Pharmaceutical composition and application thereof in preparation of medicines for treating hepatic diseases

Abstract

The invention discloses a pharmaceutical composition. The pharmaceutical composition is characterized in that the pharmaceutical composition comprises a carrier compound, the carrier compound is formed by an exosome and a lipid substance or a cationic polymer through positive and negative charge attraction, and the carrier compound further comprises an active pharmaceutical ingredient nucleic acid, the pharmaceutical composition also optionally comprises a pharmaceutically applicable carrier. The pharmaceutical composition enables delivery of nucleic acids. Therefore, hepatic targeting expression of nucleic acid is realized, and the survival rate of individuals suffering from hepatic diseases (such as an acute hepatic failure model and hepatic fibrosis) is improved.

Description

Technical Field

[0001] The present invention belongs to the field of pharmacy, and particularly relates to a pharmaceutical composition and its application in the preparation for treating liver diseases. Background Art

[0002] Gene therapy is a therapeutic strategy that delivers foreign genetic material into the target cells of patients to replace defective genes. The goal of gene therapy for genetic diseases is to enable the therapeutic gene to be persistently expressed in the target cells, and its expression level is sufficient to improve or cure the disease symptoms with minimal adverse events. Currently, the means of gene therapy include in vitro transduction and in vivo gene delivery. In vitro transduction refers to extracting cells from patients and transducing them with the target gene, and then returning the cells to the patients through procedures such as hematopoietic stem cells.

[0003] In vivo transduction has high requirements for vectors. Nanolipid particles (Lipid nanoparticles, LNPs) are non-viral vectors for gene delivery that have been widely studied in recent years. Compared with viral vectors, LNP delivery can achieve transient expression, reduce the probability of off-target by local administration; meanwhile, its immunogenicity is much lower than that of viruses. However, LNP also has several problems. First, its targeting property is poor and it cannot be well delivered to the target cells. Second, it is complex to trace PEG-containing LNPs during in vitro and in vivo uptake studies using lipid labels containing fluorophores or radioactive labels. Finally, the active lipids in LNP may also be recognized by the immune system and activate the immune response, thus causing potential safety hazards, and related immune activation problems have been reported in many literatures. Therefore, finding a nucleic acid delivery vector with high targeting and safety is the top priority of current gene therapy.

[0004] Exosomes are extracellular vesicles with a diameter of 30 - 200 nm, which are produced and secreted by somatic cells. They have a topological structure similar to cells and are rich in nucleic acids, proteins, lipids, and metabolites. Exosomes can act as transmitters of genetic information, delivering the carried cytokines, signal molecules, and genetic material to neighboring and distant cells, thereby regulating the physiological and pathological states of recipient cells and participating in the occurrence and development processes of various diseases. Since exosomes can mediate cell-to-cell communication, donor cells can transfer exogenous substances such as proteins, mRNA, miRNA, and lipids to recipient cells through exosomes, and it is used as a nanocarrier for drug delivery research. Summary of the Invention

[0005] Aiming at the problem that the existing technologies lack effective carriers for nucleic acid drug delivery for liver diseases, the present application provides a pharmaceutical composition and its application in the preparation of drugs for treating liver diseases. The pharmaceutical composition can achieve liver-targeted expression of the target gene in vivo. Compared with traditional liposome drug carriers, it has higher liver targeting and stability, lower immunotoxicity, better biocompatibility, and longer blood circulation time.

[0006] To solve the above technical problems, a technical solution provided by the present invention is: a pharmaceutical composition, the pharmaceutical composition includes a carrier complex, the carrier complex is formed by exosomes and lipid substances or cationic polymers through positive and negative charge attraction, the carrier complex further includes an active pharmaceutical ingredient nucleic acid, and the pharmaceutical composition also optionally includes a pharmaceutically acceptable carrier.

[0007] In a specific embodiment of the present invention, the lipid substances include liposomes or cationic lipids, the cationic lipids contain one or more polar regions, the polar regions can bind negatively charged components, and the cationic lipids are preferably DOTAP, DLin-MC3-DMA, DOTAM or DOSPA; the cationic polymer contains protonatable amino groups, and the amino groups form the carrier complex with the exosomes by the way of positive and negative charge contact and attraction, and the cationic polymer is preferably polyethyleneimine, polyurethane, chitosan or diethylaminoethyl dextran.

