention can effectively distinguish whether the tested variety is the Wanyu Old Coral Petal, providing a guarantee for the identification, planting, resource utilization and breeding of the Wanyu Old Coral Petal. It is also of great significance for the classification, phylogeny, and phylogenetic research of the Old Coral Petal species, as well as the protection and utilization of the Old Coral Petal resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] The method of the present invention and its beneficial effects are described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0039] Figure 1It is a comparison of the INDEL molecular marker sequence SEQ ID NO.1 of the Anhui and Henan old crow petals with the homologous sequences of 13 old crow petals.

[0040] Figure 2 It is a comparison of the INDEL molecular marker sequence SEQ ID NO.2 of the Anhui and Henan old crow petals with the homologous sequences of 11 old crow petals.

[0041] Figure 3 It is the comparison of the INDEL molecular marker sequence SEQ ID NO.3 of Anhui and Henan old crow petals with the homologous sequences of 13 old crow petals.

[0042] Figure 4 This is the comparison result of the INDEL molecular marker sequence SEQ ID NO.1 of Wanyu Laoyaban in the nr / nt database.

[0043] Figure 5 This is the comparison result of the INDEL molecular marker sequence SEQ ID NO.2 of Wanyu Laoyaban in the nr / nt database.

[0044] Figure 6 It is the comparison result of the INDEL molecular marker sequence SEQ ID NO.3 of Wanyu Laoyaban in the nr / nt database.

[0045] Figure 7 It is a simulated electrophoresis diagram of SEQ ID NO.1 and 13 homologous sequences of Cortex edulis, wherein M is a marker, 15 is SEQ ID NO.1, 14 is the PCR sequence of Cortex edulis in Anhui and Henan, and 1 to 13 are other Cortex edulis.

[0046] Figure 8 It is a simulated electrophoresis diagram of SEQ ID NO.2 and 11 homologous sequences of old crow petals, wherein M is a marker, 13 is SEQ ID NO.2, 12 is the PCR sequence of Anhui and Henan old crow petals, 11 is Yunju old crow petals, and 1 to 10 are other old crow petals.

[0047] Fig. 9 It is a simulated electrophoresis diagram of SEQ ID NO.3 and 13 homologous sequences of Cortex edulis, wherein M is a marker, 1 is SEQ ID NO.3, 2 is the PCR sequence of Cortex edulis in Anhui and Henan, and 3 to 15 are other Cortex edulis.

[0048] Fig.10 It is the alignment result of DNA sequencing reads containing Wanyu Laoya petal on SEQ ID NO.1.

[0049] Fig.11 It is the alignment result of DNA sequencing reads excluding Wanyu Laoyaban on SEQ ID NO.1, where A is the full-view image and B is the gap site image.

[0050] Fig.12 The DNA sequencing reads that do not contain the Wanyu Laoya petal are in SEQ ID NO.2 ( Fig.12 A)、SEQ ID NO.3( Fig.12 B) and ITS sequences ( Fig.12 C) on the comparison results. DETAILED DESCRIPTION

[0051] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0052] Unless otherwise defined, all technical and scientific terms used in this application have the same meanings as commonly understood by those of ordinary skill in the art to which this application belongs. The Coriolus plant samples used in the following examples can be obtained through commercial purchase or collected from the wild.

[0053] Example 1 Development of specific molecular markers for the petals of the old crow in Anhui and Henan

[0054] Amana wanyuensis BXHan, SYYi et XWSong is mainly produced in the Dabie Mountain area of ​​Anhui Province and Henan Province, and grows in forest edges, ditches, and roadsides at an altitude of more than 600m. This species is similar to Amana edulis (Miq.) Honda, and other Amana species distributed in the region include Dabie Amana, Tianmu Amana, and Anhui Amana. The Amana wanyuensis of the present invention are all collected from the Dabie Mountain area of ​​Anhui Province.

