Breeding method of butter crabs and method for screening key genes formed by butter crabs

Abstract

The invention relates to a method for cultivating butter crabs and a method for screening key genes formed by the butter crabs. The method comprises the following steps: a, screening blue crabs cultivated by the butter crabs; b, performing cultivation management; according to the breeding method, blue crabs are independently bred in a crab breeding device, and the crab breeding device comprises a breeding basket body; the sandy layer is laid at the bottom of the breeding basket body; the blowdown device is arranged in the breeding basket body, and water in the sandy layer, excrement and residual feed can be discharged by means of water level pressure generated by the inner side and the outer side of a blowdown chamber. By regulating and controlling the temperature and salinity of seawater, the proportion of the butter crabs in the blue crab breeding process is increased; the pollution discharge device is arranged in the crab breeding device, self-cleaning of the sandy layer is achieved, the stress reaction of crabs is reduced, meanwhile, the self-cleaning sandy layer can allow the crabs to dive in sand, the living state of the crabs in the nature is simulated, meanwhile, the crabs can be prevented from ulcer, and then the breeding success rate of the butter crabs is increased.

Description

Technical Field

[0001] The present invention relates to the technical field of aquaculture, in particular to a method for cultivating butter crabs and a method for screening key genes for the formation of butter crabs. Background Art

[0002] The butter crab is a special female Scylla paramamosain. Its name is mainly due to the yellow and oily hemolymph. Because of its good taste, high nutritional value, and strong scarcity, it is very popular among consumers in China (especially in Guangdong Province), and its price is relatively high. So far, the formation mechanism of butter crabs is still unclear, and the existence of "butter crabs" is also unpredictable. Currently, there are mainly three hypotheses about the formation mechanism of butter crabs: (1) High-temperature stimulation-stress theory: After the ebb tide in summer, the strong sunlight and warm water temperature stimulate the physiological reaction of the paste crab, resulting in the degeneration of the ovary, which decomposes into golden-yellow oil and penetrates into all parts of the body; (2) Developmental lesion-lesion theory: The normal female crab's ovary absorbs nutrients from the hepatopancreas and finally develops into a paste crab. However, individual crabs may have lesions and metabolic disorders, unable to absorb nutrients from the hepatopancreas, and finally form butter crabs; (3) "Germplasm theory": That is, seedlings from specific coastal areas are more likely to cultivate butter crabs. It is believed that Scylla paramamosain from the surrounding areas of Dianbai District, Maoming City, Guangdong Province is more likely to produce butter crabs. Farmers purchase such crab seedlings in the hope of obtaining a higher proportion of butter crabs in the pond, but no relevant quantitative research has been reported. Therefore, it is very necessary to study the formation mechanism of butter crabs to provide a theoretical basis for the development of the Scylla paramamosain industry.

[0003] The emergence of butter crabs mainly depends on chance. Currently, they are mainly randomly produced in ponds. Among 1,000 green crabs, there are about 2-3 butter crabs. However, artificial regulation and induction are still blank, which has great commercial potential. Environmental regulation may be an important way to induce the emergence of butter crabs. The industrialized recirculating water single-culture system for crabs plays an important role in environmental regulation and can be used to induce the emergence of butter crabs. Compared with pond culture, the industrialized recirculating water single-culture system for crabs has many advantages, such as: (1) strong environmental controllability; (2) high water resource utilization rate; (3) high stocking density; (4) reducing fighting and cannibalism, and high survival rate, etc. According to the applicant's breeding experience, sandy bottom plays an important role in maintaining the living environment of crabs, promoting their growth and reproduction, etc. when using the industrialized recirculating water single-culture system for crabs. However, due to various factors such as technology, equipment, or design concepts, the existing culture systems cannot effectively be compatible with sandy bottom. If sandy bottom is not placed in the system, since green crabs have the habit of burrowing into the sand, the lack of sandy bottom will cause stress reactions in crabs and affect the survival rate; when sandy bottom is placed in the system, if the bottom sediment is not properly cleaned, waste will easily accumulate, resulting in the occurrence of crab diseases and even death. Therefore, there is an urgent need to design a single-culture device for industrialized recirculating water of crabs that can place sandy bottom and the sandy bottom has a self-purification function. For example, the Chinese invention patent "A Crab Culture Device" with the patent number 201921431446.4 (the authorized announcement number is CN210929164U). Although the sewage discharge unit in this device can discharge excreta and residual baits to achieve the function of self-cleaning, there are still the following defects in the actual breeding process: (1) It cannot flexibly switch the water level and place sandy bottom when breeding juvenile crabs and adult crabs; (2) The sewage discharge unit adopts a siphon generating device, and the overall device structure is relatively complex, with high manufacturing costs; (3) The double-region setting inside the culture box reduces the breeding space for crabs inside the culture box; (4) There is a lack of a water-exiting rest space for crabs that like to expose to dryness. Therefore, the current single-culture device for industrialized recirculating water of crabs still needs to be further optimized to better meet the actual breeding needs. Summary of the Invention

[0004] The first technical problem to be solved by the present invention is to provide a method for cultivating butter crabs that can better cultivate butter crabs and prevent the sandy layer from emitting an odor due to the accumulation of residual baits or excreta in view of the above-mentioned current situation of the prior art.

[0005] The second technical problem to be solved by the present invention is to provide a method for cultivating butter crabs that can switch between high-level and low-level cultivation in view of the above-mentioned current situation of the prior art. The third technical problem to be solved by the present invention is to provide a method for screening key genes formed by butter crabs by applying the above-mentioned cultivation method in view of the above-mentioned current situation of the prior art.

[0006] The technical solution adopted by the present invention to solve the above first technical problem is as follows: The method for cultivating butter crabs includes the following steps:

[0007] a. Screening the green crabs for cultivating butter crabs: Selecting female crabs with a specification of 400 - 500 g, complete appendages, and being healthy;

[0008] b. Cultivation management: Using live or chilled fresh shellfish as bait, and the daily dry matter input is not less than 5% of the weight of the cultured green crabs;

[0009] It is characterized in that:

[0010] The green crabs in step a are female crabs, and the gonadal development reaches stage IV or above / the ovarian index is greater than 10%;

[0011] In the cultivation management conditions of step b, the salinity range of the seawater is 3 - 17‰, the temperature range of the seawater is 18 - 28 °C, and the day-night fluctuation does not exceed ±2 °C;

[0012] The green crabs in step a and step b are both separately raised in a crab cultivation device, and the crab cultivation device includes

[0013] A cultivation basket body;

[0014] A sandy layer, laid at the bottom of the cultivation basket body;

[0015] A sewage discharge device, arranged in the cultivation basket body, and by means of the water level pressure generated inside and outside the sewage discharge chamber, the water in the sandy layer together with excrement and residual bait can be discharged.

[0016] In order to prevent the sandy layer from emitting an odor due to the accumulation of residual bait or excrement, that is, to solve the second technical problem, preferably, the sewage discharge device includes a first sewage discharge chamber that is relatively isolated from the cultivation basket body and is suitable for high-water-level cultivation, and a vertical partition is arranged in the first sewage discharge chamber to divide the first sewage discharge chamber into a first flow channel and a second flow channel that are connected; a low water inlet lower than the top of the partition and a high water inlet higher than the top of the partition are opened on the first wall part of the first sewage discharge chamber corresponding to the first flow channel, and a first water outlet is opened on the bottom wall of the first sewage discharge chamber corresponding to the second flow channel, so as to achieve: By means of the height of the partition, a water level pressure is generated inside and outside the first sewage discharge chamber, and the water in the sandy layer together with excrement and residual bait can enter the first sewage discharge chamber automatically from the low water inlet through the first flow channel, and then be discharged through the first water outlet of the second flow channel, thus achieving flushing away the excrement while retaining the sandy layer, and finally realizing the self-purification of the sandy layer.