[0008] In an embodiment of the present invention, the exosomes are derived from mammalian cells, and the mammalian cells include but are not limited to 293 series cells and stem cells. The 293 series cells include 293T cells, 293F cells, 293FT cells and 293 cells, and the stem cells include mesenchymal stem cells, adult stem cells and embryonic stem cells, etc.

[0009] As one of the implementation manners, the 293T cells can be obtained by transfecting 293 cells with the adenovirus E1A gene.

[0010] In a preferred embodiment of the present invention, the amount of the exosomes in the carrier complex is not less than 1E5 / μl.

[0011] In a preferred embodiment of the present invention, the amount of the lipid substances or cationic polymers is not less than 0.3 μg / μl.

[0012] In one embodiment of the present invention, the ratio of the exosomes to the lipid substance or cationic polymer is 1E5: 0.3 - 10 μg, preferably 1E5: 0.3 - 3 μg, such as 1E5: 0.4 μg, 1E5: 0.5 μg, 1E5: 0.6 μg, 1E5: 0.7 μg, 1E5: 0.8 μg, 1E5: 0.9 μg, 1E5: 1 μg, 1E5: 1.1 μg, 1E5: 1.2 μg, 1E5: 1.3 μg, 1E5: 1.4 μg, 1E5: 1.5 μg, 1E5: 1.6 μg, 1E5: 1.7 μg, 1E5: 1.8 μg, 1E5: 1.9 μg, 1E5: 2 μg, 1E5: 2.1 μg, 1E5: 2.2 μg, 1E5: 2.3 μg, 1E5: 2.4 μg, 1E5: 2.5 μg, 1E5: 2.6 μg, 1E5: 2.7 μg, 1E5: 2.8 μg or 1E5: 2.9 μg.

[0013] In one embodiment of the present invention, the active pharmaceutical ingredient nucleic acid is selected from plasmids, mRNA and small RNAs.

[0014] As one kind of the embodiments, the 293T cells are obtained by transfecting 293 cells with the adenovirus E1A gene.

[0015] In a preferred embodiment of the present invention, the active pharmaceutical ingredient nucleic acid is a plasmid. Preferably, the active pharmaceutical ingredient nucleic acid is a plasmid containing the coding sequence of hIL-10 (Human Interleukin 10). More preferably, the active pharmaceutical ingredient nucleic acid contains the coding sequence of hIL-10.

[0016] The pharmaceutically acceptable carrier is a conventional carrier in the art, and the carrier can be any suitable physiologically or pharmaceutically acceptable pharmaceutical excipient. The pharmaceutical excipients are conventional pharmaceutical excipients in the art, preferably including pharmaceutically acceptable excipients, fillers or diluents, etc.

[0017] To solve the above technical problems, one technical solution provided by the present invention is: the preparation method of the pharmaceutical composition as described in the present invention, characterized in that the preparation method comprises the following steps: mixing the carrier complex in a suitable buffer system physically to obtain the carrier complex; preferably, the pH value of the buffer system is 7 - 8.

[0018] To solve the above technical problems, one technical solution provided by the present invention is: the application of the pharmaceutical composition or exosomes derived from 293T cells as described in the present invention in the preparation of drugs for treating liver diseases.

[0019] In a preferred embodiment of the present invention, the liver disease is a liver disease with gene mutation, deletion or abnormal function. Preferably, the liver disease is liver failure or liver fibrosis. More preferably, the liver failure is exogenous drug-induced liver failure or liver fibrosis. Further preferably, the exogenous drug is concanavalin A, acetaminophen or CCL4.

[0020] On the basis of conforming to the common knowledge in the art, the above preferred conditions can be combined arbitrarily to obtain various preferred examples of the present invention.

[0021] The reagents and raw materials used in the present invention are all commercially available.

