Isothermal amplification detection kit for avian influenza H5N1 virus and detection method thereof

Abstract

The invention relates to the technical field of virus detection, and particularly discloses an isothermal amplification detection kit for avian influenza H5N1 virus and a detection method thereof. The kit comprises three sets of specific primer probe groups, namely an H5 primer probe group for detecting the H5 subtype avian influenza virus, an N1 primer probe group for detecting the N1 subtype avian influenza virus and an endogenous reference gene primer probe group, according to the kit, the MAOPA technology is used for detection, nucleic acid extraction and nucleic acid amplification are integrated, the nucleic acid concentration is effectively increased, and the detection accuracy is improved. The isothermal amplification detection kit for the avian influenza virus H5N1, prepared by the invention, can be used for rapidly, accurately and sensitively detecting the avian influenza virus H5 and the avian influenza virus N1, and is expected to be widely used in prevention, control and diagnosis of avian influenza epidemic situations.

Description

Technical Field

[0001] The present application relates to the technical field of virus detection, and more specifically, to a constant temperature amplification detection kit for avian influenza H5N1 virus and a detection method thereof. Background Art

[0002] Avian influenza (AIV) is an acute infectious disease common in humans and poultry caused by influenza A viruses. Avian influenza viruses (AIV) belong to the genus Influenza A virus in the family Orthomyxoviridae. They are single-stranded, negative-sense RNA viruses classified into 15 H subtypes (H1-H15) and nine N subtypes (N1-N9) based on the antigenicity of their hemagglutinin (H) and neuraminidase (N) proteins. AIV can infect a wide range of animals, with wild waterfowl being the primary carriers. Among domestic poultry, chickens and turkeys are particularly susceptible. Furthermore, AIV can cross the host-host barrier to infect humans, rats, dogs, pigs, and marine mammals, causing widespread infection, epidemics, or pandemics. Among these, H5 subtype influenza viruses are the most widely detected, and most are highly pathogenic. The H5N1 virus has been circulating in multiple countries and continues to circulate and mutate in birds, causing periodic outbreaks in poultry and severe losses to the livestock industry. In recent years, studies have found that the H5N1 virus has begun to tend to spread among mammals, so there is an urgent need to develop a highly sensitive, specific and convenient H5N1 virus detection method.

[0003] Currently, the main methods for detecting AIV include pathogen isolation and identification, RT-PCR, and fluorescent quantitative RT-PCR. These methods are time-consuming, low-sensitivity, and cumbersome, making them unsuitable for on-site testing. Magnetic bead-mediated integrated polymerase amplification (MAOPA) technology integrates nucleic acid extraction and amplification, overcoming the drawback of traditional methods, where nucleic acid is lost step by step during extraction, elution, and amplification. The combination of MAOPA technology and fluorescent quantitative RT-PCR can provide high efficiency and convenience for epidemic prevention, control, and diagnosis. Based on the above, this application proposes a constant-temperature amplification detection kit and detection method for avian influenza H5N1 virus. Summary of the Invention

[0004] In order to solve the problems of the existing AIV detection technology, which is time-consuming, low-sensitivity and complicated operation, the present application provides a constant-temperature amplification detection kit and detection method for avian influenza H5N1 virus.

[0005] In a first aspect, the present application provides a constant temperature amplification detection kit for avian influenza H5N1 virus, comprising an H5 primer probe set for detecting H5 subtype avian influenza virus, an N1 primer probe set for detecting N1 subtype avian influenza virus, and an internal standard gene primer probe set.

[0006] Preferably, the H5 primer-probe set includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are: H5-F: TTGGGACATCAACATTAAATCAGAG (SEQ ID NO. 1); H5-R: TCCGGTTTTAAAATTGTCCAGAAG (SEQ ID NO.2); H5-probe: CCACTTTGCCCGTTTACTTGGGATCT (SEQ ID NO. 3).

[0007] Preferably, the N1 primer-probe set includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are: N1-F: GGCTGTGGCTGTATTGAAATAC (SEQ ID NO.4); N1-R: ACCAGAAATTCCAATTGTCAACC (SEQ ID NO.5); N1-probe: AGGTTTGAGTCTGTTGCTTGGTCGT (SEQ ID NO. 6).