[0017] The first sewage chamber can be cylindrical or box-shaped, as long as it can be relatively isolated from the aquaculture basket body. The bottom wall of the first sewage chamber can be independently arranged from the bottom wall of the aquaculture basket body, or it can be that: a part of the bottom wall of the aquaculture basket body directly serves as the bottom wall of the first sewage chamber. The first sewage chamber further includes a side peripheral wall extending upward from the bottom wall, and the first wall portion constitutes a part of the side peripheral wall. This can also reduce the production cost of the overall aquaculture basket body. Taking the first sewage chamber as an example in the shape of a box: the side wall part of the aquaculture basket body directly serves as the inner side wall of the first sewage chamber, and there are three side peripheral walls: a first wall portion arranged opposite to the inner side wall, and a first side wall and a second side wall connecting the first wall portion and the inner side wall. The partition is connected to the first side wall and the second side wall, and the bottom end of the partition is connected to the bottom wall of the first sewage chamber. The advantages of this design are that the partition can be set more stably. On the other hand, by setting the first sewage chamber at the outermost side relative to the aquaculture basket body, the activity area required for the culture of butter crabs is maximally "given up".

[0018] To balance the pressure between the first sewage chamber and the outside atmosphere, preferably, the top of the first sewage chamber is open, and a first water outlet pipe connected to the first water outlet of the second flow channel is provided on the back of the bottom wall of the aquaculture basket body. This first water outlet pipe can communicate with the open top parts of the aquaculture basket bodies located below, so that the water in the sand layer of the upper aquaculture basket body together with excrement and residual bait can directly flow into the aquaculture basket body located in the lower layer through the first water outlet pipe, realizing the step-by-step self-purification of the sand layer.

[0019] To provide a space for the butter crabs that like to be dry and exposed to rest out of water, preferably, a dry exposure platform for crabs to rest dry and exposed is detachably arranged in the aquaculture basket body. The dry exposure platform is arranged adjacent to the first sewage chamber and its height is between the low water inlet and the high water inlet. The dry exposure platform is located between the low water inlet and the high water inlet, and it can not affect the sewage discharge function of the first sewage chamber. The dry exposure platform includes a platform body and at least two drainage holes provided on the platform body for draining water. A notch adapted to the first sewage chamber is provided on the platform body. The dryness of the dry exposure platform is maintained through the drainage holes; a support member for supporting the platform body is also provided on the aquaculture basket body, and a slot for inserting the platform body is provided on the support member. The dry exposure platform is prevented from moving by the clamping connection with the support column.

[0020] Furthermore, a third water outlet for discharging the sand layer together with the aquaculture water is provided at the bottom of the aquaculture basket body, and a switch for opening or closing the third water outlet is installed in the third water outlet. When the third water outlet is opened, it can be used as the cleaning water for cleaning the whole aquaculture basket body together with the discharge of the sand layer.

[0021] To simulate the biological effects of light, preferably, a light source is further provided on the breeding basket body. The light source is a full-spectrum LED lamp, and the illumination intensity of the light source is 50 - 300 Lx, and the illumination time is 12 - 18 hours. The full-spectrum LED lamp is based on sunlight, and the simulation of sunlight intensity and time is closer to nature compared with visible light LED lamps. The design of illumination intensity and illumination time is because butter crabs are mostly formed in an environment with relatively high temperature. In the natural environment, the temperature is relatively high in spring and summer, and the illumination time is about 12 - 18 hours.

[0022] To provide a method for cultivating butter crabs that can be mass-produced and has low cost, preferably, each of the breeding basket bodies forms a crab breeding system in a vertical and / or horizontal arrangement, including a main outlet pipe located at the bottom layer and connecting the first outlet pipes of each breeding basket body at the bottom, a pump body connected to the water outlet end of the main outlet pipe, and a water supply pipe located at the top layer and respectively supplying water to each breeding basket body at the top and connected to the pump body. From top to bottom, the first outlet pipe and / or the second outlet pipe of each breeding basket body located above is directly communicated with the top open part of each breeding basket body located below. By using the first sewage discharge device in the breeding basket, water can flow from the first sewage discharge device in the upper breeding box into the lower breeding box, and through the self-flow between each breeding basket body under the action of gravity, the electric energy required for circulating water and the pipelines required for water inlet and outlet are greatly reduced.

[0023] To solve the third technical problem, the present invention provides a method for screening key genes for the formation of butter crabs, which is characterized by including the following steps:

[0024] S1: Transcriptome sequencing is performed on the ovarian tissues of normal crabs and butter crabs cultured by the above-mentioned butter crab cultivation method.

[0025] S2: In the transcriptome sequencing results of step S1, by aligning to the reference genome, transcript assembly, and gene function annotation, transcripts are obtained.

[0026] S3: Calculate the FPKM value of the expression level of each gene in each sample through the transcript, and calculate the expression level difference of each gene in the comparison between the normal crab group and the butter crab group to identify differentially expressed genes.

[0027] S4: Perform gene enrichment analysis on the differentially expressed genes in step S3 to identify the pathways significantly enriched by the differentially expressed genes.

[0028] S5: Screen out the differentially expressed genes in the pathways identified in step S4.

[0029] S6: Design primers and detect the expression levels of the differentially expressed genes in step S5.

[0030] Furthermore, the pathway enriched by the differential genes is the regulation of lipolysis in adipocytes. The differentially expressed genes in this pathway include the MGL gene, FABP gene, and HSL gene, among which

[0031] The cDNA sequence of the MGL gene is shown as SEQ ID NO.1;

[0032] The cDNA sequence of the FABP gene is shown as SEQ ID NO.2;

[0033] The cDNA sequence of the HSL gene is shown as SEQ ID NO.3.

[0034] Furthermore, the differentially expressed genes also include the GS gene, PKG gene, AC gene, and β-AR gene, among which

[0035] The cDNA sequence of the GS gene is shown as SEQ ID NO.4;

[0036] The cDNA sequence of the PKG gene is shown as SEQ ID NO.5;

[0037] The cDNA sequence of the AC gene is shown as SEQ ID NO.6;

[0038] The cDNA sequence of the β-AR gene is shown as SEQ ID NO.7.

[0039] Furthermore, the primers for the MGL gene are: MGL-F: CTGTTCAGAGGCGTGGTTCT, MGL-R: TACCGTGATGTAGGGCAGGA;

[0040] The primers for the FABP gene are:

[0041] FABP-F: ACGCTGGATGACGGCACCTA,

[0042] FABP-R: CGTCCATCAGCAGTGGTCTCCT;

[0043] The primers for the HSL gene are:

[0044] HSL-F: AGGCTGTGGTGTCCGTGTTCA,

[0045] HSL-R: AGGACGACCAGTGACGCAAGA.

[0046] Compared with the prior art, the advantages of the present invention are as follows:

[0047] 1. By regulating the seawater temperature and salinity, the proportion of buttery crabs in the process of green crab cultivation is increased;

[0048] 2. A sewage discharge device is arranged in the crab cultivation device to realize the self-purification of the sandy layer. While reducing the stress response of crabs, the self-purifying sandy layer can be maintained for crabs to burrow into the sand. At the same time, while simulating the living state of crabs in nature, it can also prevent ulcers from occurring, thereby improving the cultivation success rate of buttery crabs;

[0049] 3. The present invention has studied the ovarian tissues of normal crabs and buttery crabs, and used RNA-seq technology to detect the expression of mRNA to obtain a reliable transcriptome dataset. Using this dataset, the differential genes and signaling pathways between buttery crabs and normal crabs are analyzed to provide a basis for clarifying the regulatory mechanism of the transformation of normal crabs into buttery crabs;

[0050] 4. The results of the present invention show that normal crabs can activate the regulatory pathway of lipolysis in adipocytes by means of artificially inducing temperature and salinity factors, increase the expression levels of MGL, FABP, and HSL genes, thereby accelerating the lipid decomposition process in ovarian tissues and increasing the formation ratio of buttery crabs; at the same time, primers for MGL, FABP, and HSL genes are also designed, providing a technical means for detecting the expression levels of MGL, FABP, and HSL genes, and also proving that salinity and temperature can affect the formation of buttery crabs by affecting the expression of MGL, FABP, and HSL genes. The optimal salinity is 10 - 17‰, and the optimal temperature is 18 - 23°C, improving the cultivation parameters of buttery crabs;

[0051] During the process of the present invention, it is found that: (1) Genes in the regulatory pathway of lipolysis in adipocytes have significant differential expression in the buttery crab group, and these changes may affect the formation of buttery crabs; (2) MGL, FABP, and HSL genes are all differentially expressed genes. In addition, these three genes are all involved in the regulation of lipolysis in adipocytes, and these changes may be the key to the transformation of normal crabs into buttery crabs. Brief Description of the Drawings

[0052] Figure 1 It is a schematic diagram of Embodiment 1 of the present invention;