[0022] The positive and progressive effects of the present invention are as follows:

[0023] The pharmaceutical composition can achieve homing-targeted delivery of the active pharmaceutical ingredient nucleic acid. For example, the target plasmid human hIL-10 gene can be targeted to the liver parenchyma to achieve the therapeutic effects on ConA-induced acute liver injury in mice, APAP-induced drug-induced acute liver injury in mice, and CCL4-induced chronic liver fibrosis in mice. Exosomes derived from 293T cells have good liver targeting and hepatoprotective pharmacodynamic effects, as well as the function of protecting the stability of the expression vector, etc., which can improve the liver-targeted expression of the active pharmaceutical ingredient nucleic acid in cells and in vivo, enabling it to be stably expressed in vivo while reducing the possibility of immune response. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The expression effects of exosomes derived from 293T cells combined with polymers, lipids and liposomes loaded with GFP plasmid to construct a pharmaceutical composition in the recipient cell 293T.

[0025] Figure 2 The expression effects of exosomes derived from 293F cells and UCFT cells combined with liposomes loaded with GFP plasmid to construct a composition in the recipient cell 293T.

[0026] Figure 3 The positive rates of different pharmaceutical compositions prepared by different methods for delivering GFP to the recipient cell 293T.

[0027] Figure 4 The change of the expression level of hIL-10 over time after administration of the pharmaceutical composition.

[0028] Figure 5 The survival rates of each group of mice in the ConA-induced acute liver failure model of mice after treatment with the pharmaceutical composition.

[0029] Figure 6The levels of serum ALT in each group of mice and the levels of serum AST in each group of mice after the drug composition was administered to treat the ConA-induced acute liver failure model in mice.

[0030] Figure 7 The mRNA levels of hIL-10 in the hepatocytes of each group of mice after the drug composition was administered to treat the ConA-induced acute liver failure model in mice.

[0031] Figure 8 The survival rates of each group of mice in the APAP-induced drug-induced liver injury model in mice after the drug composition was administered.

[0032] Figure 9 The levels of serum ALT in each group of mice and the levels of serum AST in each group of mice after the drug composition was administered to treat the APAP-induced drug-induced liver injury model in mice.

[0033] Figure 10 The mRNA levels of hIL-10 in the hepatocytes of each group of mice after the drug composition was administered to treat the APAP-induced acute liver failure model in mice.

[0034] Figure 11 The levels of serum ALT in each group of mice after the drug composition was administered to treat the CCl4-induced liver fibrosis model in mice.

[0035] Figure 12 The levels of serum AST in each group of mice after the drug composition was administered to treat the CCl4-induced liver fibrosis model in mice.

[0036] Figure 13 The levels of serum TBIL in each group of mice after the drug composition was administered to treat the CCl4-induced liver fibrosis model in mice.

[0037] Figure 14 H&E staining of the pathological sections of the liver tissues of each group of mice after the drug composition was administered to treat the CCl4-induced liver fibrosis model in mice.

[0038] Figure 15 The mRNA levels of α-SAM in the liver tissues of each group of mice after the drug composition was administered to treat the CCl4-induced liver fibrosis model in mice.

[0039] Figure 16 The starting plasmid map of the hIL-10 used.

[0040] Figure 17 The starting plasmid map of the GFP used. Detailed implementation methods

[0041] The present invention will be further illustrated by the following examples, but the present invention is not limited to the scope of the described examples. For the experimental methods without specific conditions noted in the following examples, they are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0042] The raw materials involved in the examples include: DMSO and DOTAP were purchased from Sigma-Aldrich; DMEM (containing 4.5 g / L D-Glucose, L-Glutamine, Sodium Pyruvate), fetal bovine serum (FBS), and 10×PBS were purchased from Gibco; 0.25% Trypsin-EDTA, Phenol Red, DMEM / F12, and lipofectamine liposome transfection reagent were from Thermo Fisher; PEI was purchased from Yisheng Biotech. Trizol was from Sigma; reverse transcriptase and SYBR Green fluorescent dye were purchased from TAKARA. The hIL-10 assay kit for the supernatant was purchased from Beyotime Biotechnology. 293T cells are a human embryonic kidney cell line from ATCC, with the catalog number CRL-3216.

[0043] Experimental instruments: Tissue homogenizer (Shanghai Biheng Biotechnology Co., Ltd.), low-temperature high-speed centrifuge (Eppendorf, 5415R), cell culture incubator (Thermo Fisher Scientific, 371), ultrapure water preparation system (Pall Cascada), multi-functional microplate reader (Bio Tek Synergy4), Applied Bio-system 7500fast real-time fluorescence quantitative PCR instrument (Thremo), upright and inverted integrated fluorescence microscope (Echo Revolve).