[0008] Preferably, the internal standard gene primer probe set includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are: 18S-F: GGAGTATGGTTGCAAAGCTG (SEQ ID NO. 7); 18S-R: GAGTCAAATTAAGCCGCAGG (SEQ ID NO. 8); 18S-probe: TGGTGCCCTTCCGTCAATTCCTTT (SEQ ID NO. 9).

[0009] Preferably, the H5 probe fluorescent reporter group is one of FAM, ROX, VIC, and CY3, and the fluorescence quencher group is one of BHQ1, BHQ2, BBQ650, and DABCYL; the N1-probe fluorescent reporter group is one of FAM, ROX, VIC, and CY3, and the fluorescence quencher group of the N1-probe is one of BHQ1, BHQ2, BBQ650, and DABCYL; the 18S-probe fluorescent reporter group is one of FAM, ROX, VIC, and CY3, and the fluorescence quencher group of the 18S-probe is one of BHQ1, BHQ2, BBQ650, and DABCYL.

[0010] Preferably, the H5 primer probe group contains H5-F 0.2-0.8 μM, H5-R 0.2-0.8 μM, and H5-probe 0.3-0.5 μM; the N1 primer probe group contains N1-F 0.2-0.8 μM, N1-R 0.2-0.8 μM, and N1-probe 0.3-0.5 μM; and the internal standard gene primer probe group contains 18S-F 0.3 μM, 18S-R 0.3 μM, and 18S-probe 0.2 μM.

[0011] Preferably, the H5 primer probe group contains H5-F 0.6 μM, H5-R 0.6 μM, and H5-probe 0.4 μM; the N1 primer probe group contains N1-F 0.4 μM, N1-R 0.4 μM, and N1-probe 0.3 μM; and the internal standard gene primer probe group contains 18S-F 0.3 μM, 18S-R 0.3 μM, and 18S-probe 0.2 μM.

[0012] Preferably, the kit further comprises a sample lysis extract for detecting H5N1 subtype avian influenza virus, a sample washing solution I, a sample washing solution II, and a reaction premix.

[0013] Preferably, the sample lysis extract comprises the following components: guanidine thiocyanate, NP-40, KCl, ethanol, BSA and Tris-HCl.

[0014] Preferably, the sample lysis extract comprises the following components: 3M guanidine thiocyanate, 2% NP-40, 0.6M KCl, 20% ethanol, 0.3mM BSA and 15mM Tris-HCl.

[0015] Preferably, the sample washing solution I comprises the following components: 2M sodium dodecyl sulfate, 12mM phosphate buffer, 2mM BSA, 0.5M KCl, 3% Tween-20 and 30% isopropanol.

[0016] Preferably, the sample washing solution II comprises the following components: 40% isopropyl alcohol and 2% NP-40.

[0017] Preferably, the reaction premix includes H5-F 0.6 μM, H5-R 0.6 μM, H5-probe 0.4 μM, N1-F 0.4 μM, N1-R 0.4 μM, N1-probe 0.3 μM, 18S-F 0.3 μM, 18S-R 0.3 μM, 18S-probe 0.2 μM, 1× RNA-directrealtime PCR master mix and 2.5 mM Mn 2+ .

[0018] Second aspect, the present application provides an integrated detection method for a constant temperature amplification detection kit of avian influenza H5N1 virus, specifically including the following steps: S1. Store the sample lysis extract in the first compartment of the integrated detection reagent card; store the sample washing solution I in the second compartment of the integrated detection reagent card; store the sample washing solution II in the third compartment of the integrated detection reagent card; store the reaction premix in the fourth compartment of the integrated detection reagent card; S2. Add the test sample to the integrated detection reagent card, cover and seal the card, and gradually carry out the following reactions in the integrated detection reagent card: (1) Lyse the test sample, and the magnetic beads adsorb the RNA of H5 subtype avian influenza virus, the RNA of N1 subtype avian influenza virus, and the RNA of the internal standard gene; (2) The magnetic beads adsorbed with the RNA of H5 subtype avian influenza virus, the RNA of N1 subtype avian influenza virus, and the RNA of the internal standard gene move directionally, and the impurities, proteins and other non-nucleic acid samples on the magnetic beads are washed away; (3) The magnetic beads enter the molecular amplification reaction area, the viral RNA dissociates from the magnetic beads, and the RNA is reverse transcribed into the corresponding cDNA under the action of reverse transcriptase, and a reaction program is set to carry out fluorescence quantitative PCR reaction; (4) Analyze whether the test sample is infected with H5N1 subtype avian influenza virus according to the fluorescence curve.

