Breeding method for increasing rice anther and pollen quantity

Abstract

The invention discloses a breeding method for increasing rice anther and increasing pollen quantity, which comprises the following steps of: identifying a plurality of chromosome single-fragment substitution lines which stably show large anther characters from a single-fragment substitution line (SSSLs) library which takes wild rice as a donor and Huajing indica 74 as a receptor; positioning the anther QTL carried on the substitution fragment of each chromosome single-fragment substitution line by utilizing linkage analysis; chromosome single-segment substitution lines carrying different anther QTLs are hybridized and selfed, molecular marker-assisted selection is combined, a homozygous multi-segment polymerization line is constructed, and the homozygous multi-segment polymerization line comprises at least one of a homozygous two-segment polymerization line, a homozygous three-segment polymerization line, a homozygous four-segment polymerization line and a homozygous five-segment polymerization line. According to the breeding method disclosed by the invention, a batch of multi-fragment polymerization line materials with the characteristics of large anther and large pollen quantity of rice can be obtained, and a new method and germplasm material are provided for improving the seed production yield and efficiency of hybrid rice.

Description

Technical Field

[0001] The present invention relates to the technical field of rice breeding, and more specifically, to a breeding method for increasing rice anthers and improving pollen amount. Background Art

[0002] Rice anthers are the places where pollen develops and is stored. During the cross-breeding process of rice, the pollen amount and pollen dispersal characteristics of maintainer lines and restorer lines directly affect the outcrossing seed setting rate, and thus affect the seed production and hybrid seed production yields. Materials carrying large anther QTL (quantitative trait locus controlling the large anther trait) have a large amount of pollen produced by a single anther, may have higher vitality, can better adapt to different environmental conditions, and improve the pollination success rate. Breeding rice varieties with large anthers and a large amount of pollen can effectively improve the outcrossing seed setting rate, and has important significance and practical application value for hybrid rice breeding. As the ancestor of cultivated rice, wild rice has outcrossing characteristics, and its anthers are significantly larger than those of cultivated rice. However, due to the large differences between wild rice and cultivated rice, as well as the linkage drag of wild rice genes, if only by means of hybridization, transferring the beneficial genes of wild rice into cultivated rice varieties, there will be problems such as large segregation degree of offspring, slow stability, long cycle, and great breeding difficulty. Therefore, so far, there are not many successful cases of applying the natural genes carried by wild rice to breeding production, and there has been no report so far on the research of using wild rice large anther genes by means of pyramiding breeding to increase rice anthers and improve pollen amount. Summary of the Invention

[0003] In view of the above technical problems and material advantages, the present invention provides a breeding method for increasing rice anthers and improving pollen amount, which can pyramid multiple beneficial genes from wild rice, greatly increase the length of rice anthers, increase the pollen amount, and thus provide germplasm resources and breeding methods for improving the hybrid rice seed production yield and seed production efficiency.

[0004] To achieve the above object, the present application adopts the following technical solutions:

[0005] A breeding method for increasing rice anthers and improving pollen amount, comprising the following steps: identifying multiple chromosome single segment substitution lines that stably exhibit the large anther trait from a chromosome single segment substitution line library with wild rice as the donor and Huajingxian 74 as the recipient, and using linkage analysis to locate the large anther QTL carried on the substitution segments of each chromosome single segment substitution line; constructing a homozygous multi-segment pyramiding line by crossing, selfing, and molecular marker-assisted selection of chromosome single segment substitution lines carrying different large anther QTLs, and the homozygous multi-segment pyramiding line includes at least one of a homozygous two-segment pyramiding line, a homozygous three-segment pyramiding line, a homozygous four-segment pyramiding line, and a homozygous five-segment pyramiding line. When performing QTL pyramiding based on chromosome single segment substitution lines, two chromosome single segment substitution lines from the same chromosome with overlapping segments do not cross with each other.

[0006] Hybridization can combine the excellent genes of different parents, and self-crossing helps to homozygose the target genes in the hybrid offspring. DNA molecular marker-assisted selection can accurately locate and select target trait genes by the tight linkage between molecular markers and target trait genes, reduce the interference of non-target trait genes, and improve the selection efficiency. Chromosome single segment substitution lines (SSSLs) refer to lines in which only one homozygous chromosome segment in the genome comes from the donor parent and the other parts are the same as the recipient parent, which can eliminate the interference of genetic background and are ideal materials for analyzing complex trait QTLs. Wild rice has many excellent genes, including the large anther trait. In this application, by selecting wild rice SSSLs with the large anther trait and using hybridization, self-crossing, and molecular marker-assisted selection techniques to construct homozygous multi-segment pyramiding lines, beneficial genes from multiple wild rice sources can be integrated, which can increase the length of rice anthers and the amount of pollen, and thus improve the seed production yield and efficiency of hybrid rice. By using this method, a batch of multi-segment pyramiding materials with both large rice anthers and a large amount of pollen can be obtained, providing new methods and germplasm materials for improving the seed production efficiency of hybrid rice. In addition, this breeding method has universality for the pyramiding breeding of excellent gene resources in wild rice, and can achieve rapid and continuous improvement of a single trait or even simultaneous improvement of multiple excellent traits.