[0044] Experimental animals: Male C57BL / 6 mice, weighing 22 - 25 g, were purchased from Shanghai Model Organisms Center, Inc.

[0045] Example 1 Delivery of foreign genes on 293T cells by a drug composition constructed from exosomes derived from 293T cells

[0046] Exosomes derived from 293T cells were obtained using the classical differential centrifugation method. Specifically: The supernatant of 293T cells cultured for 72 h was collected, and the supernatant was transferred to a new centrifuge tube and centrifuged at 2000×g for 10 min. The supernatant was carefully transferred to a new centrifuge tube and centrifuged again at 10000×g for 30 min to remove larger vesicles. The supernatant was carefully taken to a new centrifuge tube and centrifuged at 110000g for 70 min at 4°C. After centrifugation, the supernatant was removed, resuspended with pre-cooled 1×PBS, and then ultracentrifuged again at 110000g for 70 min at 4°C. The supernatant was removed and resuspended with an appropriate amount of 1×PBS to obtain exosomes, and the particle number of exosomes was detected and recorded.

[0047] Plate 293T cells at a cell density of 1×10 5 cells / ml (DMEM medium containing 10% FBS). After the cells adhered for 24 h, replace the DMEM medium containing 10% FBS with DMEM without FBS. Load 1 μg of the GFP plasmid into exosomes derived from 293T cells. The specific steps are as follows: The following three groups: ① 1 μg of GFP plasmid + 1 μl of lipofectamine (1 mg / ml) + 1×10 9 exosomes derived from 293T cells; ② 1 μg of GFP plasmid + 4 μl of PEI (1 mg / ml) + 1×10 9 exosomes derived from 293T cells; ③ 1 μg of GFP plasmid + 6 μl of DOTAP (1 mg / ml) + 1×10 9 exosomes derived from 293T cells were mixed at 4°C and then allowed to stand for 12 h to prepare the corresponding drugs, which were added to the recipient cells, 293T cells. The GFP plasmid map is shown in Figure 17 . After adding the cells for 6 h, replace the medium with DMEM containing 10% FBS and continue culturing. Take pictures using a fluorescence microscope to record the expression of GFP 24 h after changing the medium. The results are as shown in Figure 1 , indicating that the composite carriers prepared above can achieve good delivery of the plasmid. Each group of cationic liposomes or cationic polymers can achieve similar effects.

[0048] The GFP coding sequence (MN832871.1) is as follows:

[0049] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtac(SEQ ID NO:7)

[0050] Example 2 Delivery of foreign genes was achieved on 293T cells by a pharmaceutical composition constructed from exosomes derived from 293F cells and UCFt cells

[0051] 293T cells were respectively at 1×10 5Seed the cells at a cell density of cells / ml. After the cells adhere for 24 h, change the culture medium to the basal medium. Load 1 μg of the GFP-expressing plasmid into exosomes derived from UCFT cells (obtained by transfecting Umbilical cord-derived fibroblasts with T). Specific steps: Mix 1 μg of the GFP plasmid + 1 μl of lipofectamine (1 mg / ml) + 1×10 9 exosomes derived from UCFT cells or 1×10 9 exosomes derived from 293F cells at 4°C, and then let them stand for 12 h to prepare the corresponding drugs, which are then added to the recipient cells, 293T cells. After treating the solution for 6 h, change to the culture medium containing serum for the recipient cells and continue culturing. Take pictures using a fluorescence microscope 24 h after transfection to record the expression of GFP. The results are as Figure 2 shown, indicating that exosomes from different cell sources can also mediate plasmid delivery into 293T cells.

