Folding oligonucleotides

Abstract

The present invention provides folded oligonucleotides and their use for correcting genetic mutations in target RNA molecules or attaching specific motifs to target RNA molecules.

Description

Technical Field

[0001] The present disclosure is in the field of engineered nucleic acid based therapeutics.

[0002] background

[0003] In the natural transcription process that occurs in the cell nucleus, RNA (ribonucleic acid) is transcribed from a DNA (deoxyribonucleic acid) template. During this process, a pre-mRNA (pre-messenger RNA) transcript is formed. Pre-mRNA becomes mature mRNA after processing. RNA processing includes 5' capping, 3' polyadenylation and splicing, including alternative splicing. The splicing process removes all introns (non-coding regions of RNA) and splices exons (coding regions) back together.

[0004] Splicing of pre-mRNA occurs at common sequences near the 5' and 3' ends of the intron, called the 5' (donor) splice site and the 3' (acceptor) splice site (5'ss and 3'ss) by a large dynamic RNA-protein complex called the spliceosome (Nelson KK and Green MRGenes Dev.1989;3:1562-1571). The splice donor site includes a nearly invariant sequence GU in a larger, less highly conserved region at the 5' end of the intron. The splice acceptor site at the 3' end of the intron terminates the intron with a nearly invariant AG sequence. Upstream (5'-direction) of AG is a region with a high content of pyrimidines (C and U), known as a polypyrimidine tract (PTT). The consensus sequence for introns (in IUPAC nucleic acid annotation) is GG-[cut]-GURAGU (donor site)...intron sequence...YURAC (branch sequence 20-50 nucleotides upstream of the acceptor site)...Y-rich-NCAG-[cut]-G (acceptor site). The branch point sequence is a cis-acting intron motif required for mRNA splicing.

[0005] Mutations in 5'ss, 3'ss, BP sequences and polypyrimidine tracts (PPTs) cause genetic diseases by altering splicing efficiency (Faustino NA and Cooper TA Genes Dev. 2003; 17: 419-437). Sometimes, cryptic 5'ss or 3'ss is activated instead of the canonical splice site (Buratti E. et al. Nucleic Acids Res. 2011; 39: D86-D91).

[0006] Eukaryotic genomes contain "authentic" splice sites (which are present in wild-type pre-mRNAs) as well as a large number of cryptic splice sites (css), which are usually maintained as dormant (or undetectably used) sites unless activated by mutations in nearby authentic splice sites. That is, point mutations in the underlying DNA or errors during transcription can activate cryptic splice sites in portions of the transcript that are not normally spliced. This results in mature mRNAs with exon-deleted segments, which can manifest as deletions or truncations in the final protein, or sequences added in exons that disrupt the reading frame and produce different protein sequences or truncated protein sequences due to the inclusion of stop codons.

[0007] Trans-splicing is a splicing reaction that joins two exons from two different RNA molecules. This mechanism occurs naturally in eukaryotic cells, including human cells.

[0008] A review article by Berger et al. (2016WIREs RNA, 7:487-498) describes spliceosome-mediated RNA trans-splicing (SMaRT) as a strategy for designing gene therapy solutions for genetic diseases. SMaRT relies on correcting mutations at the post-transcriptional level by modifying the mRNA sequence. To achieve this, exogenous RNA is usually introduced into the target cell by gene transfer to induce trans-splicing events between the exogenous RNA and the target endogenous pre-mRNA. This produces a chimeric mRNA that partially contains the exons of the latter and partially contains the exons of the former, thereby encoding a sequence without mutations. The main challenge of the SMaRT technology is to achieve a reaction that is as complete as possible, that is, to cause 100% repair of the endogenous mRNA target.

[0009] General Description

[0010] In one aspect, the invention provides an oligonucleotide comprising from 5' to 3':

[0011] a first nucleic acid sequence that is complementary in its 3' to 5' direction to a region in a pre-mRNA or mRNA target molecule;

[0012] a second nucleic acid sequence comprising a heterologous sequence; and

[0013] a third nucleic acid sequence that is complementary in the 3′ to 5′ direction to a nucleic acid sequence in the pre-mRNA or mRNA target molecule that is located upstream of the hybridization site of the first nucleic acid sequence;

[0014] And wherein the first nucleic acid sequence and the third nucleic acid sequence hybridize to the same intron, or the same exon, or consecutive introns and exons, or consecutive exons and introns.

[0015] In one embodiment, the heterologous sequence comprises a sequence that is identical and in the same 5'->3' direction as an exon, intron, splice site, 5'UTR, 3'UTR, or a fragment or portion thereof of a wild-type pre-mRNA or mRNA target molecule.

[0016] In one embodiment, the heterologous sequence encodes a portion of an exon.

[0017] In one embodiment, the oligonucleotide is an antisense oligonucleotide.

[0018] In one embodiment, the oligonucleotide is synthesized as a linear single-stranded molecule and forms an open circular structure upon hybridization to a pre-mRNA target molecule.

[0019] In one embodiment, hybridization of the oligonucleotide to the pre-mRNA or mRNA target molecule masks mutations in the pre-mRNA or mRNA molecule and aligns the second nucleic acid sequence so that the mutant sequence of the pre-mRNA is replaced by the sequence of the wild-type pre-mRNA, thereby allowing translation of a functional protein.

[0020] In one embodiment, hybridization of the oligonucleotide to the pre-mRNA or mRNA target molecule introduces a heterologous motif into the endogenous pre-mRNA or mRNA molecule.

[0021] In one embodiment, the second nucleic acid sequence is associated with a cellular complex.

[0022] In one embodiment, the nucleic acids are ribonucleotides.

[0023] In one embodiment, the mutation site comprises a single base mutation, a substitution, a deletion mutation, an insertion mutation or an insertion-deletion (Indel) mutation.

[0024] In one embodiment, the second nucleic acid sequence comprises (i) a portion of an intron terminating with an acceptor site; (ii) a heterologous sequence to be trans-spliced ​​into the pre-mRNA target molecule; and (iii) a portion of an intron terminating near the acceptor site sequence in a wild-type exon and comprising a donor site and optionally a branch point and PPT sequence.

[0025] In some embodiments, the oligonucleotide is selected from the group consisting of Ocirc 1 (SEQ ID NO: 12), Ocirc 2 (SEQ ID NO: 13), Ocirc 3 (SEQ ID NO: 14), Ocirc 4 (SEQ ID NO: 15), Ocirc 5 (SEQ ID NO: 16), Ocirc 6 (SEQ ID NO: 17), Ocirc 7 (SEQ ID NO: 18) and Ocirc 8 (SEQ ID NO: 19).

[0026] In another aspect, the present invention provides an oligonucleotide comprising from 5' to 3':

[0027] a first nucleic acid sequence that is complementary in its 3' to 5' direction to a region in a pre-mRNA target molecule;

[0028] A second sequence, the second sequence comprising:

[0029] (i) a portion of an intron terminating in an acceptor site;

[0030] (ii) a heterologous sequence to be trans-spliced ​​into the pre-mRNA target molecule; and

[0031] (iii) a portion of an intron containing a donor site and optionally a branch point and PPT sequence that terminates near the acceptor site sequence in the wild-type exon, and

[0032] A third nucleic acid sequence hybridizes in the 3' to 5' direction to a nucleic acid sequence located upstream of the hybridization site of the first nucleic acid sequence in the pre-mRNA target molecule and before the whole or part of the acceptor site sequence.

[0033] In one embodiment, the heterologous sequence comprises a sequence identical to the sequence of an exon, intron, splice site, or fragment or portion thereof of a wild-type pre-mRNA molecule and terminating in the same 5'->3' direction with a YAG acceptor site following the second complementary sequence at the 3' end of the oligonucleotide.

[0034] In one embodiment, the heterologous sequence encodes a portion of an exon.

[0035] In another embodiment, the invention provides a delivery vector or an isolated cell comprising an oligonucleotide of the invention.

[0036] In another aspect, the present invention provides a method for replacing an endogenous nucleic acid sequence, the method comprising contacting an oligonucleotide or a delivery vector of the present invention with a target cell comprising the endogenous nucleic acid sequence.

[0037] In another aspect, the invention provides a method of treating Rett syndrome, the method comprising administering an oligonucleotide or a delivery vector or an isolated cell of the invention to a patient in need thereof.