[0007] Further, the method for constructing the homozygous two-segment pyramiding line includes: hybridizing chromosome single segment substitution lines carrying different large anther QTLs to obtain F 1 -generation seeds and planting them, using DNA molecular marker technology to identify the successfully hybridized F 1 -generation single plants, self-crossing the single plants to obtain F 2 -generation seeds and planting them, and screening out homozygous two-segment pyramiding line single plants by combining molecular marker-assisted selection methods. The homozygous two-segment pyramiding line single plants are self-crossed to develop into homozygous two-segment pyramiding line strains.

[0008] Screening out homozygous two-segment pyramiding line single plants from the F 2 population, and this F 2 can be appropriately relaxed to F n , (n refers to the number of generations), until homozygous two-segment pyramiding line single plants are screened out, and the following construction of multi-segment pyramiding lines is also applicable. After multiple generations of self-crossing, the heterozygous target gene loci can be gradually transformed into homozygous states, ensuring the stable inheritance of the target gene in the offspring. Compared with other complex genetic materials, the genetic background of chromosome single segment substitution lines is relatively simple. During the construction of homozygous two-segment pyramiding lines, it can reduce the influence of other irrelevant genes on target traits. The constructed homozygous two-segment pyramiding lines can not only increase the rice anthers and the amount of pollen, but also be used as an ideal material for complex genetic laws to analyze genetic laws such as additivity, dominance, and epistasis of multiple genes under different genetic backgrounds.

[0009] Further, the construction method of the homozygous three - fragment pyramiding line includes: crossing a homozygous two - fragment pyramiding line with a chromosome single - fragment substitution line carrying different large anther QTLs to obtain F 1 - generation seeds and planting them, and identifying the successfully crossed F 1 - generation single plants by using DNA molecular marker technology. The single plants are self - crossed to obtain F 2 - generation seeds and planting them. Combining the molecular marker - assisted selection method, homozygous three - fragment pyramiding line single plants are screened out. The homozygous three - fragment pyramiding line single plants are self - crossed to develop into homozygous three - fragment pyramiding line strains.

[0010] The homozygous two - fragment pyramiding line itself has already pyramided two specific large anther QTLs. Constructing a three - fragment pyramiding line with a single - fragment substitution line carrying different large anther QTLs can further increase the number of large anther QTLs. It can not only optimize target traits such as anther size and pollen amount, but also may have a positive impact on other related traits due to gene interactions, achieving the coordinated improvement of multiple traits. For example, the change in anther size may simultaneously affect related traits such as pollen viability, stigma size, and seed - setting rate.

[0011] Further, the construction method of the homozygous four - fragment pyramiding line includes: crossing different homozygous two - fragment pyramiding lines to obtain F 1 - generation seeds and planting them, and identifying the successfully crossed F 1 - generation single plants by using DNA molecular marker technology. The single plants are self - crossed to obtain F 2 - generation seeds and planting them. Combining the molecular marker - assisted selection method, homozygous four - fragment pyramiding line single plants are screened out. The homozygous four - fragment pyramiding line single plants are self - crossed to develop into homozygous four - fragment pyramiding line strains.

[0012] Traditional breeding methods need to fix and combine excellent traits through multiple generations of backcrossing and self - crossing, and the process is relatively long. Different homozygous two - fragment pyramiding lines refer to homozygous two - fragment pyramiding lines carrying different large anther QTLs. Using different homozygous two - fragment pyramiding lines to construct a homozygous four - fragment pyramiding line can directly combine multiple excellent gene fragments together, reducing the number of intermediate backcrossing and self - crossing generations, thus greatly shortening the breeding cycle. The genetic background of the homozygous two - fragment pyramiding line is relatively clear, and the gene effects carried by each fragment are also relatively clear. When constructing a homozygous four - fragment pyramiding line, more accurate selection and combination are carried out according to the known gene effects, avoiding the introduction of bad genes and improving the accuracy of selection.