[0052] Example 3 Optimization of the preparation method of a drug composition constructed from exosomes derived from 293T cells

[0053] Seed 293T cells at a cell density of 1×10 5 cells / ml. After the cells adhere for 24 h, change the culture medium to the basal medium. Optimize the specific steps for loading 1 μg of the GFP-expressing plasmid into exosomes derived from 293T cells: For the following three groups, ① Mix 1 μg of the GFP plasmid + 1 μl of lipofectamine (1 mg / ml) at 25°C, let it stand for 20 min, and then add 1×10 9 exosomes derived from 293T cells; ② Mix 1 μg of the GFP plasmid + 1×10 9 exosomes derived from 293T cells at 25°C, let it stand for 20 min, and then add 1 μl of lipofectamine (1 mg / ml); ③ Mix 1×10 9 exosomes derived from 293T cells + 1 μl of lipofectamine (1 mg / ml) at 25°C, let it stand for 20 min, and then add 1 μg of the GFP plasmid. Then let all samples stand at 4°C for 12 h to prepare the corresponding drugs, which are then added to the recipient cells, 293T. After treating the solution for 6 h, change to the culture medium containing serum for the recipient cells and continue culturing. Analyze the positive rate of GFP in the cells under each preparation method using a flow cytometer 24 h later. The results are as Figure 3 shown. The GFP positive rate of the conventional preparation method, i.e., group ① (19.0%) is lower than that of the unconventional preparation method, i.e., group ③ (56.3%). Although group ② is also an unconventional preparation method, its GFP positive rate is not high either (16.8%).

[0054] Example 4 Delivery of Human hIL-10 Gene by a Drug Composition Constructed from Exosomes Derived from 293T Cells on 293T Cells

[0055] (1) Transfecting Cells with hIL-10-Loaded Exosomes Derived from 293T Cells

[0056] 293T cells were plated at a cell density of 1×10 5 cells / ml. After the cells adhered for 24 h, the medium was changed to basal medium. The plasmid expressing hIL-10 (the plasmid was extracted and prepared using the TIANGEN endotoxin-free plasmid large-scale extraction kit, and the plasmid map is shown in Figure 16 , and the sequence of hIL-10 is shown in SEQ IN NO:8) was prepared according to the preparation method of group ③ in Example 3. Specifically: ③ 1×10 9 exosomes derived from 293T cells + 1 μl lipofectamine (1 mg / ml) were mixed well at 25 °C and allowed to stand for 20 min, then 1 μg hIL-10 plasmid was added. Subsequently, the sample was allowed to stand at 4 °C for 12 h to obtain the drug, which was then added to the recipient cells 293T. After the solution was treated for 6 h, the medium containing serum for the recipient cells was used for continued culture to complete transfection.

[0057] The coding sequence of hIL-10 (NM_000572.3) is as follows:

[0058] ATGCACAGCTCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCCAGCCCAGGCCAGGGCACCCAGTCTGAGAACAGCTGCACCCACTTCCCAGGCAACCTGCCTAACATGCTTCGAGATCTCCGAGATGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAGCTGGACAACTTGTTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAGGGTTACCTGGGTTGCCAAGCCTTGTCTGAGATGATCCAGTTTTACCTGGAGGAGGTGATGCCCCAAGCTGAGAACCAAGACCCAGACATCAAGGCGCATGTGAACTCCCTGGGGGAGAACCTGAAGACCCTCAGGCTGAGGCTACGGCGCTGTCATCGATTTCTTCCCTGTGAAAACAAGAGCAAGGCCGTGGAGCAGGTGAAGAATGCCTTTAATAAGCTCCAAGAGAAAGGCATCTACAAAGCCATGAGTGAGTTTGACATCTTCATCAACTACATAGAAGCCTACATGACAATGAAGATACGAAAC(SEQ ID NO:8)

[0059] In the subsequent examples, both IL-10 / hIL-10H designed refer to the above nucleic acid sequence.

[0060] (2) Transfection efficiency detection

[0061] After transfection was completed, cell culture supernatants were collected at 24 h, 48 h, and 72 h respectively, and the level of hIL-10 in the cell supernatants was analyzed using an ELISA kit (Beyotime) detection method.

[0062] (3) Data analysis

[0063] Data processing and significance analysis were performed using GraphPad Prism 8.0 software. Two-tailed, unpaired t-tests were used to compare two groups of data; one-way analysis of variance (one-way ANOVA) and Tukey's test were used for correction to compare multiple groups of univariate data. * / #P < 0.05, ** / ##P < 0.01, *** / P < 0.001 indicate increasing significant differences.