[0053] Figure 2 It is a schematic diagram of Embodiment 1 of the present invention (except for the door panel and partition);

[0054] Figure 3 It is another schematic diagram of Embodiment 1 of the present invention;

[0055] Figure 4 It is a cross-sectional view of the cultivation basket body of Embodiment 1 of the present invention;

[0056] Figure 5 Schematic diagram of the crab farming system of Embodiment 1 of the present invention;

[0057] Figures 6A - 6B Analysis diagram of the bacterial community structure on the surface of Scylla serrata in Embodiment 2 of the present invention, where there is no bottom substrate, PVC pipes are placed, and a sandy layer is laid. Among them, Figure 6A It is the analysis result diagram of principal coordinate analysis (PCoA); Figure 6B It is the analysis result diagram of non-metric multidimensional scaling (NMDS);

[0058] Figures 7A - 7C Source tracing analysis diagram of the bacterial community on the surface of crabs in Embodiment 2 of the present invention, where Figure 7A It is the source tracing analysis diagram of the bacterial community on the surface of crabs without sandy bottom; Figure 7B It is the source tracing analysis diagram of the bacterial community on the surface of crabs with PVC pipes placed; Figure 7C It is the source tracing analysis diagram of the bacterial community on the surface of crabs in the sandy bottom group;

[0059] Figure 8 Proportion of butter crabs under different temperature conditions in Embodiment 5 of the present invention;

[0060] Figure 9 Proportion of butter crabs under different salinity conditions in Embodiment 6 of the present invention;

[0061] Figures 10A - 10L Appearance comparison diagram of butter crabs and normal crabs in Embodiment 8 of the present invention, where Figure 10A It is the overall picture of a normal crab; Figure 10B It is the partial enlarged view of the red dotted box in A, that is, the photo of the appendage of a normal crab; Figure 10C It is the photo of the ovarian tissue of a normal crab; Figure 10D It is the photo of the muscle tissue of the body of a normal crab; Figure 10E It is the photo of the muscle tissue of the large claw of a normal crab, Figure 10F It is the photo of the hemolymph of a normal crab; Figure 10G It is the overall picture of a butter crab; Figure 10H For Figure 10G The partial enlarged view of the red dotted box in it, that is, the photo of the appendage of a butter crab; Figure 10I It is the photo of the ovarian tissue of a butter crab; Figure 10J It is the photo of the muscle tissue of the body of a butter crab; Figure 10K It is the photo of the muscle tissue of the large claw of a butter crab; Figure 10L It is the photo of the hemolymph of a butter crab;

[0062] Figures 11A - 11B Statistical chart of the hepatopancreas index and gonad index of the initial, normal crab, and butter crab groups in Embodiment 8 of the present invention, where Figure 11AStatistical chart of the hepatopancreas index of the groups of initial, normal crabs, and buttery crabs; Figure 11B Statistical chart of the gonad index of the groups of initial, normal crabs, and buttery crabs; The star indicates a statistically significant difference, "*" represents P < 0.05, and "**" represents P < 0.01;

[0063] Figures 12A - 12F Photomicrographs of histological comparison of cross-sections of the ovaries of normal crabs and buttery crabs in Example 8 of the present invention, where, Figure 12A 4× magnified photograph of the cross-section of the ovary tissue of a normal crab; Figure 12B 10× magnified photograph of the cross-section of the ovary tissue of a normal crab; Figure 12C 20× magnified photograph of the cross-section of the ovary tissue of a normal crab; Figure 12D 4× magnified photograph of the cross-section of the ovary tissue of a buttery crab; Figure 12E 10× magnified photograph of the cross-section of the ovary tissue of a buttery crab; Figure 12F 20× magnified photograph of the cross-section of the ovary tissue of a buttery crab (in the annotation, Fc represents follicular cells, Nu represents the nucleus, No represents the nucleolus, Oc represents the oocyte, Va represents the vacuole, and Yg represents the yolk granule);

[0064] Figure 13 is a statistical chart of the biochemical indexes of the hepatopancreas, ovary, and hemolymph of normal crabs and buttery crabs in Example 8 of the present invention, where, Figure 13A Triglyceride and total cholesterol contents in the hepatopancreas of normal crabs and buttery crabs; Figure 13B Triglyceride and total cholesterol contents in the ovaries of normal crabs and buttery crabs; Figure 13C Triglyceride, total cholesterol, free fatty acid, low-density lipoprotein cholesterol, and high-density lipoprotein cholesterol contents in the hemolymph of normal crabs and buttery crabs; The star indicates a statistically significant difference, "*" represents P < 0.05, and "**" represents P < 0.01;

[0065] Figure 14 Bar chart of the number of differentially expressed genes in the ovary tissues of normal crabs and buttery crabs in Example 9 of the present invention;

[0066] Figure 15 Volcano plot of differentially expressed genes in the ovary tissues of buttery crabs and normal crabs in Example 9 of the present invention, where, the significantly down-regulated differentially expressed genes are shown in blue, the significantly up-regulated differentially expressed genes are shown in red, and the genes with no significant difference in expression are shown in gray; The black vertical line highlights Log 2 (FC) = 1 or -1, FC represents fold change; The black horizontal line represents a P value of 0.05;

[0067] Figure 16 Bubble chart of KEGG enrichment analysis of differentially expressed genes in the ovaries of buttery crabs and normal crabs in Example 9 of the present invention;

[0068] Figure 17 This is the bubble chart of GO enrichment analysis of differentially expressed genes in the ovaries of butter crabs and normal crabs in Example 9 of the present invention;

[0069] Figures 18A - 18C This is the statistical chart of the relative expression levels of MGL, FABP, and HSL genes in the ovarian tissues of Scylla paramamosain at different temperatures in Example 10 of the present invention. Among them, Figure 18A This is the statistical chart of the relative expression level of the MGL gene in the ovarian tissues of Scylla paramamosain at different temperatures; Figure 18B This is the statistical chart of the relative expression level of the HSL gene in the ovarian tissues of Scylla paramamosain at different temperatures; Figure 18C This is the statistical chart of the relative expression level of the FABP gene in the ovarian tissues of Scylla paramamosain at different temperatures;

[0070] Figures 19A - 19C This is the statistical chart of the relative expression levels of MGL, FABP, and HSL genes in the ovarian tissues of Scylla paramamosain at different salinities in Example 10 of the present invention. Among them, Figure 19A This is the statistical chart of the relative expression level of the MGL gene in the ovarian tissues of Scylla paramamosain at different salinities; Figure 19B This is the statistical chart of the relative expression level of the HSL gene in the ovarian tissues of Scylla paramamosain at different salinities; Figure 19C This is the statistical chart of the relative expression level of the FABP gene in the ovarian tissues of Scylla paramamosain at different salinities. Detailed implementation manners

[0071] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0072] Example 1 High and low water level cultivation structure of a crab cultivation device for butter crab cultivation

[0073] As Figures 1 - 5 shown, the crab cultivation device of this embodiment is applicable to high water level cultivation and low water level cultivation. Small crabs can be cultivated at low water level during the growth stage of crabs; commercial crabs or parental crabs for overwintering temporary cultivation can be cultivated at high water level. The following is a further detailed description with reference to the device diagram.

[0074] In order to enable the breeding basket body 1 to breed small crabs with a low water level, a second sewage discharge chamber 22 is provided in the breeding basket body 1 and is relatively isolated from the breeding basket body 1 on different side walls of the breeding basket body 1. It can also be provided on the same side wall, which can be determined according to actual production requirements. A second water inlet 221 with a height between the low water inlet 215 and the high water inlet 216 is opened on the second sewage discharge chamber 22. A second water outlet is opened on the bottom wall of the second sewage discharge chamber 22, and a second water outlet pipe 12 connected to the second water outlet is provided on the back surface of the bottom wall of the breeding basket body 1. The water outlet end of the second water outlet pipe 12 is connected to the middle of the first water outlet pipe 11, and a switch member 13 for connecting or disconnecting the water path with the first water outlet pipe 11 is provided on the second water outlet pipe 12. When crabs need to be bred at a low water level (no sandy layer A is required), the switch member 13 is opened. Here, the second water outlet pipe 12 of the first sewage discharge chamber 21 serves as the water outlet end of the second water outlet pipe 12, and the water in the breeding basket body 1 can flow out through the second water outlet pipe 12.