[0013] Further, the construction method of the homozygous five - fragment pyramiding line includes: crossing a homozygous three - fragment pyramiding line with a homozygous two - fragment pyramiding line to obtain F 1 - generation seeds and planting them, and identifying the successfully crossed F 1 - generation single plants by using DNA molecular marker technology. The single plants are self - crossed to obtain F2 The substituted lines are used as seeds for planting. Combining with the molecular marker-assisted selection method, homozygous five-fragment pyramiding lines are screened out, and the homozygous five-fragment pyramiding lines are self-crossed to develop into homozygous five-fragment pyramiding line strains. Among them, the homozygous three-fragment pyramiding lines and the homozygous two-fragment pyramiding lines carry different large anther QTLs.

[0014] The homozygous three-fragment pyramiding lines and the homozygous two-fragment pyramiding lines each carry specific excellent gene fragments. The homozygous five-fragment pyramiding lines constructed by combination will exponentially increase the way of gene combination. The homozygous three-fragment pyramiding lines and the homozygous two-fragment pyramiding lines used in this application are optimized and constructed for the specific trait of large anthers. Combining them to construct homozygous five-fragment pyramiding lines can further improve and expand the target traits on this basis.

[0015] Further, the method for locating the large anther QTL carried on the substitution fragment of the chromosome single fragment substitution line by linkage analysis includes the following steps: The chromosome single fragment substitution line is backcrossed with the recipient parent Huajingxian 74 to construct an F 2 generation population. Linkage analysis is carried out based on the single plant phenotype and the DNA molecular marker of the substitution fragment to determine the large anther QTL carried on the substitution fragment of the chromosome single fragment substitution line.

[0016] By backcrossing and recombining again, the chromosome single fragment substitution line can be separated into chromosome single fragment substitution lines with shorter substitution fragment lengths, so as to finely map the QTL. This method reduces the influence of the genetic background, greatly improves the accuracy of QTL mapping, and at the same time reduces the masking effect of QTLs with larger effects on QTLs with smaller effects, so that minor-effect QTLs can also be detected. After clarifying the position of the large anther QTL, select the parent or individual carrying this QTL for hybridization purposefully, so as to more accurately introduce the excellent trait of large anthers into the target variety and improve the efficiency and accuracy of breeding.

[0017] Further, the wild rice includes at least one of southern wild rice, common wild rice, and wild rice with spreading glumes.

[0018] This study found that there are QTL loci related to large anthers in southern wild rice, common wild rice, and wild rice with spreading glumes, and homozygous multi-fragment pyramiding lines that can increase the anthers of rice and improve the pollen amount can be constructed.

[0019] Further, the large anther QTL includes one of chromosome 12 of southern wild rice, chromosome 2 of common wild rice, chromosome 5 of common wild rice, chromosome 5 of wild rice with spreading glumes, and chromosome 9 of wild rice with spreading glumes.

[0020] The introduction of the above-mentioned large anther QTL can significantly increase the anther length and yield of rice and improve the success rate of constructing homozygous multi-fragment pyramiding lines.

[0021] Furthermore, within the range from the homozygous two - segment pyramiding line to the homozygous five - segment pyramiding line, the anther length and pollen amount of rice are positively correlated with the number of QTLs in the pyramiding line.

[0022] In some cases, there may be non - additive effects or epistatic effects between genes, resulting in new phenotypes or trait changes. In this application, within the range from the homozygous two - segment pyramiding line to the homozygous five - segment pyramiding line, the anther length and pollen amount of rice are significantly positively correlated with the number of QTLs pyramided in the pyramiding line. These homozygous multi - segment pyramiding lines provide new gene resources for improving the anther and pollen traits of rice.

[0023] Furthermore, the anther length of the chromosome single - segment substitution line or homozygous multi - segment pyramiding line with the large anther trait is greater than that of the recipient parent Huajingxian 74 at the P < 0.01 level.

[0024] Different anther lengths are often associated with specific gene combinations. By pyramiding these materials, multiple excellent genes can be combined into one strain, providing more possibilities for breeding new varieties with multiple excellent traits.

[0025] Compared with the prior art, the beneficial effects of the present invention are as follows: Wild rice has many excellent genes. By selecting wild rice with large anthers SSSLs, using different large - anther QTLs of wild rice, and constructing homozygous multi - segment pyramiding lines with the help of hybridization, self - crossing, and molecular marker - assisted selection techniques, beneficial genes from multiple sources can be integrated, increasing the anther length of rice and the pollen amount, and thus improving the seed production yield and efficiency of hybrid rice. This application uses the wild rice SSSLs library to conduct pyramiding breeding on excellent genes of multiple wild rices, achieving rapid and continuous improvement of a single trait or even simultaneous improvement of multiple excellent traits. This breeding method has universality for the pyramiding breeding of excellent gene resources of wild rice, and can obtain a batch of multi - segment pyramiding materials with both large anthers and high pollen amounts of rice, providing new methods and germplasm materials for improving the seed production efficiency of hybrid rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The drawings herein are incorporated into the specification and form a part of this specification, showing embodiments consistent with the present invention and used together with the specification to explain the principles of the present invention.