[0038] In another aspect, the invention provides an oligonucleotide or a delivery vector or an isolated cell of the invention for use in a method of treating Rett syndrome. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] For a better understanding of the subject matter disclosed herein and in order to illustrate how the same may be implemented in practice, embodiments will now be described, by way of non-limiting examples only, with reference to the accompanying drawings, in which:

[0041] Figure 1 Schematic diagram of a point mutation (C to G mutation) between an exon and an intron in a pre-mRNA transcript. This point mutation alters the original splicing position and results in the use of a cryptic splice site.

[0042] Figure 2 is a diagram of an open-circular folded oligonucleotide according to an embodiment of the present disclosure. The folded oligonucleotide is shown in a compressed form. The folded oligonucleotide hybridizes to and masks the original mutation site.

[0043] Figure 3 is a diagram of an open-circular folded oligonucleotide according to an embodiment of the present disclosure, wherein the length of the second nucleic acid sequence exposed upward is the same as the cumulative length of the flap.

[0044] Figure 4 is a diagram of an open-circular folding oligonucleotide according to an embodiment of the present disclosure, wherein the length of the second nucleic acid sequence exposed upward is shorter than the cumulative length of the flaps, thereby correcting the insertion mutation.

[0045] Figure 5 is a diagram of an open-circular folding oligonucleotide according to an embodiment of the present disclosure, wherein the length of the second nucleic acid sequence exposed upward is longer than the cumulative length of the flaps, thereby correcting a deletion mutation.

[0046] Figure 6 is a schematic representation of an open-circular folded oligonucleotide according to an embodiment of the present disclosure, wherein the upwardly exposed second nucleic acid sequence comprises a heterologous motif, such as a sequence motif that serves as a recognition site for an RNA binding protein.

[0047] Figure 7 is a schematic representation of an open-circle folding oligonucleotide according to an embodiment of the present disclosure, wherein the G mutation is masked by a hybridized C.

[0048] Figure 8 is a diagram of a circularly open folding oligonucleotide according to an embodiment of the present disclosure, wherein an inverted C nucleotide is placed at the end of the exposed portion of the circularly open folding oligonucleotide, aligned with the mutated G.

[0049] Figure 9 is a diagrammatic representation of an open-circular folding oligonucleotide according to an embodiment of the present disclosure, wherein a mutated GAG acceptor site sequence is masked and a correct CAG sequence is exposed at the end of the exposed portion of the open-circular folding oligonucleotide.

[0050] Figure 10 is a schematic representation of a folding oligonucleotide according to an embodiment of the present disclosure, wherein the folding oligonucleotide mediates a trans-splicing event to fix a mutation in an acceptor site.

[0051] Figure 11 is a schematic representation of a folding oligonucleotide according to an embodiment of the present disclosure, wherein the folding oligonucleotide mediates a trans-splicing event to repair a mutation in an exon.

[0052] Figure 12 is a schematic representation of a folding oligonucleotide according to an embodiment of the present disclosure, wherein the folding oligonucleotide mediates a trans-splicing event to repair a mutation in an acceptor site.

[0053] Figure 13 Exemplary sequences of folding oligonucleotides of the invention are shown.

[0054] Figure 14 Results of splicing simulations are shown.

[0055] Figure 15 is a schematic representation of the pCMV-Green Renilla Luc plasmid. The black arrow marks the insertion point of the human beta globin 5'UTR (hBB) in the derivative plasmid. The open arrow marks the Green Renilla Luc gene overall, where additional changes were made in the derivative plasmid.

[0056] Figure 16 is a schematic representation of a conventional RNA oligonucleotide binding to the 3' region of intron 3 of the human MECP2 gene, which forms an Ocirc structure upon binding.

[0057] Figure 17Results of running various samples on a polyacrylamide gel are shown: lane 1 - Ocirc template alone, incubated at 70°C; lane 2 - Ocirc template alone, not incubated at 70°C; lane 3 - Ocirc template + Ocirc 1; lane 4 - Ocirc 1 without template and not incubated at 70°C; lane 5 - Ocirc 1 without template and incubated at 70°C; lane 6 - RNA ladder; lane 7 - Ocirc template alone, not incubated at 70°C; lane 8 - Ocirc template + Ocirc 4; lane 9 - Ocirc 4 without template, not incubated at 70°C; lane 10 - Ocirc 4 without template and incubated at 70°C; and lane 11 - RNA ladder. The numbers on the right side of the gel indicate the size of the mRNA ladder (number of nucleotides).

[0058] Figure 18 Results of running various samples on a polyacrylamide gel are shown: Lane 1 - Ocirc template alone; Lane 2 - Ocirc 5; Lane 3 - Ocirc template + Ocirc 5; Lane 4 - RNA ladder; Lane 5 - Ocirc 6; Lane 6 - Ocirc template + Ocirc 6; Lane 7 - Ocirc 7; Lane 8 - Ocirc template + Ocirc 7; Lane 9 - Ocirc template alone; Lane 10 - Ocirc 8; Lane 11 - Ocirc template + Ocirc 8; Lane 12 - RNA ladder. The numbers on the right side of the gel indicate the size of the mRNA ladder.

[0059] Figure 19A and Figure 19B Shown are the results of running various samples on polyacrylamide gels. Figure 19A : Lane 1-Ocirc template alone; Lane 2-Ocirc 1; Lane 3-Ocirc template + Ocirc 1; Lane 4-Ocirc template + Ocirc 1 + recombinant U2AF2 protein; Lane 5-RNA ladder; Lane 6-Ocirc 2; Lane 7-Ocirc template + Ocirc 2; Figure 19B : Lane 1-Ocirc template alone; Lane 2-Ocirc 3; Lane 3-Ocirc template + Ocirc 3; Lane 4-Ocirc template + Ocirc 3 + recombinant U2AF2 protein; Lane 5-RNA ladder; Lane 6-Ocirc 4; Lane 7-Ocirc template + Ocirc 4; Lane 8-Ocirc template + Ocirc 4 + recombinant U2AF2 protein; Lane 9-Ocirc control; Lane 10-Ocirc template + Ocirc control.

[0060] Figure 20Figure 2 is a graphic representation of pH1-Ocirc-AS binding to the 3' region of intron 3 of the human MECP2 gene. DETAILED DESCRIPTION

[0061] The present disclosure provides novel folded oligonucleotides.

[0062] As used herein, the term "oligonucleotide" refers to a molecule consisting of several repeating units (i.e. monomers) of a nucleic acid. In an embodiment, an oligonucleotide is a recombinant nucleic acid. In the context of the present invention, an oligonucleotide is designed so that it can be folded and is referred to herein as a folded oligonucleotide.

[0063] As used herein, the term "folding oligonucleotide" refers to a molecule comprising a nucleotide sequence that is partially complementary to the nucleic acid sequence of a target RNA molecule, wherein upon binding to the target RNA, the oligonucleotide folds in a manner that exposes the heterologous sequence of the nucleic acid, thereby forming a chimeric molecule comprising an endogenous nucleic acid sequence and a heterologous nucleic acid sequence.

[0064] As used herein, the term "heterologous" refers to a nucleic acid sequence that is derived from a non-endogenous source, i.e., is foreign to the cell in which the nucleic acid sequence is expressed. The heterologous sequence may be identical to the wild-type sequence of the target mRNA, thereby correcting a mutation in the endogenous sequence, and / or the heterologous sequence may contain an external motif, such as a recognition site for an RNA binding protein, or any other desired sequence that may react with a cellular complex.

[0065] Thus, the present disclosure provides methods for replacing an original endogenous nucleic acid sequence with a new sequence using the folding oligonucleotides of the present invention.

[0066] The novel folding oligonucleotides of the present invention can be used for at least the following:

[0067] (i) Correction / replacement of genetic mutations in target RNA. Thus, the folded oligonucleotides of the invention can mask nucleic acid mutations in target RNA and expose the corrected, non-mutated sequence (also referred to herein as the "wild-type" sequence) instead of the mutation, thereby allowing normal expression of the target gene; and / or

[0068] (ii) attaching the element to the target RNA. Thus, the folding oligonucleotide of the present invention can be attached to a target nucleic acid-specific motif that can be used as a binding site for various RNA binding proteins (RBPs) to promote translation, splicing and / or silencing processes. For example, the folding oligonucleotide of the present invention can bind to a wild-type sequence in a UTR and attract an RBP.