[0075] In addition, the following is an introduction to high water level breeding. A sandy layer A is laid on the bottom of the breeding basket body 1 of this embodiment. It also includes a sewage discharge device 2. The sewage discharge device 2 includes a first sewage discharge chamber 21 that is relatively isolated from the breeding basket body 1 and is suitable for high water level breeding. A vertically arranged partition 211 is provided in the first sewage discharge chamber 21 to divide the first sewage discharge chamber 21 into a connected first flow channel 212 and a second flow channel 213. A low water inlet 215 lower than the top end of the partition 211 and a high water inlet 216 higher than the top end of the partition 211 are opened on the first wall portion 214 of the first sewage discharge chamber 21 corresponding to the first flow channel 212. A first water outlet is opened on the bottom wall of the first sewage discharge chamber 21 corresponding to the second flow channel 213, thus achieving: by means of the height of the partition 211, a water level pressure is generated inside and outside the first sewage discharge chamber 21, enabling the water in the sandy layer A together with excrement and residual bait to enter the first sewage discharge chamber 21 automatically from the low water inlet 215 through the first flow channel 212, and then discharged through the first water outlet of the second flow channel 213. The first flow channel 212 of the first sewage discharge chamber 21 generates a water level pressure difference inside and outside with the breeding basket body 1 by means of the height of the partition 211. Since the sandy layer A itself is relatively heavy, it will not be washed away by the water flow. In this way, the water in the sandy layer A in the breeding basket body 1 together with excrement and residual bait will enter the first sewage discharge chamber 21 automatically from the low water inlet 215 through the first flow channel 212, and then discharged through the first water outlet of the second flow channel 213, achieving the removal of excrement while retaining the sandy layer A, and finally realizing the self-purification of the sandy layer A.

[0076] In summary, the working process of the low water level and high water level breeding of this breeding device is as follows:

[0077] (1) Low water level breeding:

[0078] The switch member 13 is turned on, so that the second water outlet pipe 12 is connected to the first water outlet pipe 11, and the water in the breeding basket body 1 can flow out from the first sewage chamber 21 and the second sewage chamber 22 of the sewage discharge device 2. Since the height of the second water inlet 221 of the second sewage chamber 22 is located between the low water inlet 215 and the high water inlet 216, and is lower than the top of the partition 211, when the water level reaches the height of the second water inlet 221, the water will enter the second sewage chamber 22 from the second water inlet 221, and then be discharged from the second water outlet of the second sewage chamber 22.

[0079] (2) High water level aquaculture:

[0080] The switch member 13 is closed to disconnect the second water outlet pipe 12 from the first water outlet pipe 11; water is continuously supplied to the breeding basket body 1 through the water inlet pipe, so that the water level remains stable between the low water inlet 215 and the high water inlet 216, and a water level difference is created between the first flow channel 212 and the second flow channel 213 by virtue of the height of the partition 211. Therefore, there is a pressure difference, and under the action of the pressure, the water in the sandy layer A together with the excrement and the residual bait enter the first sewage chamber 21 from the low water inlet 215 through the first flow channel 212, and then is discharged through the first water outlet of the second flow channel 213.

[0081] Example 2 Sandy layer factors of crab breeding device for butter crab breeding

[0082] In the process of cultivating butter crabs in this method, the method is aimed at crabs with roe, i.e. large-sized crabs, so the high water level in the above Example 1 is used for cultivation. In order to explore the role of the sandy layer under high water level cultivation conditions, the following experiments were conducted:

[0083] The artificially reared female mud crabs were used as experimental materials. Before the experiment, the mud crabs were individually reared in the culture basket body 1 of the crab culture device in Example 1 for 14 days to adapt to the environment and fed with frozen bamboo clam meat. During the adaptation period, the water quality indicators of the culture water body were maintained as follows: temperature 15-20°C, dissolved oxygen>8mg / L, salinity 23-25‰, pH 7.8-8.3, ammonia nitrogen<0.50mg / L, nitrite<0.02mg / L, and light exposure time of 12h. An appropriate amount of fresh ice fish was fed at 5:00 pm every day, and feces, residual bait and dead crabs were removed after 3 hours, and 1 / 3 of the water was changed.

[0084] 1. Animal Experimentation:

[0085] A total of 72 healthy crabs (271.80±26.08g) with complete appendages and gonadal development at stage IV or above were selected.

[0086] 2. Test methods:

[0087] Prepare 3 breeding basket bodies 1 of crab breeding devices, put 1 mud crab in each breeding basket body 1. The first group has no bottom substrate, the second group places PVC pipes at the bottom, and the third group lays a sandy layer at the bottom, and the thickness of the sandy layer is 8 cm, and the sand diameter is 1 - 3 mm. All 3 sets of systems are turned on in the circulating water mode. Each group is set with 3 replicate groups, and each replicate group has 8 individually bred mud crabs, and the experimental breeding lasts for 28 days.

[0088] 3. Experimental results

[0089] (1) Survival rate

[0090] The survival rates of mud crabs cultured under different bottom substrates are shown in Table 1.

[0091] Table 1 Survival rates of mud crabs under different bottom substrates

[0092]

[0093] The results show that after 28 days of the experiment, there are significant differences in the survival rates of mud crabs cultured under different bottom substrates (P = 0.03). Among them, the survival rate of the mud crabs in the group without bottom substrate is the lowest, which is 41.2 ± 5.7%, and the survival rate of the mud crabs in the sandy layer is the highest, which is 76.8 ± 7.2%. Therefore, the results indicate that laying a sandy layer in the breeding device can improve the survival rate of mud crabs.

[0094] (2) Ovarian development

[0095] The ovarian development of mud crabs cultured under different bottom substrates is shown in Table 2.

[0096] Table 2 Ovarian indices of mud crabs under different bottom substrates

[0097]

[0098] The results show that there are significant differences in the ovarian development of mud crabs cultured under different bottom substrates (P = 0.04). Among them, the ovarian index of the mud crabs in the group without bottom substrate is the lowest, and the ovarian index of the mud crabs in the sandy layer is the highest. Therefore, the results indicate that laying a sandy layer in the breeding device can accelerate the ovarian development of mud crabs.

[0099] (3) Incidence of ulcer

[0100] The incidences of ulcer of mud crabs cultured under different bottom substrates are shown in Table 3.

[0101] Table 3 Effects of different bottom substrates on the incidence of ulcer

[0102]

[0103] The results showed that there were significant differences in the ulcer incidence rates of mud crabs cultured under different substrates (P = 0.01). Among them, the ulcer incidence rate of mud crabs in the substrate-free group was the highest, reaching 49.9 ± 16.7%, and no ulcers were found in the mud crabs in the sandy layer. Therefore, the results indicated that laying a sandy layer in the cultivation device could significantly inhibit the ulcer incidence rate of mud crabs.

[0104] (4) Analysis of the bacterial community on the surface of mud crabs

[0105] The bacterial community structures on the surfaces of mud crabs cultured under three different substrates were studied. As Figure 6A shown by the principal coordinate analysis (PCoA) results, there were significant differences in the bacterial communities on the surfaces of crabs in the sandy layer group and the PVC pipe group compared with the substrate-free group at the PCo1 level (explaining 38% of the variables), and the differentiation in the sandy layer group was more significant (P < 0.05); Figure 6B the results of non-metric multidimensional scaling (NMDS) analysis also showed significant differences in the bacterial communities on the surfaces of crabs in the sandy layer group compared with the substrate-free group (P < 0.05). The above results all indicated that laying a sandy layer could significantly change the bacterial community structure on the surface of mud crabs.

[0106] Furthermore, through the source analysis of the bacteria on the surface of mud crabs, as shown in Table 4 and Figures 7A - 7C shown, the results showed that the bacterial communities on the surfaces of mud crabs in the substrate-free group and the PVC pipe group mainly originated from the water body. However, in the sandy layer group, the source of the bacterial community on the surface of crabs changed significantly, with the vast majority originating from the sand, and only less than 1% of the bacteria originating from the water body.

[0107] Table 4: Sources of the bacterial communities on the surfaces of mud crabs cultured under different substrates

[0108]

[0109] In summary, the above results indicated that laying a sandy layer in the cultivation device could not only improve the survival rate of mud crabs but also accelerate the ovarian development of mud crabs. In addition, the sandy layer could change the bacterial community structure on the surface of mud crabs, reduce the relative abundance of harmful bacteria, and thus inhibit the occurrence of ulcers.