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, for those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0028] In the drawings:

[0029] Figure 1 A construction scheme of a large anther homozygous multi - fragment pyramiding line for the embodiments of the present application, wherein MAS represents marker - assisted selection; the dashed line indicates that after the true - false detection of the hybrid F 1 is carried out, the true F 1 is self - crossed to obtain F 2 segregating population. The F 2 -F n populations can all be used to screen single plants with homozygous multi - fragment genotypes, and finally self - crossed to develop into homozygous multi - fragment pyramiding lines;

[0030] Figure 2 Statistics of the anther length and pollen amount of the parents and D1 in Experimental Example 1 of the present application;

[0031] Figure 3 Statistics of the anther length and pollen amount of the parents and T1 in Experimental Example 2 of the present application;

[0032] Figure 4 Statistics of the anther length and pollen amount of the parents and Q1 in Experimental Example 3 of the present application;

[0033] Figure 5 Statistics of the anther length and pollen amount of the parents and P1 in Experimental Example 4 of the present application;

[0034] Figure 6 Morphological diagrams of the anthers of the parents and each homozygous multi - fragment pyramiding line in the embodiments of the present application. Among them, every three anthers are in a group, bar = 1mm;

[0035] Figure 7 Microscopic photos of pollen grains of the parents and each homozygous multi - fragment pyramiding line in 2 μL pollen suspension in the embodiments of the present application, bar = 500 μm.

[0036] Reference numerals:

[0037] Figures 2 - 5 Among them, HJX74 is the receptor parent of Huajingxian 74. The values represent the average anther length ± standard deviation and the average pollen amount ± standard deviation from the early season of 2022 to the late season of 2024. ANOVA is performed using Duncan's multiple comparison. Capital letters indicate significant differences at the P < 0.01 level, and lowercase letters indicate significant differences at the P < 0.05 level; hollow circles represent the average data of this material in one season. Detailed implementation manners

[0038] The following examples are used to illustrate the present invention, but not to limit the scope of the present invention. Modifications or substitutions made to the methods, steps or conditions of the present invention without departing from the spirit and essence of the present invention all fall within the protection scope of the present invention. Unless otherwise specified, the experimental materials, reagents, instruments, etc. used in the embodiments of the present invention can be obtained commercially; unless specifically specified, all technical means in the embodiments of the present invention are conventional means well known to those skilled in the art.

[0039] The construction scheme of the large anther homozygous multi-fragment pyramiding line in the embodiments of this application is as Figure 1 shown. In the following examples:

[0040] Hybridization refers to the conventional rice field hybridization method. The specific steps mainly include selecting the female parent, cutting the glumes and emasculating, bagging, taking the male parent, pollination, etc. The specific steps refer to the reference "Li Yunwu. Rice Glume Cutting and Male Sterilization Hybridization Technology [J]. Sichuan Agricultural Science and Technology, 1998, (03): 14-15." The entire content of which is incorporated herein by reference. In this scheme, there is no need to strictly distinguish the specific selection of the male parent and the female parent.

[0041] For the DNA molecular marker-assisted selection technology, the main steps include leaf sampling, DNA extraction, PCR amplification, electrophoresis detection, etc. The specific steps refer to the reference "Lai Jiahua. Preliminary Mapping and Pyramiding Effect Analysis of Anther Length QTLs Based on Wild Rice SSSLs [D]. South China Agricultural University, 2021." The PCR amplification part is slightly improved: 2×PCR Mix is changed to 2×superTaqPCR StarMix for PAGE (Dye), so that the reaction time required for the PCR program is shortened to 1 / 2 of the original, improving the amplification efficiency; the PCR amplification program is changed to: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 15 s, 35 cycles; extension at 72°C for 5 min; cooling at 15°C for 1 min.

[0042] The construction of the SSSLs library using southern wild rice, common wild rice, and Oryza glumaepatula as donors and Huajingxian 74 as the recipient has been disclosed in the literature “(1) He N, Wu RX, Pan XP, et al. Development and trait evaluation of chromosome single-segment substitution lines of O. meridionalis in the background of O. sativa. Euphytica, 2017, 213:281. (2) Zhao HW, Sun LL, Xiong TY, et al. Genetic characterization of the chromosome single-segment substitution lines of O. glumaepatula and O. barthii and identification of QTLs for yield-related traits. Mol Breeding, 2019, 39:51. (3) Wang ZQ, Guo ZS, Zou T, et al. Substitution mapping and allelic variations of the domestication genes from O. rufipogon and O. nivara. Rice, 2023, 16:38.”, the entire content of which is hereby incorporated herein by reference.