[0069] As used herein, the term "RNA binding protein" or "RBP" refers to a protein that contains an RNA binding domain and binds to a single-stranded RNA molecule or a double-stranded RNA molecule via a specific sequence motif. Such sequence motifs are usually located in the untranslated region (UTR) of the transcript, but they are also present in introns and exons, such as in splicing enhancers / repressors. RBPs contain various structural elements, such as RNA recognition motifs (RRMs), dsRNA binding domains, zinc fingers, and others.

[0070] RBPs regulate most, if not all, RNA functions in gene expression, including pre-mRNA splicing, mRNA trafficking (localization), RNA processing (e.g., polyadenylation), modification, stability, silencing, and regulation of protein synthesis (translation) via the formation of ribosomes, spliceosomes, and the RNA-induced silencing complex (RISC).

[0071] There are thousands of genes encoding RBPs in humans, and a list of RBPs can be found in the Eukaryotic RBP Database (EuRBPDB). Although not limited thereto, the folding oligonucleotides of the present disclosure can therefore be used to correct genetic mutations by complexing with pre-mRNA or mRNA molecules carrying mutations, such that the translational machinery of the cell will "read" the corrected mature mRNA sequence, thereby causing the synthesis of functional proteins.

[0072] The methods and compounds of the present invention can be used to correct mutations in one or both of the introns and exons of pre-mRNA molecules. In addition, the methods and compounds of the present invention can also be used to correct mutations in the exons of mature mRNA molecules.

[0073] As used herein, the term "mutation" refers to the insertion or deletion of one or more nucleotides, including indel mutations, and substitutions of one or more nucleotides. The term also encompasses point mutations in which a single wild-type nucleotide is substituted by another nucleotide (e.g., Figure 1 C to G mutation exemplified in ).

[0074] In one aspect, the present disclosure relates to compositions and methods for correcting a mutant MeCP2 gene in a cell or subject. The MeCP2 gene refers to the methyl CpG binding protein 2 gene. The MeCP2 protein plays an important role in neural cells such as mature neurons (e.g., as a transcriptional repressor or transcriptional activator). An example of a MeCP2 gene is represented by GenBank Accession No. NM_001110792 (MeCP2-e1). Another example of a MeCP2 gene is represented by Genbank Accession No. NM_001110792 (MeCP2-e2).

[0075] MeCP2 mutations are the leading cause of Rett syndrome, a neurodevelopmental disorder. Multiple types of mutations in the gene can cause the disease, including mutations in the splice site between intron 3 and exon 4, C to G mutations that eliminate the normal splice site and cause mis-splicing events.

[0076] Therefore, in one aspect, the present invention provides a method for treating Rett syndrome, comprising administering the folded oligonucleotide of the present invention or a vector comprising the folded oligonucleotide to a patient in need thereof.

[0077] The folding oligonucleotide can be used to correct any mutation in the MeCP2 gene, including but not limited to the C to G point mutation that causes mis-splicing events.

[0078] As used herein, "treating" Rett syndrome means administering to an individual a composition comprising an oligonucleotide of the invention by any suitable dosage regimen, schedule, and / or route of administration, with the goal of achieving a desired clinical / medical endpoint, including but not limited to halting or slowing progression of the disease, reversing or alleviating symptoms of the disease.

[0079] Open-loop folded oligonucleotide

[0080] The present disclosure relates to folding oligonucleotides and methods for compensating nucleic acid mutations in target nucleic acid sequences using oligonucleotides (also referred to herein as Ocirc oligonucleotides) that can fold into open ring structures. The open ring structure formed by the folding oligonucleotides of the present invention when hybridizing with a target molecule is similar to the structure of circular RNA (circRNA), except that it is open (not forming a closed loop). In some embodiments, the folding oligonucleotides of the present invention are synthesized as circular RNA. However, it should be emphasized that the assumed role of circRNA in nature is different from the proposed use of the folding oligonucleotides of the present invention.

[0081] The folded oligonucleotides of the invention may be produced synthetically using methods known in the art and administered to the cell, or they may be natural RNA, in which case the oligonucleotide is produced, for example, by a gene / plasmid inserted into the cell nucleus.

[0082] In an embodiment, the folding oligonucleotide is an antisense molecule (also referred to herein as an "open circular antisense oligonucleotide (ASO)" or OcircASO).

[0083] The folding oligonucleotide is produced as a linear single-stranded molecule and upon interaction with the target sequence, it folds into an open circular structure.

[0084] The folding oligonucleotide may comprise ribonucleotides, deoxyribonucleotides, nucleic acid analogs, or any combination thereof.

[0085] In one embodiment, the folding oligonucleotide comprises three parts from 5' to 3':

[0086] a first nucleic acid sequence that is complementary in its 3' to 5' direction to a nucleic acid sequence in a pre-mRNA or mRNA target molecule;

[0087] a second nucleic acid sequence comprising a heterologous sequence, i.e., a sequence that mimics an exon, intron, splice site, 5'UTR, 3'UTR, or fragment thereof of a wild-type pre-mRNA or mRNA target molecule and is in the same 5'->3' direction; and

[0088] A third nucleic acid sequence that is complementary in the 3' to 5' direction to a nucleic acid sequence located upstream of the hybridization site of the first nucleic acid sequence in the pre-mRNA or mRNA target molecule.

[0089] As used herein, the term "from 5' to 3'" refers to the directionality or orientation of nucleotides in a single strand of DNA or RNA. 5' and 3' specifically refer to the 5th and 3rd carbon atoms in the deoxyribose / ribose sugar ring forming the 5' and 3' ends.

[0090] The first and third nucleic acid sequences that hybridize to the target mRNA or pre-mRNA are also referred to herein as "binding sites" or "flaps."

[0091] According to the present invention, the first nucleic acid sequence and the third nucleic acid sequence do not hybridize to consecutive introns, which is obviously opposite to the trans-splicing methods known in the art. The first nucleic acid sequence and the third nucleic acid sequence will hybridize to the same intron, the same exon, or consecutive introns and exons, or consecutive exons and introns.

[0092] In one embodiment, the first and third nucleic acid sequences are designed and synthesized so that they will be complementary to and thus hybridize to a continuous nucleic acid segment in the target molecule. That is, the 3' to 5' sequence of the first and third sequences is complementary to the 5' to 3' continuous sequence of the target molecule.

[0093] In another embodiment, the first nucleic acid sequence and the third nucleic acid sequence are designed and synthesized so that they will be complementary to and thus hybridize with non-sequential or non-contiguous nucleic acid segments in the target molecule. That is, the hybridization sites of the first nucleic acid sequence and the third nucleic acid sequence on the pre-mRNA or RNA target molecule are separated by the nucleic acid segment.

[0094] Because the first sequence and the third sequence are complementary to the nucleic acid segment in the target (a nucleic acid segment is upstream of another nucleic acid segment, continuously or separated by the nucleic acid segment), after the first sequence and the third sequence are hybridized with the target molecule, the oligonucleotide of the present invention itself is folded at both 5' ends and 3' ends. Due to spatial interaction, the structure of the folded oligonucleotide is spatially expanded into an open-loop structure. In the open-loop structure, the first nucleic acid sequence and the third nucleic acid sequence face the target sequence and are complementary to the target sequence, and the second nucleic acid sequence turns upwards away from the target. The second nucleic acid sequence can have the same sequence as the wild-type sequence, thereby correcting the mutation, or it can replace or additionally comprise a heterologous sequence that is different from the sequence of wild-type pre-mRNA or RNA target molecule, thereby introducing a heterologous element or motif, for example, a sequence motif used as a recognition site for RNA binding proteins into an endogenous molecule. Based on the sequence of nucleotides, the second nucleic acid sequence can generate a tertiary structure.

[0095] One embodiment of the folded oligonucleotide of the present invention is Figure 2 The middle panel shows an open-circular folded oligonucleotide in a compressed form.

[0096] According to this embodiment of the invention, the folding oligonucleotide comprises: a first nucleic acid sequence that hybridizes to a sequence downstream of the cryptic region and is part of the PPT;

[0097] a second nucleic acid sequence that is oriented upward and has a sequence that mimics the PPT sequence of a wild-type pre-mRNA and is in the same 5'->3' direction; and

[0098] A third nucleic acid sequence that hybridizes to and masks the upstream cryptic region (see Figure 1 Notes on the hidden areas in the middle and upper reaches).