[0055] The specific indel molecular markers of the Wanyu old crow petal, i.e., DNA barcodes, were obtained by the following steps:

[0056] 1) Collect leaves of the Wanyu Old Crow Petal;

[0057] 2) Extracting total DNA from leaves of Psoralea corylifolia;

[0058] 3) performing second-generation high-throughput sequencing on the total DNA to obtain sequencing reads;

[0059] 4) Assemble sequencing reads into contigs.

[0060] 5) Compare with the nucleotide sequences of Corynebacterium species in Genbank and screen for specific marker sites containing indels.

[0061] As a result, three fragments were obtained as shown in SEQ ID NO.1 to SEQ ID NO., and the three sequences had multiple polymorphic sites with the homologous nucleotide sequences of the genome of known Corvina species.

[0062] SEQ ID NO.1:

[0063] 5'-CTCCTGCAAGAGAAGCGGATATAGGAAGTGTTGTTGCGGAGATCTAGCTTTTTTGAAATACCCTTGTAATTCTTCCATTTAAATTTTTGACTTGAAACAGAGACATAGGACAAGAGGCATTTTTGGGGTTATAAAAT AATACATAGTGCAATATGGTCCGAACAGGGTATATAATTATGTATATAATTATGTAGATATAATACTTACAGTATATATAGTAAACAGTATATATAGTAAGAATAGTAAGAACCTATACCCCGGAGACCTAGAATCC-3'

[0064] SEQ ID NO.2:

[0065] 5'-ATCTGGGTGTCGCCTGATTGACAAAATGGTGGACCCACCGTACCAATCCAATAGGATGAAGTGAAGGTTGCTGCACTTATTAATTATTAATTTAATAATGGGTTCGGTTCATTTATTTAATTCTTTAATTCATTCATTGAATCAAATA AATTAGGAAATGGAGGTTTTATTAAGATAGTTATCTGTCTTTAGTTATCTGTCTTTAGTATAGAGATTTTTTTATCTTTTATATCTATATATATAATTTATCTCTTTTGCTTATACAAAAGGTAACAAAAGAAACAATAGGTCT-3'

[0066] SEQ ID NO.3:

[0067] 5'-CTCCCTTCTTCCACTCCGTCCCGAAGAGTAACTAAGACCAATTCAGTCACGTTTTCATGTTCCAATTGAACACTTTCCATTTATGATCAAAGAAGAAGATTATTTTTTACCAAACCATATACAGATCAAATCACAATATTATAATAAG AATCAGAAAGATCCCTTTTGATTTTGAATTTGTTCATTTGGAATATGGGCTCTTCTATCTTGTACTTATTTTTGTTTTATTCTTTATTTATTTCATTTCGATTTTCTTTCCCTCTCTTTTTTCCCTTCCATCATTCCTTAAGTCCCA-3'

[0068] Primers were further designed to amplify the homologous sequences of P. annuli and the other 13 closely related species of P. annuli, and multiple sequence alignment was performed. It was found that all three sequences had significant differences from the homologous sequences of the 13 P. annuli ( Figure 1 to Figure 3 ). The 13 closely related species of the old crow petal are two-leaf old crow petal, Yunju old crow petal, Yunmeng old crow petal, Nanyue old crow petal, polymorphic old crow petal, Dabie old crow petal, Tianmu old crow petal, Anhui old crow petal, Baohua old crow petal (SEQ ID.2 not expanded), Kuacangshan old crow petal, Japanese old crow petal, Anhui and Zhejiang old crow petal (SEQ ID.2 not expanded), Anhui and Henan old crow petal, and old crow petal. The primer sequences are as follows:

[0069]

[0070]

[0071] Example 2 Comparison of specific molecular markers of the old crow petal in Anhui and Henan with sequences of closely related species