[0110] Example 3 Self-purification function of the sandy layer of the crab cultivation device for culturing butter crabs

[0111] To explore the self-purification function of the sandy layer in the breeding device, female mud crabs (Scylla paramamosain) raised artificially were used as experimental materials. Before the experiment, the mud crabs were individually raised in the breeding basket body 1 of the crab breeding device as described in Example 1 for 14 days to adapt to the environment, and were fed with frozen razor clams. During the adaptation period, the water quality indicators of the breeding water body were maintained as follows: temperature 15-20 °C, dissolved oxygen > 8 mg / L, salinity 23-25‰, pH 7.8-8.3, ammonia nitrogen < 0.50 mg / L, nitrite < 0.02 mg / L, and the lighting time was 12 h. Appropriate amounts of fresh frozen fish were fed at 5:00 pm every day. After 3 h, feces, residual bait, and dead crabs were removed, and 1 / 3 of the water was changed.

[0112] 1. Animal experiment:

[0113] Select 120 healthy paste crabs (305.80 ± 35.18 g) with gonadal development reaching stage IV or above and having complete appendages.

[0114] 2. Test method:

[0115] Prepare 2 sets of breeding basket bodies 1 of the crab breeding device. Put 1 mud crab in each breeding basket body 1. A sandy layer with a thickness of 8 cm and a sand diameter of 1-3 mm is laid at the bottom of both sets of system devices. However, the circulating water is turned on in one set of systems, that is, the self-purification function of the sandy layer is realized; while the circulating water is not turned on in the other set of systems, that is, the sandy layer cannot achieve self-purification. Each group is set with 3 replicate groups, and each replicate group has 20 individually raised mud crabs. The test breeding lasts for 30 days.

[0116] 3. Test results

[0117] The ulcer incidence rate of mud crabs under the condition of whether the sandy layer has self-purification function is shown in Table 5.

[0118] Table 5 The ulcer incidence rate of mud crabs under different self-purification functions of the sandy layer

[0119]

[0120] The results show that the ulcer rate of mud crabs in the breeding device with a sandy layer laid and the circulating water turned on to achieve self-purification of the sandy layer is 0%, which can better avoid the occurrence of ulcers. However, serious ulcers occurred in the mud crabs cultured without turning on the circulating water and without the self-purification function of the sandy layer. This may be because the excrement and humus of mud crabs will breed the growth of harmful bacteria, resulting in the occurrence of shell ulcers in mud crabs. Therefore, the self-purification function of the sandy layer can effectively avoid the occurrence of ulcers in mud crabs.

[0121] Example 4 The dry-dew platform structure of the crab breeding device for culturing butter crabs

[0122] The artificially reared female mud crabs were used as experimental materials. Before the experiment, the mud crabs were individually reared in the culture basket body 1 of the crab culture device in Example 1 for 14 days to adapt to the environment and fed with frozen bamboo clam meat. During the adaptation period, the water quality indicators of the culture water body were maintained as follows: temperature 15-20°C, dissolved oxygen>8mg / L, salinity 23-25‰, pH 7.8-8.3, ammonia nitrogen<0.50mg / L, nitrite<0.02mg / L, and light exposure time of 12h. An appropriate amount of fresh ice fish was fed at 5:00 pm every day, and feces, residual bait and dead crabs were removed after 3 hours, and 1 / 3 of the water was changed.

[0123] 1. Animal Experimentation:

[0124] A total of 120 healthy crabs (305.80±35.18 g) with complete appendages and gonadal development at stage IV or above were selected.

[0125] 2. Test methods:

[0126] Two sets of crab culture basket bodies 1 were prepared, and one blue crab was placed in each culture basket body 1. The bottoms of the two system culture devices were paved with a sand layer and had a self-cleaning function. One system culture device had a dry platform structure; while the other system culture device did not have a dry platform structure. Three replicate groups were set up in each group, and each replicate group had 20 blue crabs cultured individually, and the experimental culture lasted for 30 days.

[0127] 3. Test results

[0128] The survival rates of blue crabs cultured with and without dry platforms are shown in Table 6.

[0129] Table 6 Effect of dry exposure platform on survival rate

[0130]

[0131] The results showed that after 30 days of testing, the survival rate of blue crabs cultured under the dry platform was significantly different from that under the dry platform (P = 0.012). The survival rate of blue crabs on the basis of adding the dry platform reached 89.0 ± 12.5%. Therefore, the results show that adding the dry platform to the culture device can significantly increase the survival rate of blue crabs.

[0132] In summary, in embodiments 1-4, when the blue crab is cultured under high water level conditions, an 8-10 cm sand layer is laid at the bottom of the culture device, and the self-cleaning function of the sand layer is turned on. In addition, a drying platform is added, which can effectively improve the survival rate of the blue crab and further inhibit the occurrence of blue crab shell ulcers.

[0133] Example 5 Temperature Factors in the Method for Cultivating Butter Crabs

[0134] Using artificially reared female Scylla paramamosain as experimental materials, before the experiment, the mud crabs were individually reared in the breeding basket body 1 of the crab breeding device as in Example 1 to adapt to the environment for three weeks and were fed frozen razor clam meat.

[0135] 1. Animal experiment:

[0136] Select 96 healthy paste crabs (average weight 466.9±61.2 g) with complete appendages and gonadal development reaching stage Ⅳ or above. After fertilization, the gonads of female crabs will gradually develop. In biology, we use the gonadosomatic index to measure the degree of gonadal development. The definition of the gonadosomatic index is the percentage of gonad weight to the total body weight of an individual. Female crabs with a gonadosomatic index above 10% have gonadal development in the later stage and can be called "paste crabs".

[0137] 2. Test method:

[0138] Prepare 4 breeding basket bodies 1 of the crab breeding device, put 1 mud crab in each breeding basket body 1, the initial temperature of the test is 16 - 19 °C, and the initial water temperature is cooled or heated to 13 - 18 °C, 18 - 23 °C, 23 - 28 °C and 28 - 33 °C at a rate of 2 °C per day.

[0139] During the experiment, the mud crabs were cultured for 16 weeks, and the mud crabs were fed frozen razor clam meat at 5% of their body weight every day. The ammonia nitrogen and nitrite were below 0.5 mg / L, the dissolved oxygen was greater than 5 mg / L, the pH range was 8 - 8.5, the light intensity was 50 - 300 Lx, and the light time was 12 - 18 hours.

[0140] 3. Test results

[0141] The proportion of butter crabs among the mud crabs cultured at different temperatures is shown in Table 7 and Figure 8 as shown.

[0142] Table 7: Proportion of butter crabs among the mud crabs cultured at different temperatures

[0143]

[0144] The specifications of the cultured mud crabs were counted. The weight range of butter crabs was 474.2±76.3 g, while the weight range of normal crabs was 450.8±48.8 g. It can be seen that crabs with a slightly larger size may be more likely to be cultured into butter crabs.

[0145] Analysis of the proportion of butter crabs among the mud crabs cultured at different temperatures shows that when the water temperature is 18 - 28 °C, the proportion of butter crab cultivation is the highest, reaching 30 - 50%.

[0146] Salinity factor in the method for culturing butter crabs in Example 6

[0147] Using female Scylla paramamosain reared artificially as experimental materials, before the experiment, the crabs were separately reared in the culture basket body 1 of the crab culture device as in Example 1 for three weeks to adapt to the environment, and were fed with frozen razor clam meat. On the basis that the water temperature in Example 5 was maintained at 18 - 28°C, relevant salinity tests were conducted.

[0148] 1. Animal experiment:

[0149] Forty-five healthy paste crabs (average weight 412.3 ± 60.5 g) with complete appendages and gonadal development reaching stage IV or above were selected.

[0150] 2. Test method:

[0151] Prepare 3 culture basket bodies 1 of the crab culture device, put 1 Scylla paramamosain in each culture basket body 1, keep the water temperature at 18 - 28°C, the initial salinity of the test was 24‰. Among them, the test salinity of the first set of crab culture device was set at 17 - 24‰, the second set of crab culture device was diluted to 10 - 17‰ at a rate of 2‰ per day, and the third set of crab culture device was diluted to 10‰ at a rate of 2‰ per day, and then diluted to 3 - 10‰ at a rate of 1‰.