[0099] In an embodiment, at least one of the nucleic acid sequences complementary to the pre-mRNA or mRNA target has a length that determines high specificity and strong hybridization ability (a non-limiting example is a sequence of about 15 nucleotides), and the second nucleic acid sequence complementary to the pre-mRNA or mRNA target may be a short sequence of lower specificity, or it may have a length that also determines high specificity and strong hybridization ability.

[0100] In one embodiment, the length of the second nucleic acid sequence exposed upward is the same as the cumulative length of the flap, and the heterologous sequence is identical to the wild-type sequence, thereby correcting the mutation. Figure 3 The middle figure shows the correction of a point mutation as an example.

[0101] In another embodiment, the folding oligonucleotide of the present invention is used to correct an insertion mutation. In such a case, the length of the second nucleic acid sequence exposed upward is shorter than the cumulative length of the flap, and the heterologous sequence is identical to the wild-type sequence, thereby correcting the mutation. This embodiment is Figure 4 As shown in the figure.

[0102] In another embodiment, the folding oligonucleotide of the present invention is used to correct a deletion mutation. In such a case, the length of the second nucleic acid sequence exposed upward is longer than the cumulative length of the flap, and the heterologous sequence is identical to the wild-type sequence, thereby correcting the mutation. This embodiment is Figure 5 As shown in the figure.

[0103] In another embodiment, the folding oligonucleotides of the present invention are used to introduce heterologous motifs into target mRNA or pre-mRNA molecules, with or instead of mutations. In such cases, the length of the second nucleic acid sequence exposed upward can be longer or shorter than the cumulative length of the flap, and the heterologous sequence contains a sequence motif that serves as a recognition site for an RNA binding element (e.g., an RNA binding protein), which can be used as a recognition site for attracting various enzymes or ribozymes that may affect the translation process. This embodiment is Figure 6 As shown in the figure.

[0104] An open circular folding oligonucleotide refers to a circular structure that is not closed. However, in one embodiment, the folding oligonucleotide is chemically closed to generate a completely circular molecule.

[0105] In one embodiment, the folding oligonucleotide is from about 40 to about 200 bases in length.

[0106] Figures 7 - 9 Schematic diagrams of various embodiments of the open-loop folding oligonucleotides of the present invention are provided. In these specific exemplary embodiments, the folding oligonucleotide corrects the C to G mutation by replacing the G back to the wild-type C. The accompanying drawings schematically illustrate the spatial ring structure formed by the folding oligonucleotide.

[0107] Figure 7 is a schematic diagram of one embodiment of the present invention showing an open-circular folded oligonucleotide in which a G mutation is masked by a hybridized C.

[0108] Add C to the end of the exposed part of the Ocirc folded oligonucleotide, before the AG of the original acceptor site.

[0109] Figure 8 is a schematic diagram of another embodiment of the present invention, showing an open-circular folding oligonucleotide in which the G mutation is retained, but an inverted C nucleotide is placed at the end of the exposed portion of the Ocirc folding oligonucleotide, aligned with the mutated G.

[0110] Reverse base oligonucleotides are oligonucleotides having a 5'-5' linkage or a 3'-3' linkage or a combination of these linkages in the same oligonucleotide.

[0111] Figure 9 is a schematic diagram of another embodiment of the present invention showing an open-circular folded oligonucleotide in which a mutated GAG acceptor site sequence is masked.

[0112] The correct CAG sequence was placed at the end of the exposed portion of the Ocirc fold oligonucleotide.

[0113] Example 1 below shows the corresponding Figures 7 - 9 Sequences of three representative folding oligonucleotide molecules (1, 2 and 3) of the folding oligonucleotide schematically represented in FIG.

[0114] Variable splice acceptor sites can be designed using dedicated tools (e.g., NetGene2), for example, as shown in Example 1 below, which presents NetGene2 simulation results that estimate the confidence of potential splice acceptor sites. In one embodiment, the variable splice acceptor site is represented by SEQ ID NO: 31.

[0115] The sequences are planned to achieve optimal results while attempting to minimize "stacking" of the folding oligonucleotides with each other or undesired hybridization of parts of the folding oligonucleotide molecules.

[0116] Various solutions can be adopted to reduce stacking, all of which involve introducing nucleic acid changes into the sequence to avoid further binding of folded oligonucleotides to each other. For example, one solution can include introducing minor changes in the selected PPT sequence, i.e., one or more nucleic acid substitutions, thereby presenting a PPT slightly different from the natural wild-type sequence, but still maintaining the characteristics of a strong PPT. Another solution related to the situation in which the mutation is in the exon will be to introduce nucleic acid substitutions, which will change the nucleic acid sequence, but still maintain codon reading. This solution is based on codon redundancy, i.e., different codon groups can encode the same amino acid. Therefore, although the nucleic acid sequence is changed, the correct amino acid sequence is still maintained.

[0117] In another embodiment, the open-circle folding oligonucleotide may also comprise a binding site for an RNA binding protein.

[0118] In aspects of the invention, the folding oligonucleotide may function via a trans-splicing mechanism.

[0119] The Ocirc molecules of the present invention may comprise one or more modified nucleotides to increase the stability of the molecule. Modified nucleotides include, but are not limited to, 2'-O-methyl modified nucleotides, LNA (locked nucleic acid) modified nucleotides, or 2'MOE (2'-O-methoxyethyl / phosphorothioate) modified nucleotides. One, two, three, four, five or six nucleotides may be incorporated into either end of the Ocirc arm. In addition, the entire arm may comprise modified nucleotides, and the nucleotides selected from the rest of Ocirc may also be modified nucleotides.

[0120] Folded oligonucleotide for trans - splicing

[0121] In known trans-splicing methods, in order to achieve trans-splicing events, antisense oligomers (also called antisense oligonucleotides) (ASOs) must include entire exons, which are usually hundreds of nucleotides long. The reason is that trans-splicing events rely on natural splicing cues located at intron-exon junctions.

[0122] In contrast, the folding oligonucleotide according to the present invention can be shorter and does not necessarily contain a complete exon sequence. In certain embodiments, the folding oligonucleotide can be between about 100-200 nucleotides long.

[0123] Trans-splicing according to the present invention will not occur in the original true splice site, but will employ "pseudo" acceptor and donor sequences present within the relevant exon.

[0124] Therefore, the folding oligonucleotide of the present invention comprises an alternative splice acceptor site, followed by a sequence identical to the target exon (referred to as an "artificial exon" or "synthetic exon"). If the mutation is in an intron, the folding oligonucleotide of the present invention will mask the mutation region, generate a new splice junction, and will also comprise a sequence identical to the "disabled" sequence of the wild-type target exon.

[0125] Figure 10 A schematic diagram of an embodiment of the present invention is described. Accordingly, if the mutation is in an intron (e.g., in an acceptor site), the trans-splicing event will replace the mutant sequence with an artificial exon with a wild-type sequence. According to this embodiment, the folding oligonucleotide comprises: a first sequence that hybridizes with the pre-mRNA and optionally masks a potential hidden site, a part of an artificial intron that includes an acceptor site, an artificial exon that replaces a part of an original exon, a part of an artificial intron whose acceptor site is derived from an original exon, and another sequence that hybridizes with the pre-mRNA.

[0126] If the mutation is in an exon, the trans-splicing event will replace the mutant sequence with an artificial exon having the wild-type sequence. According to this embodiment, both the donor site and the acceptor site are derived from the original nucleic acid sequence of the mutant exon. A schematic of this embodiment is shown in Figure 11 as shown.

[0127] To illustrate the trans-splicing event according to the present invention, Figure 1 a schematic showing an exemplary intron mutation of a C to G mutation in a pre-mRNA transcript is provided. This mutation causes the activation of a cryptic splice site (two nucleotides upstream of the correct, authentic splice site). Activation of the cryptic splice site causes a frameshift, resulting in a mutant mRNA transcript.

[0128] As Figure 10 shown, the folded oligonucleotide of the present invention contains a variable splice acceptor site instead of the mutant acceptor site (e.g., the GAG cryptic site as shown in Figure 1 ), followed by an artificial exon that is identical to the relevant portion of the target exon.

[0129] The folded oligonucleotide also contains an artificial intron sequence that terminates in a polypyrimidine tract (PPT) immediately adjacent to the YAG acceptor site (the conserved 3' splice site required for pre-mRNA splicing) that is part of the original exon sequence.