[0072] In order to determine whether the molecular markers of the present invention are species specific, the molecular markers of the present invention were compared using the blast program of Geneious Prime, selecting the nr / nt library, not limiting the species, and keeping the other parameters as default. Figures 4 to 6 As shown, Figure 4 The highest consistency between the species compared with SEQ ID NO.1 and the known sequences of the genus Corvina is 94.2%. Figure 5 The molecular marker of SEQ ID NO.2 showed that the highest consistency between the species and the known old crow petal sequence was 94.9%. Figure 6The sequence of SEQ ID NO.3 is similar to Corsia dispar, but the coverage is only 99.33 and the consistency is only 85.4%. The remaining sequences are all known Corsia sequences, with the highest coverage of only 50.67. The compared sequences are not the sequences of Corsia dispar in Anhui and Henan. It can be seen that the molecular markers of the present invention are different from all known Corsia species and have strong specificity.

[0073] Example 3 Identification method of Wanyu old crow petal 1

[0074] 1) Collecting leaves of Corynebacterium plants as samples to be tested;

[0075] 2) extracting total DNA from the sample to be tested;

[0076] 3) amplifying the DNA in step 2) using the primers in Example 1);

[0077] 4) The amplified product was detected by 2.5% agarose gel electrophoresis together with the molecular marker of Wanyu Lao Ya petal in Example 1, and the PCR amplification was observed under a gel imaging system, and the species of the sample to be tested was determined according to the band size.

[0078] Since the PCR products in Example 1 have been sequenced to obtain the sequencing sequence, in this example, Snapgene software was used to simulate agarose gel electrophoresis based on the size of the sequencing product. Figures 7 to 9 As shown, when the electrophoresis band of the PCR product is consistent with the control marker of SEQ ID NO.1 or SEQ ID NO.3, it is judged to be Wanyu Lao Yaban, otherwise it is not Wanyu Lao Yaban. SEQ ID NO.2 cannot distinguish Wanyu Lao Yaban from other Lao Yaban.

[0079] Example 4 Identification method of Wanyu old crow petal 2

[0080] 1) Collecting leaves of Corynebacterium plants as samples to be tested;

[0081] 2) extracting total DNA from the sample to be tested;

[0082] 3) Performing second-generation high-throughput sequencing on the total DNA of the above two samples to obtain sequencing reads;

[0083] Geneious software was used to align the sequencing reads to SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively, and the maximum mismatch base and the maximum gap ratio were set to 2%.

[0084] 4) The species of the sample to be tested is determined according to the coverage of the sequencing reads on the DNA molecular markers. If any sequence of SEQ ID NO: 1 can be completely covered without any gap, the species of the sample to be tested is determined to include the Wanyu Lao Yaban. Otherwise, it is determined that the sample does not contain the Lao Yaban sample.

[0085] Results Fig.10 As shown, the sequencing reads containing the Wanyu Corvina sample (mixed with the second-generation sequencing reads of all samples in Example 1 and other known Corvina sequencing reads published on NCBI) completely cover SEQ ID NO: 1 without any gap. Fig.11 It shows that the sequencing reads without the Wanyu Lao Ya petal sample (mixed with the second-generation sequencing reads of non-Wanyu Lao Ya petal samples in Example 1 and other known Lao Ya petal sequencing reads published on NCBI) cannot cover SEQ ID NO: 1, and there is a gap. Fig.12 It was shown that the mixed reads can also cover SEQ ID NO: 2 and SEQ ID NO: 3, as well as the ITS sequence of Wanyu Laoyaban, so SEQ ID NO: 2, SEQ ID NO: 3 and ITS sequence are not applicable in this identification scheme.

[0086] In summary, firstly, the present invention is a powerful supplement to traditional species identification, and the sample identification process can be automated and standardized, breaking through the excessive reliance on experience, and can use fresh or dried leaves of plants, such as specimen samples, for rapid and effective identification, and can establish an easy-to-use application system in a relatively short time. Secondly, the present invention can distinguish between Anhui and Henan old cormorants and related species, and can stably and accurately identify Anhui and Henan old cormorants and related species at a higher resolution level. Finally, the method of the present invention is of great significance for the classification, phylogeny, and phylogenetic research of the species of the genus Cormorant, as well as the protection and utilization of Cormorant resources.