[0019] Preferably, the reaction program in step (3) is 90°C for 40 s, 62°C for 20 min; 95°C for 45 s, 90 - 92°C for 1 s, 65°C for 40 - 50 s, 40 cycles.

[0020] Preferably, the result determination of the detection method is: no Ct value or Ct value of 40 is negative; Ct value < 37 is positive; when 37 < Ct value < 40 is suspicious, reexamination is required. If the Ct value of the reexamination < 40 and the amplification curve has an obvious peak, it is positive, otherwise it is negative.

[0021] In summary, the present application has the following beneficial effects: The isothermal amplification detection kit for avian influenza H5N1 virus prepared by the present application can simultaneously detect H5 subtype AIV and N1 subtype AIV, and the operation is simple and convenient. The primer pairs and probes in the kit are designed with full consideration of the annealing temperature between the primers. Not only are they highly specific and accurate, they can only specifically detect H5 subtype AIV and N1 subtype AIV. Detection of other subtypes of AIV, Newcastle disease virus, infectious bursal virus of chickens, and infectious laryngotracheitis virus of chickens does not produce obvious amplification curves. Moreover, they have high sensitivity for detecting the corresponding viruses. The minimum detection limit of the primer pair and probe for H5 subtype AIV and the minimum detection limit of the primer pair and probe for N1 subtype AIV are both 10 copies / μL. In addition, the kit of the present application also has excellent repeatability, can detect viruses in a long-term and stable manner, and can play an important role in epidemic prevention and control. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a graph showing the test results of throat swab fluid from healthy chickens. (In the graph, 1 represents the H5 subtype AIV; 2 represents the N1 subtype AIV; and 3 represents the internal standard gene.)

[0023] Figure 2 This is a graph showing the specificity of the isothermal amplification detection kit and method for the avian influenza H5N1 virus. (In the graph, 1 represents H5 subtype AIV; 2 represents N1 subtype AIV; 3-8 represent H3N2 subtype AIV, H3N8 subtype AIV, H6N6 subtype AIV, Newcastle disease virus, infectious bursal disease virus, and infectious laryngotracheitis virus, respectively; 9 represents the internal standard gene.)

[0024] Figure 3 This is a graph showing the sensitivity test results of the isothermal amplification detection kit and detection method for avian influenza H5N1 virus. (In the figure, 1-6 represent the plasmid concentration of 1×10 1 Plasmid, 1×10 2 Plasmid, 1×10 3 Plasmid, 1×10 4 Plasmid, 1×10 5 Plasmid, 1×10 6 H5 subtype AIV plasmid; 7-12 represent plasmid concentrations of 1×10 1 Plasmid, 1×10 2 Plasmid, 1×10 3 Plasmid, 1×10 4 Plasmid, 1×10 5 Plasmid, 1×10 6 N1 subtype AIV plasmid; 13 represents the internal standard gene). DETAILED DESCRIPTION

[0025] The present application is further described in detail below with reference to the embodiments.

[0026] Example 1 1. Primer and Probe Design Published HA gene sequences of the H5 subtype avian influenza virus and NA gene sequences of the N1 subtype avian influenza virus were searched from GeneBank. A conserved region was selected as the target sequence through multiple sequence alignment. Primers and probes were designed, and an optimal combination was screened, as shown in Table 1. The optimal primers were used for amplification and ligated into the pUC57 vector to obtain positive plasmid standards for the H5 subtype AIV and the N1 subtype AIV.

[0027] Table 1

[0028] 2. Design of internal standard primers and probes Multiple sequence alignment analysis was performed on the full-length 18S rRNA sequences of mammals and birds published in Genebank. A conserved region was selected as the internal standard gene target sequence. Primers and probes were designed to determine the optimal combination, as shown in Table 2. The optimal primers were used for amplification and ligated into the pUC57 vector to obtain the internal standard gene positive plasmid standard.