[0130] Accordingly, the present invention provides a folded oligonucleotide that, from 5' to 3', comprises:

[0131] a first complementary sequence between about 10 and 15 bases (e.g., ~12 bases) in length that is complementary to and capable of hybridizing with a mutant region, wherein the mutant region comprises a mutation site, a downstream cryptic site, and an upstream cryptic site;

[0132] a trans-splicing variable acceptor site that comprises a preceding strong PPT;

[0133] a sequence identical to the original exon sequence between the end of the first complementary sequence at the 5' end of the folded oligonucleotide and 3 nucleotides (YAG acceptor site) after a second complementary sequence (at the 3' end of the folded oligonucleotide);

[0134] an artificial intron that includes a donor site, a branch point, and a PPT and terminates immediately adjacent to the YAG sequence that is part of the original exon;

[0135] a second complementary sequence between about 10 and 15 bases (e.g., ~12 bases) in length that is complementary to and capable of hybridizing with the sequence preceding the YAG acceptor site.

[0136] As used herein, the term "strong PPT" refers to a polypyrimidine tract (PPT) that can strongly attract (e.g., have a competitive advantage in attracting) the spliceosome to splice at a splice site adjacent to the PPT. The PPT is an important cis-acting sequence element that guides intron removal in pre-mRNA splicing. The specific sequence of the PPT exhibits great flexibility and has different levels of functional competitive efficiency in guiding the spliceosome to the splice site. There are known methods for preparing strong PPTs, for example, it was found that a pyrimidine tract containing 11 consecutive uridines is a very strong pyrimidine tract (Coolidge et al., (1997) Nucleic Acid Res. 25 (4): 888-896).

[0137] In an embodiment, at least one of the nucleic acid sequences complementary to the pre-mRNA or mRNA target has a length that determines high specificity and strong hybridization ability (a non-limiting example is a sequence of about 15 nucleotides), and the second nucleic acid sequence complementary to the pre-mRNA or mRNA target may be a short sequence of lower specificity, or it may have a length that also determines high specificity and strong hybridization ability. Figure 12 Schematically illustrated in , which demonstrates the correction of a mutation in the receptor site.

[0138] Typically, the GURAGU donor site can also be located in an exon and continued in the first artificial intron within the folding oligonucleotide. Since the probability of finding a GU or GUR sequence in an exon is much higher than the full donor sequence, the desired sequence can be separated between the exon and the folding oligonucleotide. The same applies to the acceptor site (continuing the second artificial intron), whose full sequence is YNCAG. (R: A or G, Y: C or T, N: any nucleotide). The folding oligonucleotide contains an exon sequence that will replace the original exon sequence encoded by the endogenous gene, i.e., a 5' and / or 3' splice site, whose strength must be equal to or even stronger than the splice site carried by the pre-mRNA.

[0139] Folding oligonucleotides can be introduced into cells by any method known in the art, non-limiting examples include transfection of plasmids carrying genes expressing folding oligonucleotides, use of recombinant viral vectors (e.g., adeno-associated viruses (AAV)) that will express folding oligonucleotides, lipid encapsulation, etc. In the case where it is necessary to correct mRNA or pre-mRNA in the brain, a special delivery vehicle will be selected for introducing the folding oligonucleotide into the brain. Such a vehicle will be selected based on its ability to cross the blood-brain barrier (BBB) ​​and injected via the spinal cord.

[0140] Recombinant AAV (rAAV) vectors according to the invention typically comprise at least a transgene (ie, a folded oligonucleotide of the invention) and 5' and 3' AAV inverted terminal repeats, operably linked to regulatory sequences allowing its expression in cells of a target tissue.

[0141] As used herein, the term "about" indicates that the value may deviate from the indicated value, up to 1%, more specifically 5%, more specifically 10%, more specifically 15%, and in some cases up to 20% higher or lower than the indicated value, and the deviation range includes integer values, and if applicable, also includes non-integer values, constituting a continuous range. It will be understood that the disclosure and description are not limited to the specific embodiments, method steps and compositions disclosed herein, because such method steps and combinations may vary slightly. It should also be understood that the terms used herein are only for the purpose of describing specific embodiments, and are not intended to be limiting, because the scope of the present invention will be limited only by the appended claims and their equivalents.

[0142] It must be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the content clearly dictates otherwise.

[0143] Throughout this specification and the examples and appended claims, unless the context requires otherwise, the term "comprise" and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[0144] Example

[0145] Example 1: Simulation of representative folded oligonucleotides

[0146] like Figure 13 As shown in (Options 1, 2 and 3), representative, exemplary folded oligonucleotide molecules designated as Ocirc 1, Ocirc 2 and Ocirc 3 (corresponding to SEQ ID NOs: 12-14, respectively) were constructed. These oligonucleotide molecules correspond to Figures 7 - 9 A folded oligonucleotide is schematically represented in FIG.

[0147] The "arms" of these folding oligonucleotide molecules were designed to pair with sequences that bridge the end of intron 3 and the beginning of exon 4 of MECP2.

[0148] like Figures 7 - 9As indicated, the folded oligonucleotide contains a PPT portion. According to these options, a portion of the original PPT sequence of intron 4 is replaced with a new sequence of a portion of the Ocirc molecule.

[0149] To design the optimal PPT portion, splicing simulations were performed using Netgene2, a software tool that predicts splice junctions based on a given intron and exon sequence.

[0150] To search for sequences with potential splice sites, the following sequence (designated as SEQ ID NO:27) derived from Homo sapiens chromosome X, GRCh38.p13, NC_000023.11:c154031955-154030936 was used for the simulation:

[0151]

[0152] The following sequences (which are fragments of the above-mentioned base sequence) were selected as potential splice sites by a simulation tool:

[0153] AATGTTCTAG^ATGGTGACTC (SEQ ID NO:28)

[0154] GGTGACTCAG^GCCCAGGCAC (SEQ ID NO:29)

[0155] TCAGGCCCAG^GCACCAACCA (SEQ ID NO:30)

[0156] GTCCCCGCAG^TCCCCAGGGA (SEQ ID NO:31)

[0157] CAGTCCCCAG^GGAAAAGCCT (SEQ ID NO:32)

[0158] CAGGGAAAAG^CCTTTCGCTC (SEQ ID NO:33)

[0159] CGCTCTAAAG^TGGAGTTGAT (SEQ ID NO:34)

[0160] TAAAGTGGAG^TTGATTGCGT (SEQ ID NO:35)

[0161] ATCCACCCAG^GTCATGGTGA (SEQ ID NO:36)

[0162] GCCCCGGCAG^GAAGCGAAAA (SEQ ID NO:37)

[0163] CGGCAGGAAG^CGAAAAGCTG (SEQ ID NO:38)

[0164] AAGCGAAAAG^CTGAGGCCGA (SEQ ID NO:39)

[0165] The ^ symbol indicates the intersection between the intron (on the left) and the exon (on the right).

[0166] The analysis results are presented in Figure 14 The confidence score is a numerical value usually in the range from 0 to 1, where a higher value indicates a higher level of confidence in the prediction. That is, a higher confidence score indicates a higher likelihood that the predicted splice site is accurate. "Phase" can have one of three values: 0, 1, or 2.

[0167] Phase 0 splice site indicates that the predicted splice site corresponds to the canonical phase for splicing. In other words, the intron-exon boundary is correctly aligned with the reading frame, ensuring that the protein coding sequence is not disrupted during translation. Phase 0 splice site is the most common and preferred phase in many genes.

[0168] Phase 1 splice sites show that the intron-exon boundary has shifted by one nucleotide compared to the canonical phase. This shift can cause a slight disruption of the reading frame, potentially leading to a different amino acid sequence in the protein product.

[0169] Phase 2 splice sites indicate that the intron-exon boundary is shifted by two nucleotides relative to the typical phase. This results in a more significant disruption of the reading frame, potentially leading to a different amino acid sequence, and often introduces a premature stop codon, which may affect protein function.

[0170] Knowing the phase of predicted splice sites is essential for accurate gene annotation and predicting the functional consequences of splice site variation. Researchers and biologists can use this information to assess how a given mutation or alternative splice site may affect the final protein product and its function.