[0043] The literature “Lai JH. Preliminary mapping of QTLs for anther length based on wild rice SSSLs and analysis of pyramiding effects [D]. South China Agricultural University, 2021” details the identification of multiple major QTLs for long anthers with stable expression and positive effects using SSSLs materials, the entire content of which is hereby incorporated herein by reference. Table 1 shows the results of the identification of QTLs for long anthers, where M refers to southern wild rice, R refers to common wild rice, and G refers to Oryza glumaepatula.

[0044] Table 1 Results of the identification of QTLs for long anthers

[0045]

[0046] Note: The substitution fragment marker sequence used is (5'-3'):

[0047] Forward primer F of RM3331: CCTCCTCCATGAGCTAATGC

[0048] RM3331 Reverse Primer R: AGGAGGAGCGGATTTCTCTC

[0049] RM1310 Forward Primer F: TGCGTTCTTGATCCAGTGAG

[0050] RM1310 Reverse Primer R: CCCCAATCCAACACTTGGAAC

[0051] RM12492 Forward Primer F: CCATGTACTGTGTGCTCTTCTTTGC

[0052] RM12492 Reverse Primer R: TGCTACCACCACGTTACACATGC

[0053] L9 Forward Primer F: CGCTTGACTTCTCATAGCATA

[0054] L9 Reverse Primer R: TCATCATCTAGTCAGTTTGGC

[0055] AN69 Forward Primer F: GGAACCCCCGTAGTCATATT

[0056] AN69 Reverse Primer R: TACAGGCCATGCACCAAAC

[0057] AN245 Forward Primer F: CTACTCCGTAGCTTGGTGTA

[0058] AN245 Reverse Primer R: ATCATGTTGCCGCCGAAGAT

[0059] XS51 Forward Primer F: TCTCTCCCGTCGCTTGGTA

[0060] XS51 Reverse Primer R: GAAGAGTGTGGCCTCCTGAT

[0061] RM249 Forward Primer F: GGCGTAAAGGTTTTGCATGT

[0062] RM249 Reverse Primer R: ATGATGCCATGAAGGTCAGC

[0063] D70 Forward Primer F: TGGCCATGGGTAAAACTAGA

[0064] D70 Reverse Primer R: ATGACGCACTAAAACGCTGC

[0065] D37 Forward Primer F: GAACCTACTCCGCTAGTTAA

[0066] D37 post primer R: CGGTGCAGTTTCTTTCATA

[0067] Example 1 Construction of Homozygous Two-Fragment Pyramiding Lines

[0068] Using SSSL3 as the male parent and SSSL5 as the female parent for hybridization to obtain hybrid F 1 generation seeds. Plant the F 1 generation. At the seedling stage, take young leaves and use DNA molecular markers to detect the authenticity of each individual plant in the F 1 generation. Harvest the seeds of true hybrid F 1 individual plants, which are the F 2 generation seeds. The detection result of the successfully hybridized F 1 generation individual plants is as follows: By detecting the band pattern through 6% polyacrylamide gel electrophoresis, the band pattern of the F 1 generation individual plants is a heterozygous band pattern containing the band patterns of the parental lines.

[0069] Plant the F 2 generation population. Combining molecular marker-assisted selection, screen the individual plants with substitution fragment markers identical to those of the parental lines SSSL3 and SSSL5, and record them as homozygous two-fragment pyramiding line individual plants. The obtained homozygous two-fragment individual plants are self-crossed to develop into homozygous two-fragment pyramiding line strains, numbered D1.

[0070] Example 2 Construction of Homozygous Three-Fragment Pyramiding Lines

[0071] Using the homozygous two-fragment pyramiding line D1 constructed in Example 1 as the female parent and SSSL2 as the male parent for hybridization to obtain F 1 generation seeds. Plant the F 1 generation. At the seedling stage, take young leaves and use DNA molecular markers to detect the authenticity of each individual plant in the F 1 generation. Harvest the seeds of true hybrid F 1 individual plants, which are the F 2 generation seeds.

[0072] Plant the F 2 generation population. Combining molecular marker-assisted selection, screen the individual plants with substitution fragment markers identical to those of SSSL2, SSSL3, and SSSL5, and record them as homozygous three-fragment pyramiding line individual plants. The screened homozygous three-fragment individual plants are self-crossed to develop into homozygous three-fragment pyramiding line strains, numbered T1.