[0087] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to the above embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. An Indel molecular marker for identifying the petals of the Wanyu old crow, characterized in that: The sequence of the Indel molecular marker is shown in any one of SEQ ID NO.1 to SEQ ID NO.

3.

2. A primer set for amplifying the Indel molecular marker according to claim 1.

3. The primer set according to claim 2, characterized in that The sequences of the primer set are shown in SEQ ID NO.4 to SEQ ID NO.

9.

4. A method for identifying the petals of the Wanyu old crow, characterized in that: include: (1) Extracting DNA from the plant to be identified; (2) sequencing the total DNA to obtain sequencing reads; (3) aligning the reads described in step 2) to the Indel molecular marker described in claim 1; (4) The species of the sample to be tested is determined according to the coverage of the sequencing reads on the Indel molecular marker. If SEQ ID NO: 1 can be completely covered without any gap, the species of the sample to be tested is determined to include the species of the Wanyu Laoyaban. Otherwise, the sample to be tested is determined not to include the species of the Wanyu Laoyaban.

5. A method for identifying the petals of the Wanyu old crow, characterized in that: include: (1) Extracting DNA from the plant to be identified; (2) sequencing the total DNA to obtain sequencing reads; (3) The reads in step 2 are assembled. If the assembled contigs contain any Indel molecular marker described in claim 1, it is determined that the species of the sample to be tested includes the Wanyu Laoyaban, otherwise it is determined that the sample to be tested does not include the Wanyu Laoyaban.

6. A method for identifying the petals of the Wanyu old crow, characterized in that: include: (1) Extracting DNA from the plant to be identified; (2) performing PCR amplification using any pair of primers described in claim 2 or 3; (3) sequencing the PCR product in step 2); if the sequencing result is consistent with any Indel molecular marker sequence described in claim 1, it is determined that the species of the sample to be tested includes the species of the Wanyu Old Crow Petal; otherwise, it is determined that the sample to be tested does not include the species of the Wanyu Old Crow Petal.

7. A method for identifying the petals of the Wanyu old crow, characterized in that: include: (1) Extracting DNA from the plant to be identified; (2) using SEQ ID NO. 4 to SEQ ID NO. 5 and / or SEQ ID NO. 8 to SEQ ID NO. 9 as described in claim 2 or 3 for PCR amplification; (3) performing electrophoresis on the amplified product together with the Indel molecular marker SEQ ID NO.1 and / or SEQ ID NO.2 described in claim 1, and determining the sample species according to the electrophoresis results; (4) If the sample contains a band with the same length as the Indel molecular marker, it is judged that the species of the sample to be tested includes the Wanyu Laoya petal, otherwise it is judged that the sample to be tested does not contain the Wanyu Laoya petal.

8. The method according to any one of claims 4 to 6, characterized in that: The sequencing is first-generation sequencing, second-generation sequencing or third-generation sequencing.

9. The method according to claim 4, characterized in that In step 3), use Geneious, Bowtie, Tophat, bwa or HISAT to align reads.

10. Any of the following uses of the Indel molecular marker according to claim 1, the primer according to any one of claims 2 to 3, or the method according to any one of claims 4 to 9: (1) Application in identification of old crow petals in Anhui and Henan; (2) Application in identification, improvement or molecular marker-assisted breeding of Anhui and Henan old crow petal germplasm resources; (3) Application in screening or creating different Anhui and Henan old crow petal varieties; (4) Application in constructing DNA fingerprint database of old crow petals in Anhui and Henan; (5) Application in the quality inspection of seedlings of old crow petals in Anhui and Henan.

Images