[0152] During the experiment, the Scylla paramamosain were cultured for 18 weeks, and the crabs were fed with frozen razor clam meat at 5% of their body weight every day. Ammonia nitrogen and nitrite were lower than 0.5 mg / L, dissolved oxygen was greater than 5 mg / L, pH range was 8 - 8.5, light intensity was 50 - 300 Lx, and light time was 12 - 18 hours.

[0153] 3. Test results

[0154] The proportion of butter crabs among Scylla paramamosain cultured at different salinities is shown in Table 8 and Figure 9 as follows.

[0155] Table 8: Proportion of butter crabs among Scylla paramamosain cultured at different salinities

[0156]

[0157] Based on the analysis results of the proportion of butter crabs among Scylla paramamosain cultured at different salinities under the premise that the temperature is 18 - 28°C, when the salinity is 3 - 17‰, the proportion of butter crab cultivation is the highest, reaching 44 - 56%.

[0158] Example 7 Cultivating butter crabs using the culture device and the established method

[0159] Using female Scylla paramamosain reared artificially as experimental materials, before the experiment, the crabs were temporarily cultured in a cement pond (3m * 5m * 1.5m) for three weeks to adapt to the environment, and were fed with frozen razor clam meat.

[0160] 1. Animal experiment:

[0161] Select 120 healthy paste crabs with complete appendages and gonadal development reaching stage Ⅳ or above (average weight 405.4±51.2 g).

[0162] 2. Test method:

[0163] The test was divided into two groups and cultured for 12 weeks. Control group: The mud crabs were placed in 3 square pools for cultivation. The specifications of the square pools were 2.5m * 2.5m * 1m. 20 crabs were placed in each square pool. The water temperature was not controlled additionally and maintained at the natural water temperature state. The salinity was 20 - 25‰, the dissolved oxygen > 8mg / L, the pH was 7.8 - 8.3, the ammonia nitrogen < 0.50mg / L, the nitrite < 0.02mg / L, and the light time was 12h. Experimental group: Prepare 1 culture basket body 1 of a crab culture device. Put 1 mud crab in each culture basket body 1. The culture device used high-water-level culture. An 8 - 10 cm sandy layer was laid at the bottom, and the sandy paper layer had a self-purification function. In addition, there was a dry dew platform for rest. The temperature was controlled at 18 - 28°C, the salinity was 3 - 17‰, the dissolved oxygen > 8mg / L, the pH was 7.8 - 8.3, the ammonia nitrogen < 0.50mg / L, the nitrite < 0.02mg / L, and the light time was 14h.

[0164] 3. Test results

[0165] The survival rate during the test process and the final breeding proportion of butter crabs are shown in Table 9

[0166] Table 9 Survival rate and butter crab proportion of different groups

[0167]

[0168] Note: The star indicates a statistically significant difference, P < 0.05 (*) or P < 0.01 (**).

[0169] The results show that when culturing mud crabs in the culture device and controlling a certain temperature and salinity range, the survival rate of mud crabs is increased to 82.6±9.7%, and the proportion of butter crabs reaches 54.9±10.3%. Compared with the proportion of butter crabs under natural conditions (1 / 1000), the method of the present invention can significantly increase the breeding proportion of butter crabs.

[0170] Therefore, the results show that applying the method of the present invention in the above-mentioned culture device can effectively improve the survival rate of Scylla paramamosain and the breeding proportion of butter crabs.

[0171] Example 8 Analysis of the differences in appearance and physiological indexes between normal crabs and butter crabs

[0172] 1. Animals and sample collection

[0173] Six butter crabs cultured by the method of Example 7 were selected as the butter crab group, and another six paste crabs (i.e., those with ovarian development at stage IV or above) were selected as the normal crab group;

[0174] 2. Comparison of the appearances of butter crabs and normal crabs

[0175] The various parts of the crabs in the normal crab group and the butter crab group were observed separately and the picture results were recorded. The picture results are shown in Figure 10;

[0176] Specifically, except for the difference in the color of the appendages, see Figure 10A and 10B , there was no obvious difference between the abdomens of butter crabs and normal crabs. The most obvious external features for differentiating normal crabs and "butter crabs" were observed at the appendages and joint membranes. See Figure 10H , the "butter crabs" showed obvious redness. See Figure 10I , compared with normal crabs, the internal tissue features of "butter crabs" included ovarian atrophy, with the color changing from orange to dark red; see Figure 10J and 10K , the muscle tissue changed from grayish-white to brownish; see Figure 10L , the hemolymph was dark red and filled with oily substances, which was one of the most important features for differentiating normal crabs and "butter crabs". See Figure 10F , because the hemolymph of normal crabs is usually blue.

[0177] 3. Comparison of the hepatosomatic index (HSI) and gonadosomatic index (GSI)

[0178] The hepatopancreas weight, gonad weight and total weight of the crabs before cultivation (initial group), normal crabs and butter crabs were weighed separately, and then the hepatosomatic index and gonadosomatic index were calculated according to the calculation formulas. The calculation formulas are as follows

[0179] Hepatosomatic index (HSI, %) = hepatopancreas weight / crab body weight * 100%;

[0180] Gonadosomatic index (GSI, %) = gonad weight / crab body weight * 100%; The calculation results are shown in Table 10

[0181] Table 10 HSI and GSI of crabs in different groups

[0182]

[0183] Figure 11A and Figure 11B are the illustrations of Table 10. See Figure 11A and Figure 11B, analysis shows that compared with the initial group and the normal crab group, the gonadosomatic index (GSI) of butter crabs showed a statistically significant decrease (P<0.01). Therefore, the ovarian tissue played an important role in the transformation of normal crabs into butter crabs.

[0184] 4. HE staining observation of the ovarian tissues of normal crabs and butter crabs

[0185] Hematoxylin-eosin staining, abbreviated as HE staining, is one of the commonly used staining methods in paraffin section technology. The experimental steps of HE staining mainly include paraffin embedding, sectioning and staining. Briefly, a small part of ovarian tissue was fixed in 4% tissue cell fixative for 24 hours. After fixation, the samples were dehydrated by continuous immersion in graded ethanol solutions and then embedded in paraffin. Subsequently, the paraffin blocks containing the samples were cut into sections 3-4 μm thick. Then, the sections were dewaxed with xylene and rehydrated in a series of graded ethanol solutions. Next, they were stained with hematoxylin and eosin and covered with neutral resin. Finally, microscopic observation (NOVEL, DN-800M) and image capture analysis were performed.

[0186] For the results of the completed staining steps, please refer to Figures 12A - 12F , from which it can be concluded that the ovarian tissue of normal crabs showed a complete and clear oocyte structure (Oc), with yolk granules (Yg) evenly distributed within Oc. In addition, clear structures of the cell nucleus (Nu) and nucleolus (No) were observed; on the contrary, the ovarian tissue of butter crabs showed a degenerated state, with Oc folded, cell boundaries blurred, and accompanied by structural changes. In addition, the number of Yg within Oc decreased significantly, while the number of follicular cells (Fc) around Oc increased significantly.

[0187] 5. Comparison of lipid contents in the hepatopancreas, ovary and hemolymph tissues of normal crabs and butter crabs

[0188] Experimental procedure: The hepatopancreas and ovarian tissues of normal crabs (n = 6) and butter crabs (n = 6) were homogenized in physiological saline and inserted into ice. The homogenate was centrifuged at 2500 rpm for 15 minutes at 4°C. The supernatant was used to analyze the contents of triglyceride (TG) (A110-1-1) and total cholesterol (T-CHO) (A111-1-1), and the determination was carried out according to the instructions in the kit provided by Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Hemolymph samples were collected from the crabs and stored in 1.5 mL EPP tubes at 4°C overnight. Subsequently, it was centrifuged at 2500 rpm for 15 minutes at 4°C. The supernatant was used to detect the contents of TG (A110-1-1), T-CHO (A111-1-1), non-esterified fatty acid (NEFA) (A042-2-1), low density lipoprotein cholesterol (LDL-C) (A113-1-1) and high density lipoprotein cholesterol (HDL-C) (A112-1-1), and the measurement results are shown in Tables 11-13.