[0073] Example 3 Construction of Homozygous Four-Fragment Pyramiding Lines

[0074] Construct a homozygous two-fragment pyramiding line D2 by using SSSL1 as the male parent and SSSL4 as the female parent. Using the homozygous two-fragment pyramiding line D1 constructed in Example 1 as the female parent and D2 as the male parent for hybridization to obtain F 1 generation seeds. Plant the F 1In the F generation, young and tender leaves were taken at the seedling stage, and DNA molecular markers were used to detect the authenticity of each individual plant in the F generation. The seeds harvested from the true hybrid F individual plants were the F generation seeds. 1 In the F generation, young and tender leaves were taken at the seedling stage, and DNA molecular markers were used to detect the authenticity of each individual plant in the F generation. The seeds harvested from the true hybrid F individual plants were the F generation seeds. 1 The seeds of the F individual plants 2 were the F generation seeds.

[0075] The F generation population was planted. Combining molecular marker-assisted selection, individual plants with substitution fragment markers identical to the SSSL1, SSSL3, SSSL4, and SSSL5 markers were screened and recorded as homozygous four-fragment pyramiding line individual plants. The homozygous four-fragment individual plants obtained were self-crossed to develop into homozygous four-fragment pyramiding line strains, numbered Q1. 2 The F generation population was planted. Combining molecular marker-assisted selection, individual plants with substitution fragment markers identical to the SSSL1, SSSL3, SSSL4, and SSSL5 markers were screened and recorded as homozygous four-fragment pyramiding line individual plants. The homozygous four-fragment individual plants obtained were self-crossed to develop into homozygous four-fragment pyramiding line strains, numbered Q1.

[0076] Example 4: Construction of homozygous five-fragment pyramiding line

[0077] Using the homozygous three-fragment pyramiding line T1 in Example 2 as the female parent and the homozygous two-fragment pyramiding line D2 in Example 3 as the male parent for hybridization, F generation seeds were obtained. 1 The F generation seeds were planted. 1 In the F generation, young and tender leaves were taken at the seedling stage, and DNA molecular markers were used to detect the authenticity of each individual plant in the F generation. 1 In the F generation, young and tender leaves were taken at the seedling stage, and DNA molecular markers were used to detect the authenticity of each individual plant in the F generation. 1 The seeds harvested from the true hybrid F individual plants 2 were the F generation seeds.

[0078] The F generation population was planted. 2 Combining molecular marker-assisted selection, individual plants with substitution fragment markers identical to the SSSL1, SSSL2, SSSL3, SSSL4, and SSSL5 markers were screened and recorded as homozygous five-fragment pyramiding line individual plants. The homozygous five-fragment individual plants obtained were self-crossed to develop into homozygous five-fragment pyramiding line strains, numbered P1.

[0079] In the following experimental examples: The method for investigating anther length has been disclosed in a Chinese patent with the application number CN202111397605.5 (patent number: ZL2021 1 1397605.5), mainly including sampling, preservation, dissection, measurement, etc. For the specific operation steps, the entire content is incorporated herein by reference.

[0080] The methods for pollen amount investigation mainly include sampling, fixation and preservation, pollen amount investigation, pollen counting, etc. The specific operation steps refer to the reference "Ogami T, Yasui H, Yoshimura A, et al. Identification of anther length QTL and construction of chromosome segment substitution lines of Oryza longistaminata[J]. Plants, 2019, 8(10): 388-401. Ogami et al. (2019)". There are slight improvements in the parts of fixation and preservation and pollen amount investigation: in the part of fixation and preservation, ethanol fixation is changed to 70% FAA (formula: the formula of 100 mL FAA fixing solution is: 70 mL absolute ethanol, 10 mL 37% formaldehyde, 5 mL glacial acetic acid, and make up to 100 mL with distilled water) fixation. The improved fixing solution formula can prevent the over-contraction of anthers and pollen grains, enhance the uniformity of fixation and make the fixation effect more lasting; in the part of pollen amount investigation, 1 μL suspension is changed to 2 μL, which can increase the pollen density to cover more pollen grains, help reduce the pollen counting error caused by random sampling, and improve the accuracy and reliability of the investigation results.

[0081] Experimental Example 1

[0082] From the early season of 2022 to the late season of 2024, a total of 6 seasons, the anther length and pollen amount of the homozygous two-fragment pyramiding line D1 constructed in Example 1, its parental SSSL3, SSSL5 and the recipient parent HJX74 were investigated.