[0029] Table 2

[0030] Example 2 Optimization of the primer-probe reaction system and reaction conditions designed above.

[0031] Primer concentrations were screened in the range of 0.2–0.6 μM with an increase of 0.2 μM; The probe concentration was screened in the range of 0.3–0.5 μM with an increase of 0.1 μM; The denaturation temperature was optimized and set at 90°C, 91°C, and 92°C; The annealing time was optimized and set to 40s, 45s, and 50s respectively; According to the optimized conditions, the Ct values ​​were compared, and the condition with the smallest Ct value was considered the best reaction condition. The results are shown in Tables 3, 4, 5, and 6.

[0032] Table 3

[0033] As shown in Table 3, the Ct value was the smallest when the concentration of H5 primer was 0.6 μM, and the Ct value was the smallest when the concentration of N1 primer was 0.4 μM.

[0034] Table 4

[0035] As can be seen from Table 4, when the concentration of the H5 probe is 0.4 μM, the Ct value is the smallest, and when the concentration of the N1 probe is 0.3 μM, the Ct value is the smallest.

[0036] Table 5

[0037] As can be seen from Table 5, when the denaturation temperature is 90 °C, the Ct values of both the H5 primer-probe and the N1 primer-probe are the smallest, indicating that the optimal denaturation temperature is 90 °C.

[0038] Table 6

[0039] As can be seen from Table 6, when the annealing time is 40 s, the Ct values of both the H5 primer-probe and the N1 primer-probe are the smallest, indicating that the optimal annealing time is 40 s.

[0040] The optimal reaction system is: H5-F 0.6 μM, H5-R 0.6 μM, H5-probe 0.4 μM, N1-F 0.4 μM, N1-R 0.4 μM, N1-probe 0.3 μM, 18S-F 0.3 μM, 18S-R 0.3 μM, 18S-probe 0.2 μM, 1×RNA-direct realtime PCR master mix and 2.5 mM Mn 2+ .

[0041] The optimal reaction conditions are: 90 °C for 40 s, 62 °C for 20 min (reverse transcription); 95 °C for 45 s, 90 °C for 1 s, 65 °C for 40 s, 40 cycles. <able>

[0042] Result determination: No Ct value or Ct value of 40 is negative; Ct value < 37 is positive; when 37 < Ct value < 40 is suspicious and needs to be retested. If the retested Ct < 40 and the amplification curve has an obvious peak, it is positive, otherwise it is negative.

[0043] Mix the positive plasmid standards of H5 subtype AIV and N1 subtype AIV into the throat swab fluid of healthy chickens to simulate clinical samples. Take 200 μL of the throat swab fluid and add it to the integrated molecular diagnostic reagent card for reaction. The results are as Figure 1 shown: Obvious amplification curves are generated for both H5 subtype AIV, N1 subtype AIV and the internal standard gene, and the Ct values are all less than 37, indicating that the amplification effect of the above reaction system and reaction conditions is stable and the results are accurate.

[0044] Example 3 <able> Specificity detection of the isothermal amplification detection kit and detection method for avian influenza H5N1 virus.

[0045] Using plasmid standards of H5 subtype AIV, N1 subtype AIV, H3N2 subtype AIV, H3N8 subtype AIV, H6N6 subtype AIV, Newcastle disease virus, infectious bursal disease virus, infectious laryngotracheitis virus and internal standard genes (corresponding to 1, 2, 3, 4, 5, 6, 7, 8, and 9, respectively) as templates, a fluorescent quantitative PCR amplification reaction was performed according to the reaction system and reaction conditions described in Example 2.

[0046] The results are as follows Figure 2 As shown, the amplification curves of the H5 and N1 subtype AIV plasmid standards both exhibited distinct peaks. However, the plasmid standards for H3N2, H3N8, H6N6, Newcastle disease virus, infectious bursal disease virus, and infectious laryngotracheitis virus did not produce distinct amplification curves. This demonstrates that the kit and detection method of this application do not produce nonspecific amplification curves and are highly specific.

[0047] Example 4 Repeatability testing of the isothermal amplification detection kit and detection method for avian influenza H5N1 virus.