[0189] Table 11 Triglyceride and total cholesterol indexes of hepatopancreas of normal crabs and butter crabs

[0190]

[0191] Table 12 Triglyceride and total cholesterol indexes of ovarian tissues of normal crabs and butter crabs

[0192]

[0193] Table 13 Lipid indexes of hemolymph of normal crabs and butter crabs

[0194]

[0195] See Figures 13A - 13C For the statistical charts of Tables 11-13, it can be seen that there is no significant difference in the contents of triglyceride and total cholesterol in the hepatopancreas of butter crabs and normal crabs (P>0.05). However, compared with normal crabs, the levels of triglyceride and total cholesterol in the ovaries of butter crabs showed a statistically significant decrease (P<0.05). In addition, except that the content of non-esterified fatty acid was not significantly different from that of the normal crab group, the concentrations of other indexes (triglyceride, total cholesterol, low density lipoprotein cholesterol and high density lipoprotein cholesterol) in the hemolymph of the butter crab group were significantly higher than those of the normal crab group (P<0.01).

[0196] Example 9 Comparative transcriptomic analysis of ovarian tissues between normal crabs and butter crabs

[0197] 1. RNA extraction, library preparation and sequencing

[0198] 1.1 Method

[0199] (1) After the RNA sample was detected to be qualified, mRNA was enriched with magnetic beads carrying Oligo(dT). Subsequently, fragmentation buffer was added to break the mRNA into short fragments. Using the mRNA as a template, first-strand cDNA was synthesized with random hexamers. Then, buffer, dNTPs, DNA polymerase I, and RNase H were added to synthesize second-strand cDNA. Subsequently, the double-stranded cDNA was purified using AMPure XP beads. The purified double-stranded cDNA was first subjected to end repair, A-tailing, and ligation of sequencing adapters, and then fragment size selection was performed using AMPure XP beads. Finally, PCR amplification was carried out, and the PCR product was purified using AMPure XP beads to obtain the final library. After the library construction was completed, Qubit 2.0 was first used for preliminary quantification, and the library was diluted. Subsequently, Agilent 2100 was used to detect the insert fragment size of the library. After the insert fragment met the expectations, qPCR was used to accurately quantify the effective concentration of the library to ensure the library quality.

[0200] (2) The initial fluorescence image data obtained through the Illumina platform was converted into short reads (raw data) through base calling. These short reads were subsequently archived in FASTQ format, including sequence data and related sequencing quality metrics. FastQC was used to perform quality control on the raw data, and Trim_Galore (v0.6.2) software was used for filtering to obtain Clean data. Using Hisat2 software, the filtered Clean data was aligned with the published genome data of Scylla paramamosain. FeatureCount was used to quantify the gene fragments aligned with the genomic exon sequences to generate the raw expression matrix.

[0201] 1.2 Results:

[0202] Using the high-throughput sequencing platform (Illumina NovaSeq 6000), cDNA libraries of the ovaries of 12 Scylla paramamosain (6 normal crabs and 6 butter crabs in Example 8) were constructed and analyzed. The total sequencing data was 81.35 Gb. The GC content was 41.10 - 47.31%. The distribution ranges of Q20 and Q30 in the 12 cDNA libraries were 97.62 - 98.07% and 93.47 - 94.45% respectively. These results indicate that the transcriptome sequencing data can be used for further analysis. All sequencing information is shown in Table 14.

[0203] Table 14 Transcriptome sequencing information

[0204]

[0205] 2. Analysis of differentially expressed genes (DEGs) and functional enrichment analysis:

[0206] 2.1 Method:

[0207] (1) Use the "stinger" software package in R language to screen for effectively expressed genes. The screening criterion is that >75% of the fragments are expressed in all samples. Use the "CPM" function of the "edgeR" software package to standardize the expression matrix, and logarithmize the obtained CPM values to log 2 (CPM + 1) to obtain a standardized expression matrix. Use the DESeq2 software package to perform differential expression analysis on two treatments (butter crab vs normal crab). Use the "DESeq2" software package to select the differential genes DEGs between butter crab and normal crab according to the criteria of P < 0.05 and |log 2 (fold change)| > 1.

[0208] (2) Use Diamond software to annotate the protein sequences corresponding to the published Scylla paramamosain genome file against the Nr (NCBI non-redundant protein sequences) and Swiss-Prot databases, and set the E-value threshold to 10 -5 . Use the R language "ClusterProfiler" software package to perform GO and KEGG enrichment analysis on DEGs. In KEGG enrichment analysis, pathways with P < 0.05 and P.adjust < 0.02 are considered significantly enriched. For GO analysis, entries with P < 0.05 are considered significantly enriched.

[0209] 2.2 Results:

[0210] (1) Analysis of differentially expressed genes (DEGs):

[0211] Normalize the original reads count and adjust the sequencing depth. In the comparison between normal crab and butter crab, using the criteria of P < 0.05 and |log 2 (fold change)| > 1, a total of 3321 DEGs were identified, including 1749 up-regulated DEGs and 1572 down-regulated DEGs, as shown in Figure 14 and Figure 15 .

[0212] (2) Functional enrichment analysis of DEGs:

[0213] To describe the observed expression patterns in more detail, perform KEGG enrichment analysis on significantly up-regulated and down-regulated DEGs. The top 20 enriched KEGG pathways of all DEGs are shown in Figure 16As shown, the KEGG pathways most significantly enriched in butter crabs were identified as "Regulation of lipolysis in adipocytes (ko04923)", followed by "Whooping cough (ko05133)", "TNF signaling pathway (ko04668)", "Notch signaling pathway (ko04330)", "Ribosome (ko03010)", etc.

[0214] In addition, GO enrichment analysis of DFGs was performed in terms of biological process (BP), cellular component (CC), and molecular function (MF). The enriched GO terms of all DEGs are as Figure 17 shown. In the BP category, terms such as "regulation of small GTPase-mediated signal transduction", "small GTPase-mediated signal transduction", and "regulation of defense response" were significantly enriched in butter crabs. In the CC category, the top three enriched terms in butter crabs were "perinuclear region of cytoplasm", "apical part of cell", and "lateral side of membrane". In the MF category, the terms significantly enriched in the butter group mainly included "nuclease activity", "actin binding", and "cadherin binding", etc.

[0215] 3. Screening of key genes in the regulation pathway of lipolysis in adipocytes

[0216] Through the KEGG pathway website ( https: / / www.kegg.jp / ) relevant genes involved in the regulation pathway of lipolysis in adipocytes (ko04923) significantly enriched in butter crabs were searched, and differential genes were analyzed through the results of transcriptome data. It was found that a total of 7 differentially expressed genes were identified in the regulation pathway of lipolysis in adipocytes. The specific information is shown in Table 15. Among the up-regulated DEGs, MGL, FABP, and HSL genes are the key genes regulating lipid decomposition in the ovaries of butter crabs.

[0217] Table 15 Differentially expressed genes in the regulation pathway of adipocyte lipolysis

[0218]

[0219]

[0220] Example 10 Relative expression levels of MGL, HSL, and FABP genes in the ovarian tissues of Scylla paramamosain under different temperature and salinity conditions

[0221] 1. Method:

[0222] (1) To reveal the expression patterns of the key genes (MGL, HSL, and FABP) screened by transcriptome in the above temperature and salinity examples, ovarian tissues of 6 Scylla paramamosain in Example 5 and Example 6 were respectively selected for qPCR analysis;

[0223] (2) RNA extraction and reverse transcription: Total RNA of ovarian tissue was extracted using TRIzol reagent (Invitrogen, USA). The extracted RNA pellet was dissolved in 20 - 25 μL of DEPC-treated water. The total RNA was treated with RNase-Free DNase (Takara, China) to remove genomic DNA contaminants. Then, the concentration and integrity of the extracted total RNA were detected using Nanodrop-2000 (Thermo, USA) and 2% gel electrophoresis, respectively. 2 μg of RNA was reverse transcribed into complementary DNA (cDNA) using the HiFiScript cDNA Synthesis Kit (CWBiotech, Shanghai, China) for quantitative PCR analysis.

[0224] (3) Primer design: According to the sequences of MGL, HSL, and FABP in the transcriptome data, corresponding specific primers were designed (see Table 16). In addition, β-actin was used as an internal reference gene.

[0225] Table 16 Primer information for qPCR

[0226]

[0227] (4) qPCR analysis: Quantitative PCR analysis was performed using LightCycler 96 (Roche) to evaluate gene expression. Each qPCR system included 10 μL of 2×Magic SYBR Green mixture, 1 μL of cDNA, 0.4 μL of each 10 mM primer, and 8.2 μL of ddH 2 O, for a total of 20 μL. The PCR conditions were: initial denaturation (95 °C, 30 s), denaturation (95 °C, 5 s), and annealing (60 °C, 30 s), for a total of 40 cycles. The 2 -△△CT method was used to normalize the CT values of the target gene and the internal reference gene (β-actin), and the results were the relative expression levels of these genes.