[0083] The results are as Figure 2 shown. The average anther length of D1 was significantly longer than that of SSSL3 and SSSL5 at the P<0.01 level, and the average pollen amount of D1 was significantly more than that of SSSL3 and SSSL5 at the P<0.05 level. It can be seen that the homozygous two-fragment pyramiding line with large anthers increased the pollen amount while increasing the anthers, achieving the breeding effect of increasing the anthers of rice and improving the pollen amount.

[0084] Experimental Example 2

[0085] From the early season of 2022 to the late season of 2024, a total of 6 seasons, the anther length and pollen amount of the homozygous three-fragment pyramiding line T1 constructed in Example 2, the homozygous two-fragment pyramiding line D1 constructed in Example 1, SSSL2, SSSL3, SSSL5 of SSSLs and the recipient parent HJX74 were investigated.

[0086] The results are as Figure 3As shown in the figure, the average anther length of T1 was significantly longer than that of D1, SSSLs, and HJX74 at the P<0.01 level, and the average pollen amount of T1 was significantly more than that of D1, SSSLs, and HJX74 at the P<0.05 level. It can be seen that the homozygous three-fragment pyramiding line with large anthers achieved the breeding effect of increasing the anthers and pollen amount of rice.

[0087] Experimental Example 3

[0088] From the early season of 2022 to the late season of 2024, a total of 6 seasons, the anther length and pollen amount of the homozygous four-fragment pyramiding line Q1 constructed in Example 3, the homozygous three-fragment pyramiding line T1 constructed in Example 2, the homozygous two-fragment pyramiding line D1 constructed in Example 1, SSSL1, SSSL3, SSSL4, SSSL5 of SSSLs, and the recipient parent HJX74 were investigated.

[0089] The results are as Figure 4 shown. The average anther length of Q1 was significantly longer than that of T1, D1, SSSLs, and HJX74 at the P<0.01 level, and the average pollen amount of Q1 was significantly more than that of T1, D1, SSSLs, and HJX74 at the P<0.05 level. It can be seen that the homozygous four-fragment pyramiding line with large anthers achieved the breeding effect of increasing the anthers and pollen amount of rice.

[0090] Experimental Example 4

[0091] From the early season of 2022 to the late season of 2024, a total of 6 seasons, the anther length and pollen amount of the homozygous five-fragment pyramiding line P1 constructed in Example 4, the homozygous four-fragment pyramiding line Q1 constructed in Example 3, the homozygous three-fragment pyramiding line T1 constructed in Example 2, the homozygous two-fragment pyramiding line D1 constructed in Example 1, SSSL1, SSSL2, SSSL3, SSSL4, SSSL5 of SSSLs, and the recipient parent HJX74 were investigated.

[0092] The results are as Figure 5 shown. It can be seen that within the range from the homozygous two-fragment pyramiding line to the homozygous five-fragment pyramiding line, the anther length and pollen amount of rice were positively correlated with the number of QTLs pyramided in the pyramiding line. Among them, the average anther length of P1 was significantly longer than that of Q1, T1, D1, SSSLs, and HJX74 at the P<0.01 level, and the average pollen amount of P1 was significantly higher than that of Q1, T1, D1, SSSLs, and HJX74 at the P<0.05 level. The homozygous five-fragment pyramiding line had the strongest breeding effect of increasing the anthers and pollen amount of rice.

[0093] Experimental Example 5

[0094] The anther morphology of SSSL1, receptor parent HJX74, and the homozygous two-fragment pyramiding line D1, homozygous three-fragment pyramiding line T1, homozygous four-fragment pyramiding line Q1, and homozygous five-fragment pyramiding line P1 materials constructed in Examples 1 to 4 was observed, and the pollen grains in 2 μL of pollen suspension were investigated under a microscope.

[0095] The observation results are as Figure 6 and Figure 7 shown. It can be seen that the anther length and the pollen amount per anther on average of the homozygous multi-fragment pyramiding lines are higher than those of SSSL and HJX74, and within the range from the homozygous two-fragment pyramiding line to the homozygous five-fragment pyramiding line, the rice anthers gradually increase in size and the pollen amount gradually increases.

[0096] It can be understood that the above embodiments only represent the preferred embodiments of the present invention, and the description thereof is relatively specific and detailed, but it should not be construed as a limitation on the scope of the patent of the present invention; it should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, the above technical features can be freely combined, and several deformations and improvements can also be made, which all belong to the protection scope of the present invention; therefore, all equivalent transformations and modifications made to the scope of the claims of the present invention shall fall within the scope covered by the claims of the present invention.