[0048] The plasmid standard H5 subtype AIV plasmid was diluted in a 10-fold gradient (1×10 1 Plasmid, 1×10 2 Plasmid, 1×10 3 Plasmid, 1×10 4 Plasmid, 1×10 5 Plasmid, 1×10 6 Plasmid), the plasmid standard N1 subtype AIV plasmid was diluted in 10-fold gradients (1×10 1 Plasmid, 1×10 2 Plasmid, 1×10 3 Plasmid, 1×10 4 Plasmid, 1×10 5 Plasmid, 1×10 6 plasmid); The copy number is 1×10 4 , 1×10 5 and 1×10 6 Intra-assay reproducibility experiments were conducted with H5 and N1 subtype AIV positive plasmid standards. Three replicates were set for each sample. Fluorescence quantitative PCR was performed according to the reaction system and reaction conditions described in Example 2. The average Ct value, standard deviation, and coefficient of variation of the reaction results were calculated. The results are shown in Table 7.

[0049] Table 7

[0050] The copy number is 1×10 4 , 1×10 5 and 1×10 6 Inter-batch reproducibility experiments were conducted with H5 and N1 subtype AIV positive plasmid standards. Three replicates were set up for each sample. Fluorescence quantitative PCR was performed according to the reaction system and reaction conditions described in Example 2. Repeat experiments were performed at two different time points. The average Ct value, standard deviation, and coefficient of variation of the reaction results were calculated. The results are shown in Table 8.

[0051] Table 8

[0052] According to Tables 7 and 8, the coefficient of variation within the group ranged from 0.29% to 1.14%, and the coefficient of variation between the groups ranged from 0.52% to 1.34%. The coefficients of variation within and between the groups were both less than 2%, indicating excellent repeatability both within and between the groups.

[0053] Example 5 Sensitivity testing of a constant temperature amplification detection kit and detection method for avian influenza H5N1 virus.

[0054] 1×10 1 Plasmid, 1×10 2 Plasmid, 1×10 3 Plasmid, 1×10 4 Plasmid, 1×10 5 Plasmid, 1×10 6 The H5 subtype AIV plasmids of different plasmid concentrations were used as templates (corresponding to 1, 2, 3, 4, 5, and 6, respectively); 1×10 1 Plasmid, 1×10 2 Plasmid, 1×10 3 Plasmid, 1×10 4 Plasmid, 1×10 5 Plasmid, 1×10 6 The N1 subtype AIV plasmids (corresponding to 7, 8, 9, 10, 11, and 12, respectively) of different plasmid concentrations were used as templates, and corresponding primers and probes were added. Fluorescence quantitative PCR detection was performed according to the reaction system and reaction conditions described in Example 2.

[0055] The results are as follows Figure 3 As shown, the detection sensitivity of H5 subtype AIV and N1 subtype AIV is 10 copies of plasmid standards, indicating that the kit and detection method of the present application can detect trace amounts of virus with high sensitivity.

[0056] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed, but as long as they are within the scope of the claims of the present application, they are protected by the patent law.

[0057] <110> Taizhou Leiling Biotechnology Co., Ltd. <120> Avian influenza H5N1 virus isothermal amplification detection kit and detection method <160> 9 <170> SIPO SequenceListing 1.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <400> 1 ttgggacatc aacattaaat cagag 25 <210> 2 <211> twenty four <212> DNA <213> Artificial Sequence <400> 2 tccggtttta aaattgtcca gaag 24 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <400> 3 ccactttgcc cgtttacttg ggatct 26 <210> 4 <211> twenty two <212> DNA <213> Artificial Sequence <400> 4 ggctgtggct gtattgaaat ac 22 <210> 5 <211> twenty three <212> DNA <213> Artificial Sequence <400> 5 accagaaatt ccaattgtca acc 23 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <400> 6 aggtttgagt ctgttgcttg gtcgt 25 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 ggagtatggt tgcaaagctg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 gagtcaaatt aagccgcagg 20 <210> 9 <211> twenty four <212> DNA <213> Artificial Sequence <400> 9 tggtgccctt ccgtcaattc cttt 24.