[0171] Based on the confidence value, Figure 14 The highlighted sequence in (SEQ ID NO:31) was selected as having the highest likelihood of being a splice site (indicated by the letter H).

[0172] Example 2: Preparation of template plasmid used as target for Ocirc oligonucleotide

[0173] All plasmids were constructed based on the same original plasmid pCMV-green Renilla Luc. This plasmid was purchased from Thermo Fisherscientific, catalog number: 16153. The map of the plasmid is Figure 15 Shown in.

[0174] Based on the nucleotide sequence of the plasmid (referred to herein as SEQ ID NO: 1), the following features are present in the plasmid:

[0175] Cytomegalovirus (CMV) promoter: 8-635

[0176] Green Renilla luciferase gene: 646-1581

[0177] BGH poly(A) signal: 1590-1715

[0178] SV40 origin / promoter: 1716-2280

[0179] Puromycin resistance gene: 2281-2880

[0180] SV40 poly(A) signal: 3042-3075

[0181] β-lactamase (Amp R )Gene: 3184-4044

[0182] pUC origin of replication (pUC Ori): 4223-5027

[0183] Transcription terminator (Ter): 5028-5635

[0184] Lac operator gene 1 (Lac O1): 5636-5656

[0185] Transcription pause site (TPS): 5789-5860

[0186] The sequence of the plasmid (designated as SEQ ID NO: 1) is as follows:

[0187]

[0188] Several derivative plasmids were generated from the base plasmid (by GeneScript, Singapore).

[0189] All derivative plasmids have the following region of human beta globin 5'UTR (hBB) inserted between the CMV promoter and the green sea renilla Luc gene (designated as SEQ ID NO: 2). Figure 15 The black arrow marks the insertion point.

[0190] SEQ ID NO:2:

[0191] 5'ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC-3'

[0192] In addition, an intron sequence was inserted into the plasmid at the location of the green Renilla luciferase (Luc) gene, as will be described in detail below.

[0193] Plasmid pCMV - RLuc - Int_WT

[0194] Insert the intron into the green Renilla Luc gene at the following position:

[0195]

[0196] This insertion point was chosen because it contains sequence features of the exon end (AG) and exon start (GT). These are marked in bold and underlined in the sequence above.

[0197] The following "intron" sequence (designated SEQ ID NO: 3) was inserted at the position indicated above:

[0198]

[0199] The first portion of the inserted intron (underlined) contains 84 nucleotides from the 5' end of the first intron of the human beta globin gene (sequence taken from the human genome available on the UCSC genome website).

[0200] The second part of the intron (in bold) contains 200 nucleotides from the 3' region of intron 3 of the human MECP2 gene.

[0201] After insertion, the derivative plasmid, referred to as "plasmid pCMV-RLuc-Int_WT", had the following sequence (designated SEQ ID NO: 4):

[0202]

[0203] Plasmid pCMV - RLuc - Int_Mut

[0204] Another derivative plasmid was generated that has a mutation at the splice acceptor site, like the mutation in the MECP2 gene that causes Rett syndrome in patients. The mutation (C to G substitution) located at the first two nucleotides from the end of the sequence below is shown in italics and underlined.

[0205] In this case, the following mutated "intron" sequence (designated SEQ ID NO:5) was inserted at the position indicated above:

[0206]

[0207] After insertion, the derivative plasmid, referred to as "plasmid pCMV-RLuc-Int_Mut", had the following sequence (designated SEQ ID NO: 6):

[0208]

[0209] Plasmid pCMV - RLuc - AltInt_WT

[0210] Another derivative plasmid was generated by inserting the same WT intron (SEQ ID NO: 3) as above into a different position within the plasmid, more closely mimicking the beginning of the 4th exon of the MECP2 gene (starting with TCC). The insertion point is shown in bold in SEQ ID NO: 7 presented below, i.e.:

[0211]

[0212] After insertion, the derivative plasmid, referred to as "plasmid pCMV-RLuc-AltInt_WT", had the following sequence (designated SEQ ID NO: 7):

[0213]

[0214]

[0215]

[0216] Plasmid pCMV - RLuc - AltInt_Mut

[0217] This derivative plasmid is similar to the alternative plasmid described above, but contains a mutated intron insert sequence (SEQ ID NO: 5) instead of the WT intron. That is, in this plasmid, the intron is identical to that of pCMV-RLuc-Int_Mut, contains a mutant splice acceptor site, but is inserted at a variable site.

[0218] After insertion, the derivative plasmid, referred to as "plasmid pCMV-RLuc-AltInt_Mut", had the following sequence (designated SEQ ID NO: 8):

[0219]

[0220] Plasmid pCMV - RLuc - AltInt_WTBPMut

[0221] Finally, additional derivative plasmids are generated. The derivative plasmid contains the WT intron sequence, in which the splice branch point signal sequence is mutated to a sequence that is not recognized as a branch point (shown in bold and underlined). This intron sequence is designated as SEQ ID NO:9:

[0222]

[0223] After insertion, the derivative plasmid designated "plasmid pCMV-RLuc-AltInt_WTBPMut" has the following sequence (designated as SEQ ID NO:10):

[0224]

[0225] Example 3: Generation of Ocirc RNA oligonucleotides

[0226] All RNA oligonucleotides were synthesized by IDT.

[0227] Conventional RNA oligonucleotides were designed to match a specific sequence in the 3' region of the third intron of human MECP2. Figure 16 is a schematic representation showing the structure after RNA oligonucleotide binding. The start of the 4th exon of MECP2 is indicated. The splice acceptor is shown in bold letters (GAG), and the mutated nucleotide (G replaces C) is shown in italics. The Ocirc sequence is shown at the top: the highlighted sequence is the 5' antisense arm, and the sequence not highlighted is the 3' antisense arm. The dotted line represents the RNA sequence present between the arms of the Ocirc molecule. Generally, it can be any selected sequence. In this specific embodiment, it has a PPT sequence and is designed to bind to spliceosomal proteins. The black line marks the contact area of ​​the two arms of Ocirc on the MECP2 sequence template. The underlined area is the PPT sequence of the human MECP2 gene. The Ocirc sequence becomes attached to the PPT sequence through base pairing.

[0228] The following oligonucleotides were used (in the sequence listing, uracil nucleotides (U) were replaced by thymine nucleotides (T)):

[0229] Ocirc-Template (designated as SEQ ID NO: 11):

[0230]

[0231] Ocirc-1 (designated as SEQ ID NO: 12):

[0232] 5'-ACAGAAAGACGCCCCUUAUUCGUCCCCGCCUGGGGACAA-3'

[0233] Ocirc-2 (designated as SEQ ID NO: 13):

[0234] 5'-ACAGAAAGACCGCCCCCUUAUUCGUCCCG[3'-3'-C-5'-5']UGGGGACAA-3'

[0235] Ocirc-3 (designated as SEQ ID NO: 14):

[0236] 5'-AAACAGAAAGCCCCCUUAUUCGUCCCCCAGCUCUGGGGAC-3'

[0237] Ocirc-4 (designated as SEQ ID NO: 15):

[0238] 5'-AGAAAGACACAAUCUCUGCCUAGCCCCCUUAUUCGUCCCCGCCUGGGGACAAAC-3'

[0239] Ocirc-5 (designated as SEQ ID NO: 16):

[0240] 5'-AGAAAGACACAAUCUCUGCCUACGCCCCCUUAUUCGUCCCG[3'-3'-C-5'-5']UGGGGACAAAC-3'

[0241] Ocirc-6 (designated as SEQ ID NO: 17):

[0242] 5'-ACAGAAAGACACUCUCUGCCUACCCCUUAUUCGUCCCCCAGCUCUGGGGACAA-3'

[0243] Ocirc-7 (designated as SEQ ID NO: 18):

[0244] 5'-GACAAACAGAAAGACGCCCCUUAUUCGUCCCCGCCUGGG-3'

[0245] Ocirc-8 (designated as SEQ ID NO: 19):

[0246] 5'-GACAAACAGAAAGACACAAUCUCUGCCUAGCCCCCUUAUUCGUCCCCGCCUGGG-3'

[0247] Ocirc-Cont (designated as SEQ ID NO: 20):

[0248] 5'-GCUCGUCACAGGCCCCUUAUUCGUCCCCGCUAGCAGCGAU-3'

[0249] Example 4: In vitro binding of Ocirc oligonucleotides to RNA templates

[0250] To test whether Ocirc RNA oligonucleotides were able to bind to the template (Ocirc-Temp), the Ocirc oligonucleotides were each mixed with the template using the concentrations described in Table 1 below.