Claims

1. A breeding method for increasing rice anthers and pollen quantity, characterized in that: The following steps are involved: Several chromosome single segment substitution lines that stably expressed large anther traits were identified from a single segment substitution line library with wild rice as donor and Huajingxian 74 as recipient, and linkage analysis was used to locate the large anther QTL on the substitution segment. A single-segment replacement line of chromosomes carrying different large anther QTLs is constructed through hybridization, selfing, and molecular marker-assisted selection to construct a homozygous multi-segment polymerization line, wherein the homozygous multi-segment polymerization line includes at least one of a homozygous two-segment polymerization line, a homozygous three-segment polymerization line, a homozygous four-segment polymerization line, and a homozygous five-segment polymerization line.

2. A breeding method for increasing rice anthers and pollen quantity according to claim 1, characterized in that: The method for constructing a homozygous two-segment polymer line comprises: hybridizing chromosome single-segment substitution lines carrying different large anther QTLs to obtain F1 generation seeds and plant them, identifying successfully hybridized F1 generation plants using DNA molecular marker technology, self-pollinating the plants, obtaining F2 generation seeds and planting them, screening homozygous two-segment polymer line plants using molecular marker-assisted selection methods, self-pollinating the homozygous two-segment polymer line plants, and developing them into homozygous two-segment polymer line strains.

3. A breeding method for increasing rice anthers and pollen quantity according to claim 1, characterized in that: The method for constructing the homozygous three-segment polymer line comprises: hybridizing a homozygous two-segment polymer line with a chromosome single-segment substitution line carrying different large anther QTLs, obtaining F1 generation seeds and planting them, identifying F1 generation plants that have successfully hybridized by using DNA molecular marker technology, self-pollinating the plants, obtaining F2 generation seeds and planting them, selecting homozygous three-segment polymer line plants by combining molecular marker-assisted selection methods, self-pollinating the homozygous three-segment polymer line plants, and developing them into homozygous three-segment polymer line strains.

4. A breeding method for increasing rice anthers and pollen quantity according to claim 1, characterized in that: The method for constructing the homozygous four-segment polymer system comprises: hybridizing different homozygous two-segment polymer systems to obtain F1 generation seeds and plant them, identifying the F1 generation single plants that have been successfully hybridized by using DNA molecular marker technology, self-pollinating the single plants, obtaining F2 generation seeds and planting them, screening out homozygous four-segment polymer system single plants by combining molecular marker-assisted selection methods, self-pollinating the homozygous four-segment polymer system single plants, and developing them into homozygous four-segment polymer system strains.

5. A breeding method for increasing rice anthers and pollen quantity according to claim 1, characterized in that: The method for constructing the homozygous five-segment polymer line includes: hybridizing the homozygous three-segment polymer line with the homozygous two-segment polymer line to obtain F1 generation seeds and plant them, identifying the F1 generation single plants that have successfully hybridized by using DNA molecular marker technology, self-pollinating the single plants, obtaining F2 generation seeds and planting them, screening out homozygous five-segment polymer line single plants by combining molecular marker-assisted selection methods, self-pollinating the homozygous five-segment polymer line single plants, and developing them into homozygous five-segment polymer line strains; wherein the homozygous three-segment polymer line and the homozygous two-segment polymer line carry different large anther QTLs.

6. A breeding method for increasing rice anthers and pollen quantity according to claim 1, characterized in that: The method for locating the large anther QTL carried on the substitution segment of a single chromosome segment substitution line by using linkage analysis comprises the following steps: backcrossing the single chromosome segment substitution line with a recipient parent Huajingxian 74 to construct an F2 generation population, performing linkage analysis based on the phenotype of a single plant and DNA molecular markers of the substitution segment, and determining the large anther QTL carried on the substitution segment of the single chromosome segment substitution line.

7. A breeding method for increasing rice anthers and pollen quantity according to claim 1, characterized in that: The wild rice includes at least one of southern wild rice, common wild rice and awn wild rice.

8. A breeding method for increasing rice anthers and pollen quantity according to claim 1, characterized in that: The large anther QTL includes one of chromosome 12 of southern wild rice, chromosome 2 of common wild rice, chromosome 5 of common wild rice, chromosome 5 of aphrodisiac wild rice, and chromosome 9 of aphrodisiac wild rice.

9. A breeding method for increasing rice anthers and pollen quantity according to claim 1, characterized in that: In the range of homozygous two-segment aggregate lines to homozygous five-segment aggregate lines, rice anther length and pollen amount were positively correlated with the number of QTLs in the aggregate lines.

10. A breeding method for increasing rice anthers and pollen quantity according to claim 1, characterized in that: The anther length of the chromosome single segment substitution line or homozygous multi-segment aggregation line with the large anther trait is greater than the anther length of the recipient parent Huajingxian 74 at the P<0.01 level.

Images