Claims

1. A constant temperature amplification detection kit for avian influenza H5N1 virus, characterized in that: It includes an H5 primer probe set for detecting H5 subtype avian influenza virus, an N1 primer probe set for detecting N1 subtype avian influenza virus, and an internal standard gene primer probe set; The internal standard gene primer probe set includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are: 18S-F: GGAGTATGGTTGCAAAGCTG (SEQ ID NO. 7); 18S-R: GAGTCAAATTAAGCCGCAGG (SEQ ID NO. 8); 18S-probe: TGGTGCCCTTCCGTCAATTCCTTT (SEQ ID NO. 9).

2. The isothermal amplification detection kit for avian influenza H5N1 virus according to claim 1, characterized in that: The H5 primer probe set includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are: H5-F: TTGGGACATCAACATTAAATCAGAG (SEQ ID NO. 1); H5-R: TCCGGTTTTAAAATTGTCCAGAAG (SEQ ID NO.2); H5-probe: CCACTTTGCCCGTTTACTTGGGATCT (SEQ ID NO. 3).

3. The isothermal amplification detection kit for avian influenza H5N1 virus according to claim 1, characterized in that: The N1 primer probe set includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are: N1-F: GGCTGTGGCTGTATTGAAATAC (SEQ ID NO.4); N1-R: ACCAGAAATTCCAATTGTCAACC (SEQ ID NO.5); N1-probe: AGGTTTGAGTCTGTTGCTTGGTCGT (SEQ ID NO. 6).

4. The isothermal amplification detection kit for avian influenza H5N1 virus according to claim 1, characterized in that: The H5 primer probe group contains H5-F 0.2-0.8μM, H5-R 0.2-0.8μM, and H5-probe 0.3-0.5μM; the N1 primer probe group contains N1-F 0.2-0.8μM, N1-R 0.2-0.8μM, and N1-probe 0.3-0.5μM; the internal standard gene primer probe group contains 18S-F 0.3μM, 18S-R 0.3μM, and 18S-probe 0.2μM.

5. The isothermal amplification detection kit for avian influenza H5N1 virus according to claim 1, characterized in that: The kit also includes a sample lysis extract, a sample washing solution I, a sample washing solution II, and a reaction premix solution for detecting H5N1 subtype avian influenza virus.

6. The isothermal amplification detection kit for avian influenza H5N1 virus according to claim 5, characterized in that: The sample lysis extraction solution comprises the following components: guanidine thiocyanate, NP-40, KCl, ethanol, BSA and Tris-HCl.

7. A detection method of the isothermal amplification detection kit for avian influenza H5N1 virus according to any one of claims 1 to 6, characterized in that: The specific steps include the following: S1, storing the sample lysis extract in the first small chamber of the integrated detection reagent card; storing the sample washing solution I in the second small chamber of the integrated detection reagent card; The sample washing solution II is stored in the third chamber of the integrated detection reagent card; the reaction premix solution is stored in the fourth chamber of the integrated detection reagent card; S2. Add the sample to be tested to the integrated detection reagent card, cover the card, and gradually carry out the following reactions in the integrated detection reagent card: (1)Lyse the test sample, and use magnetic beads to adsorb the RNA of H5 subtype avian influenza virus, the RNA of N1 subtype avian influenza virus, and the RNA of the internal standard gene; (2)Direct the movement of the magnetic beads adsorbed with the RNA of H5 subtype avian influenza virus, the RNA of N1 subtype avian influenza virus, and the RNA of the internal standard gene, and wash away the non-nucleic acid samples on the magnetic beads; (3)The magnetic beads enter the molecular amplification reaction area, the viral RNA dissociates from the magnetic beads, and under the action of reverse transcriptase, the RNA is reverse transcribed into the corresponding cDNA, and the reaction program is set to perform fluorescence quantitative PCR reaction; (4)Analyze whether the test sample is infected with H5N1 subtype avian influenza virus according to the fluorescence curve.

8. The detection method of the isothermal amplification detection kit for avian influenza H5N1 virus according to claim 7, characterized in that: The result is judged as follows: no Ct value or Ct value of 40 is negative; Ct value < 37 is positive; when 37 < Ct value < 40 is suspicious and needs to be retested. If the retest Ct < 40 and the amplification curve has an obvious peak, it is positive, otherwise it is negative.

Images