[0251] Table 1: Hybridization of RNA oligonucleotides

[0252]

[0253]

[0254] The stock concentration of each of the tested oligonucleotides was 20 μM, and the final concentration was 10 μM. For samples 1-3, the final volume of the reaction was 40 μl, containing 20 μl oligonucleotide + 20 μl hybridization buffer (in phosphate buffered saline (PBS) (PBS is 137 mM NaCl, 2.7 mM KCl, 10 mM Na 2 HPO 4 and 1.8 mM KH 2 PO 4 ) in 2 mM MgCl 2 ), and 20 μl of each oligonucleotide was included in Sample 4 and Sample 5.

[0255] The samples were incubated at 70°C for 5 minutes, slowly cooled (over 30 minutes) to room temperature, and placed on ice. The samples were then prepared by adding running buffer (50 μl SBx2-0.025M Tris, 0.192M glycine pH: 8.3) to run on an acrylamide gel. For each sample, the amount loaded was 0.15 μg / lane in a volume of 20 μl / lane. The sample concentration was 0.008 μg / μl and the final volume was 100 μl, as detailed in Table 2 below.

[0256] Table 2: Preparation of samples for gel loading (Ocirc 1 and Ocirc 4)

[0257]

[0258] The samples were loaded onto an acrylamide gel and separated by running under standard conditions.

[0259] like Figure 17 As shown in , mixing of template RNA (Ocirc-temp) with Ocirc 1 (see lane 3 - Ocirc template + Ocirc 1) or Ocirc 4 (see lane 8 - Ocirc template + Ocirc 4) resulted in slower migrating species indicating binding of Ocirc 1 and Ocirc 4 to the template RNA. See also Figure 19A and Figure 19B .

[0260] Similar experiments were performed with Ocirc 5, Ocirc 6, Ocirc 7 and Ocirc 8 under the same conditions, as detailed in Table 3 below.

[0261] Table 3: Preparation of samples for gel loading (Ocirc 5-Ocirc 8)

[0262]

[0263]

[0264] like Figure 18 As shown in FIG, mixing of template RNA (Ocirc-temp) with each of Ocirc 5 (see lane 3—Ocirc template+Ocirc 5), Ocirc 6 (see lane 6—Ocirc template+Ocirc 6), Ocirc 7 (see lane 8—Ocirc template+Ocirc 7), and Ocirc 8 (see lane 11—Ocirc template+Ocirc 8) resulted in slower migrating species indicating that Ocirc 5, Ocirc 6, Ocirc 7, and Ocirc 8 were bound to the template RNA.

[0265] Similar experiments were performed with Ocirc 2 and Ocirc 3 under the same conditions, as detailed in Table 4 below.

[0266] Table 4: Preparation of samples for gel loading (Ocirc 2 and Ocirc 3)

[0267]

[0268] U2AF2 is a protein that binds to PPT sequences and splicing acceptor sequences and contributes to splicing events. To test the possible binding of U2AF2 protein to the complex of Ocirc+ template RNA, the Ocirc+ template RNA oligonucleotides were first hybridized as described above. They were then mixed with U2AF2 protein (ACRIS) in binding buffer (final concentration: HEPES-KOH (pH 7.6) 20mM, KCl 100mM, EDTA 0.2mM, DTT 0.5mM). The samples were incubated at 4°C for 1 hour. The preparation for loading on the gel was as described above. The results are inconclusive.

[0269] As observed for other Ocirc molecules, Ocirc 2 (see Figure 19A Lane 7 - Ocirc template + Ocirc2) or Ocirc 3 (see Figure 19B Lane 3 - Mixture of Ocirc template + Ocirc 3) with template RNA produces a slower migrating species indicating binding to template RNA. The control Ocirc RNA oligonucleotide with arms that do not match the template RNA did not show any binding to the template RNA.

[0270] Example 5: Testing Ocirc RNA oligonucleotides in cells

[0271] The plasmid set described in Example 2 above, namely: pCMV-Rluc-Int-WT, pCMV-Rluc-Int-Mut, pCMV-Rluc-AltInt-WT, pCMV-Rluc-AltInt-Mut (as used herein, Rluc refers to Renilla luciferase) was used in the following examples.

[0272] As described above, all plasmids contain the 3' region of the 3rd intron of the MECP2 gene. In the group of pCMV-Rluc-Int-WT and pCMV-Rluc-Int-Mut, the intron is inserted between the AG-GT sequence of the Renilla luciferase gene, so that the intron starts after AG and ends before GT. This insertion site is very convenient for experimental purposes.

[0273] As an alternative that more closely represents the in vivo MECP2 gene, in the pCMV-Rluc-AltInt-WT and pCMV-Rluc-AltInt-Mut groups, an intron was inserted between the AG-TCC nucleotides of the Renilla luciferase gene. The TCC forms the beginning of exon 4 of the MECP2 gene and is a non-standard and rare exon start.

[0274] Experimental protocol:

[0275] The cell line HEK293 (Human Embryonic Kidney 293) was used in all experiments.

[0276] 100,000 cells were seeded per well of a 24-well plate.

[0277] Lipofectamine MessengerMAX reagent (Invitrogen) was used for transfection as it is suitable for both DNA and RNA. Setup experiments determined that 0.75 μl Lipofectamine and a plasmid concentration of 0.5 μg / well gave the best results.

[0278] All protocols were performed according to the manufacturer's instructions.

[0279] Cells were collected 48 hours after independent plasmid or plasmid+oligonucleotide (Ocirc) transfection. Cells were lysed in the buffer supplemented in the test kit (Renilla-Glo luciferase assay system, promega) for Renilla luciferase assay, and Renilla luciferase activity was measured according to the manufacturer's scheme. Reading was completed using 96 orifice plates on a photometer.

[0280] Table 5 shows the results obtained for the two plasmid groups.

[0281] Table 5: Results of Renilla luciferase assay

[0282] Treatment Mean STDEV Untransfected 6379 5593 Plasmid - free 15142 2266 pCMV - Rluc - Int_WT 5 1μg 6228320 1532800 pCMV - Rluc - Int_Mut 8 1μg 605617 236647 pCMV - Rluc - AltInt_WT 11 1μg 6649772 244040 pCMV - Rluc - AltInt_Mut 14 1μg 64186 17580 pCMV - Renilla green Luc 18 1μg 5459719 385131

[0283] Although both pCMV-Rluc-Int-WT and pCMV-Rluc-AltInt-WT gave similar results (and 20% higher than the starting plasmid pCMV-green Renilla Luc), the activity of the pCMV-Rluc-Int-Mut plasmid was only 10 times lower than that of the pCMV-Rluc-Int-WT. In contrast, the activity of the pCMV-Rluc-AltInt-Mut plasmid was 100 times lower than that of the WT plasmid. Therefore, the pCMV-Rluc-AltInt-WT and pCMV-Rluc-AltInt-Mut groups were selected as target model systems for further experiments. This setup can be used to test the ability of various Ocirc RNA oligonucleotides to restore normal splicing of MECP2 intron 3, whereby restoration of normal splicing of mutated MECP2 intron 3 by Ocirc oligonucleotides will be reflected by an increase in Renilla luciferase (Rluc) activity of the pCMV-Rluc-AltInt-Mut plasmid.

[0284] Example 6: Activity of Ocirc RNA antisense oligonucleotides in cells

[0285] To test the activity of Ocirc RNA oligonucleotides, HEK293 cells were grown in 96-well plates - 20,000 cells per well.

[0286] Plasmids were transfected using 0.1 μg of plasmid per well as described above. The template plasmid was pCMV-RLuc-AltInt-WT. Cells were co-transfected with the template plasmid and an additional plasmid pH1-Ocirc-AS (antisense) or pH1-Ocirc-control.

[0287] The pH1-Ocirc-AS plasmid was constructed by conjugating the Ocirc RNA oligonucleotide, referred to herein as Ocirc-AS (SEQ ID NO: 21), to the H1 promoter.