[0228] 2. Results

[0229] See Figures 18A - 18C , temperature significantly affected the relative expression levels of MGL, FABP, and HSL genes in the ovarian tissue of Scylla paramamosain. With the increase in temperature, the expression level of MGL was downregulated, while the expression levels of FABP and HSL genes were significantly upregulated at 18 - 23 °C, which also corresponded to the highest formation ratio of butter crabs at 18 - 23 °C. Similarly, see Figures 19A - 19C, salinity also significantly affected the relative expression levels of MGL, FABP, and HSL genes in the ovarian tissues of mud crabs. Interestingly, the expression levels of MGL and FABP were significantly upregulated at salinities of 10-17‰, which may explain the highest proportion of butter crab formation at salinities of 10-17‰. In summary, MGL, FABP, and HSL genes played a key role in the formation of butter crabs under different temperatures and salinities.

Claims

1. A method for cultivating butter crabs, comprising the following steps: a. Screening blue crabs bred from butter crabs: Select healthy blue crabs with a size of 400-500g and complete appendages; b. Cultivation management: The bait shall be fresh or chilled shellfish, and the daily dry matter weight shall not be less than 5% of the body weight of the cultured blue crabs; Features: The blue crab in step a is a female crab, and the gonadal development reaches stage IV or above, and the ovarian index is greater than 10%; In the culture management conditions in step b, the salinity of seawater is in the range of 3-17‰, the temperature of seawater is in the range of 18-28°C, and the fluctuation between day and night does not exceed ±2°C; The blue crabs in step a and step b are individually raised in a crab breeding device, which comprises: Breeding basket body (1); A sandy layer (A) is laid on the bottom of the breeding basket body (1); The sewage discharge device (2) is arranged in the breeding basket body (1), and water in the sandy layer (A) together with excrement and residual bait can be discharged by means of water level pressure generated inside and outside the sewage discharge device (2).

2. The method for cultivating butter crab according to claim 1, characterized in that: The sewage discharge device (2) comprises a first sewage discharge chamber (21) which is relatively isolated from the breeding basket body (1) and is suitable for high water level breeding, and a vertical partition (211) is provided in the first sewage discharge chamber (21) to separate the first sewage discharge chamber (21) into a first flow channel (212) and a second flow channel (213) which are connected to each other; A low water inlet (215) lower than the top of the partition (211) and a high water inlet (216) higher than the top of the partition (211) are provided on the first wall portion (214) of the first sewage chamber (21) corresponding to the first flow channel (212), and a first water outlet is provided on the bottom wall of the first sewage chamber (21) corresponding to the second flow channel (213), thereby achieving: water level pressure is generated inside and outside the first sewage chamber (21) by virtue of the height of the partition (211), so that water in the sandy layer (A) together with excrement and leftover bait can enter the first sewage chamber (21) from the low water inlet (215) through the first flow channel (212), and then be discharged through the first water outlet of the second flow channel (213).

3. The method for cultivating butter crab according to claim 2, characterized in that: A portion of the bottom wall of the breeding basket body (1) directly serves as the bottom wall of the first sewage discharge chamber (21); the first sewage discharge chamber (21) further comprises a side peripheral wall extending upward from the bottom wall, and the first wall portion (214) constitutes a portion of the side peripheral wall; the first sewage discharge chamber (21) directly uses the side wall portion of the breeding basket body (1) as the inner side wall of the first sewage discharge chamber (21), and the side peripheral wall has three portions: a first wall portion (214) arranged opposite to the inner side wall, and a first side wall (217) and a second side wall (218) connecting the first wall portion (214) and the inner side wall; the partition plate (211) is connected to the first side wall (217) and the second side wall (218), and the bottom end of the partition plate (211) is connected to the bottom wall of the first sewage discharge chamber (21).

4. The method for cultivating butter crab according to claim 3, characterized in that: The top of the first sewage discharge chamber (21) is open, and the back of the bottom wall of the breeding basket body (1) is provided with a first water outlet pipe (11) connected to the first water outlet of the second flow channel (213).

5. The method for cultivating butter crab according to claim 4, characterized in that: A dehumidifying platform (3) for crabs to dehumidify and rest is detachably provided in the breeding basket body (1); the dehumidifying platform (3) is arranged adjacent to the first sewage discharge chamber (21) and its height is between the low water inlet (215) and the high water inlet (216); the dehumidifying platform (3) comprises a platform body and at least two drainage holes arranged on the platform body for drainage; a notch is provided on the platform body to fit the first sewage discharge chamber (21); and a supporting member (14) for supporting the platform body is also provided on the breeding basket body (1); the supporting member (14) is provided with a slot (141) for the platform body to be inserted.

6. The method for cultivating butter crab according to claim 5, characterized in that: The bottom of the breeding basket body (1) is provided with a third water outlet for discharging the sand layer (A) together with the breeding water, and a switch (4) for opening or closing the third water outlet is installed in the third water outlet.

7. The method for cultivating butter crab according to any one of claims 2 to 6, characterized in that: The breeding basket body (1) is also provided with a light source, the light intensity of the light source is 50-300Lx, and the lighting time is 12-18 hours.

8. The method for cultivating butter crab according to claim 7, characterized in that: The breeding basket bodies (1) are arranged vertically and / or horizontally to form a crab breeding system, comprising a main water outlet pipe (51) located at the bottom layer and connected to the first water outlet pipes (11) of the breeding basket bodies (1) at the bottom, a pump body (5) connected to the water outlet end of the main water outlet pipe (51), and a water supply pipe located at the top layer and connected to the pump body (5) for supplying water to the breeding basket bodies (1) at the top. From top to bottom, the first water outlet pipe (11) and / or the second water outlet pipe (12) of the breeding basket bodies (1) at the top are directly connected to the top open portion of the breeding basket bodies (1) at the bottom.

9. A method for screening key genes for the formation of butter crabs, characterized in that: The following steps are included: S1: performing transcriptome sequencing on the ovarian tissues of normal crabs and butter crabs cultured according to the butter crab cultivation method according to any one of claims 1 to 8; S2: In step S1, transcripts are obtained by aligning the transcriptome sequencing results to the reference genome, assembling transcripts, and annotating gene functions; S3: Calculate the FPKM value of the expression of each gene in each sample through the transcript, and calculate the difference in the expression of each gene in the comparison between the normal crab group and the butter crab group to identify the differentially expressed genes; S4: Perform gene enrichment analysis on the differentially expressed genes in step S3 to identify pathways where the differentially expressed genes are significantly enriched; S5: screening the differentially expressed genes in the pathways identified in step S4; S6: Design primers and detect the expression levels of the differentially expressed genes in step S5.

10. The method for screening key genes for the formation of butter crab according to claim 9, characterized in that: The pathway in which the differentially expressed genes are enriched is the regulation of lipolysis in adipocytes. The differentially expressed genes in this pathway include MGL gene, FABP gene and HSL gene. The cDNA sequence of the MGL gene is shown in SEQ ID NO.1; The cDNA sequence of the FABP gene is shown in SEQ ID NO.2; The cDNA sequence of the HSL gene is shown in SEQ ID NO.

3.

11. The method for screening key genes for the formation of butter crab according to claim 9 or 10, characterized in that: The differentially expressed genes also include GS gene, PKG gene, AC gene, β-AR gene, wherein The cDNA sequence of the GS gene is shown in SEQ ID NO.4; The cDNA sequence of the PKG gene is shown in SEQ ID NO.5; The cDNA sequence of the AC gene is shown in SEQ ID NO.6; The cDNA sequence of the β-AR gene is shown in SEQ ID NO.

7.

12. The method for screening key genes for the formation of butter crab according to claim 10, characterized in that: The primers of the MGL gene are: MGL-F: CTGTTCAGAGGCGTGGTTCT, MGL-R: TACCGTGATGTAGGGCAGGA; The primers for the FABP gene are: FABP-F:ACGCTGGATGACGGCACCTA, FABP-R:CGTCCATCAGCAGTGGTCTCCT; The primers for the HSL gene are: HSL-F:AGGCTGTGTGTCCGTGTTCA, HSL-R: AGGACGACCAGTGACGCAAGA.

Images