[0288] Ocirc-AS has the following sequence (designated as SEQ ID NO: 21):

[0289]

[0290] The bold sequence indicates the Ocirc-AS arm that matches the target sequence (e.g. Figure 20) and upon binding it causes cyclization of the oligonucleotide. The boundary between the intron and exon 4 of MECP2 is indicated. The splice acceptor is shown in bold letters (CAG). The Ocirc sequence is shown at the top: the highlighted sequence is the 5' antisense arm and the non-highlighted sequence is the 3' antisense arm. The RNA produced by the H1 promoter terminates with TT. Since these TT nucleotides do not match the template RNA, they do not bind and are therefore Figure 20 The middle figure shows highlighted. The dotted line indicates the RNA sequence present between the arms. The black line marks the contact area of ​​the two arms of Ocirc on the MECP2 sequence template. The underlined area is the PPT sequence of the human MECP2 gene.

[0291] The pH1-Ocirc-control plasmid was constructed by conjugating a control sequence called Ocirc-control to the H1 promoter. Ocirc-control has the following sequence (designated as SEQ ID NO: 22):

[0292]

[0293] The bold sequence represents the Ocirc-control arm that does not match the target sequence, and thus this Ocirc-control oligonucleotide will not be able to bind to the target.

[0294] In both Ocirc-AS and Ocirc-control, the sequences between the "arms" were identical.

[0295] These sequences were conjugated to the H1 promoter as indicated above.

[0296] pH1-Ocirc-AS has the following sequence (designated as SEQ ID NO: 23):

[0297]

[0298] pH1-Ocirc-control has the following sequence (designated as SEQ ID NO: 24):

[0299]

[0300] The H1 promoter sequence is underlined and the Ocirc sequence is shown in bold. Sequences shown in italics are restriction enzyme sites.

[0301] The sequence of plasmid pH1-Ocirc-AS (designated as SEQ ID NO: 25) is:

[0302]

[0303] The sequence of plasmid pH1-Ocirc-control (designated as SEQ ID NO: 26) is:

[0304]

[0305] At 48 hours post-transfection, cells were harvested and analyzed by Renilla luciferase assay. All experiments were performed in quadruplicate.

[0306] Results

[0307] Template plasmid Test plasmid Rluc activity Standard deviation pCMV - RLuc - AltInt - WT ---- 5,047,058 1,351,618 pCMV - RLuc - AltInt - WT pH1 - Ocirc - control 4,873,062 907,102 pCMV - RLuc - AltInt - WT pH1 - Ocirc - AS 3,258,109 935,339

[0308] The experimental results are modified by removing extreme points and displayed as follows:

[0309] Template plasmid Test plasmid Rluc activity Standard deviation pCMV - RLuc - AltInt - WT ---- 4,779,521 740,067 pCMV - RLuc - AltInt - WT pH1 - Ocirc - control 6,467,840 907,102 pCMV - RLuc - AltInt - WT pH1 - Ocirc - AS 3,671,592 535,237

[0310] Compared with parallel transfection with pH1-Ocirc-control plasmid expressing Ocirc-control RNA, a decrease of ∼33% to 43% in Renilla luciferase activity was observed after addition of pH1-Ocirc-AS plasmid expressing Ocirc-AS RNA.

[0311] These results indicate that the plasmid containing Ocirc RNA is able to enter the nucleus, bind to its target sequence and successfully knock down the expression of the target gene at the RNA level.

Claims

1. An oligonucleotide comprising from 5' to 3': a first nucleic acid sequence that is complementary in its 3' to 5' direction to a region in a pre-mRNA or mRNA target molecule; a second nucleic acid sequence comprising a heterologous sequence; and a third nucleic acid sequence that is complementary in the 3′ to 5′ direction to a nucleic acid sequence in the pre-mRNA or mRNA target molecule that is located upstream of the hybridization site of the first nucleic acid sequence; And wherein the first nucleic acid sequence and the third nucleic acid sequence hybridize to the same intron, or the same exon, or consecutive introns and exons, or consecutive exons and introns in the target molecule.

2. The oligonucleotide of claim 1, wherein the heterologous sequence comprises a sequence that is identical to and in the same 5'->3' direction as an exon, intron, splice site, 5'UTR, 3'UTR, or a fragment or portion thereof of a wild-type pre-mRNA or mRNA target molecule.

3. An oligonucleotide according to any one of the preceding claims, wherein the heterologous sequence encodes a portion of an exon.

4. An oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide is an antisense oligonucleotide.

5. The oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide is synthesized as a linear single-stranded molecule and forms an open ring structure upon hybridization with the pre-mRNA target molecule.

6. An oligonucleotide according to any of the preceding claims, wherein hybridization of the oligonucleotide to the pre-mRNA or mRNA target molecule masks mutations in the pre-mRNA or mRNA molecule and aligns the second nucleic acid sequence such that the mutant sequence of the pre-mRNA is replaced by the sequence of the wild-type pre-mRNA, thereby allowing translation of a functional protein.

7. The oligonucleotide according to any one of claims 1 to 6, wherein hybridization of the oligonucleotide to the pre-mRNA or mRNA target molecule introduces a heterologous motif into an endogenous pre-mRNA or mRNA molecule.

8. The oligonucleotide according to any one of the preceding claims, wherein the second nucleic acid sequence is bound to a cellular complex.

9. An oligonucleotide according to any one of the preceding claims, wherein the nucleic acid is a ribonucleotide.

10. The oligonucleotide according to any one of the preceding claims, wherein the mutation site comprises a single base mutation, a substitution, a deletion mutation, an insertion mutation or an indel mutation.

11. An oligonucleotide according to any of the preceding claims, wherein the second nucleic acid sequence comprises (i) a portion of an intron terminating with an acceptor site; (ii) a heterologous sequence to be trans-spliced ​​into the pre-mRNA target molecule; (iii) a portion of an intron terminating near the acceptor site sequence in a wild-type exon comprising a donor site and optionally a branch point and a PPT sequence.

12. An oligonucleotide comprising from 5' to 3': a first nucleic acid sequence that is complementary in its 3' to 5' direction to a region in a pre-mRNA target molecule; A second sequence, the second sequence comprising: (i) a portion of an intron terminating in an acceptor site; (ii) a heterologous sequence to be trans-spliced ​​into the pre-mRNA target molecule; and (iii) a portion of an intron comprising a donor site and optionally a branch point and a PPT sequence that terminates near the acceptor site sequence in the wild-type exon, a third nucleic acid sequence that hybridizes in the 3′ to 5′ direction with a nucleic acid sequence located upstream of the hybridization site of the first nucleic acid sequence in the pre-mRNA target molecule and before the entire or partial receptor site sequence; And wherein the first nucleic acid sequence and the third nucleic acid sequence hybridize to the same intron, or the same exon, or consecutive introns and exons, or consecutive exons and introns.

13. The oligonucleotide of claim 12, wherein the heterologous sequence comprises a sequence identical to the sequence of an exon, intron, splice site, or a fragment or portion thereof of a wild-type pre-mRNA molecule and terminating in the same 5'->3' direction with a YAG acceptor site following the second complementary sequence at the 3' end of the oligonucleotide.

14. The oligonucleotide according to any one of claims 11 to 13, wherein the heterologous sequence encodes a portion of an exon.

15. The oligonucleotide according to claim 1, wherein the oligonucleotide is selected from the group consisting of Ocirc 1 (SEQ ID NO: 12), Ocirc 2 (SEQ ID NO: 13), Ocirc 3 (SEQ ID NO: 14), Ocirc 4 (SEQ ID NO: 15), Ocirc 5 (SEQ ID NO: 16), Ocirc 6 (SEQ ID NO: 17), Ocirc 7 (SEQ ID NO: 18) and Ocirc8 (SEQ ID NO: 19).

16. A delivery vehicle comprising the oligonucleotide according to any one of the preceding claims.

17. An isolated cell comprising an oligonucleotide according to any one of the preceding claims.

18. A method for replacing an endogenous nucleic acid sequence, the method comprising contacting the oligonucleotide according to any one of claims 1 to 15 or the delivery vector according to claim 16 with a target cell comprising the endogenous nucleic acid sequence.

19. A method of treating Rett syndrome, the method comprising administering an oligonucleotide according to any one of claims 1 to 15, a delivery vector according to claim 16 or an isolated cell according to claim 17 to a patient in need thereof.

20. The oligonucleotide of any one of claims 1 to 15, the delivery vector of claim 16 or the isolated cell of claim 17 for use in a method of treating Rett syndrome.

Images