[0064] The results are as Figure 4As shown, it indicates that the exosomes loaded with hIL-10 plasmid can express hIL-10 well, and the expression level increases with time.

[0065] Example 5 Prevention of Concanavalin A-Induced Acute Liver Failure in Mice by Delivery of Human hIL-10 Gene with 293T Cell-Derived Exosome-Based Drug Combinations

[0066] (1) After adaptive culturing of C57 / BL6 mice, 200 μl of each drug preparation prepared in Example 1 was injected via the tail vein. Specific formulation system: 10 μg of hIL-10 plasmid (injection concentration is 0.05 μg / μl) + 10 μl of lipofectamine (1 mg / ml) (injection concentration is 0.05 μg / μl) + 1 × 10 10 exosomes derived from 293T cells (injection concentration is 0.5 × 10 8 per μl), and PBS was added to make up to 200 μl. 24 h after injection, 16 mg / kg of concanavalin A (ConA, Sigma) was injected via the tail vein. Blood was collected at 0 h, 24 h, and 48 h to obtain serum, which was sent to Qianmai Medical Biochemical Company for detection of the levels of ALT and AST in mice by HPLC. The death situation of mice was recorded and the survival curve was plotted.

[0067] (2) Primary mouse hepatocytes were isolated, and the mRNA levels of hIL-10 in hepatocytes of each group of mice were detected, with β-ACTIN as the internal reference. The primer sequences of hIL-10 were F: ACCCTCAGGCTGAGGCTA (SEQ ID NO: 1), R: CATGGCTTTGTAGATGCC (SEQ ID NO: 2); the primer sequences of β-ACTIN were F: TCAGCAATGCCTGGGTACAT (SEQ IDNO: 3), R: ATCACTATTGGCAACGAGCG (SEQ ID NO: 4).

[0068] (3) Data processing and significance analysis were performed using GraphPad Prism 8.0 software. Two-tailed, unpaired t-tests were used to compare two groups of data; one-way analysis of variance (one-way ANOVA) was used and corrected with Tukey's test to compare multiple groups of univariate data. * / #P < 0.05, ** / ##P < 0.01, *** / P < 0.001 indicate increasing significant differences.

[0069] In the ConA-induced acute liver failure mouse model, after administration of 293T cell-derived exosomes loaded with hIL-10, the survival rate of the administration group was significantly improved compared with that of the PBS group of mice at 72 h (P < 0.001), as Figure 5As shown, the ALT and AST levels in the blood biochemical indexes of the mice in the administration group were significantly improved compared with those in the PBS group at 24 h (P<0.001). As Figure 6 shown. At the same time, the primary hepatocyte RNA of the mice in each group was extracted, and the experimental results of fluorescence quantitative PCR ([[]] Figure 7 ) showed that the exosomes loaded with hIL-10 could be well expressed in hepatocytes, and played a good role in preventing and treating ConA-induced acute liver failure in mice.

[0070] Note: Since only one mouse in the PBS group survived at 48 h, there was no error bar at the corresponding point in [[[]] Figure 6 . All the mice in the PBS group had died at 72 h.

[0071] Example 6 Intervention of drug composition of exosomes derived from 293T cells delivering human hIL-10 gene in acute liver failure in mice

[0072] (1) After adaptive cultivation of C57 / BL6 mice, 200 μl of each drug prepared in Example 1 was injected through the tail vein. The specific preparation system: 10 μg of hIL-10 plasmid (the injection concentration was 0.05 μg / μl) + 10 μl of lipofectamine (1 mg / ml) (the injection concentration was 0.05 μg / μl) + 1×10 10 exosomes derived from 293T cells (the injection concentration was 0.5×10 8 / μl), and PBS was added to make up to 200 μl. 600 mg / kg of APAP (acetaminophen, Sigma) was injected through the tail vein 24 h after injection. Blood was collected at 0 h, 24 h, and 48 h respectively, and the serum was sent to Qianmai Medical Biochemical Company to detect the levels of ALT and AST in mice by HPLC analysis. Record the death of mice and draw the survival curve.

[0073] (2) Isolate primary hepatocytes of mice and detect the mRNA level of hIL-10 in the hepatocytes of each group of mice. The primer sequences are the same as those in Example 5.

[0074] (3) GraphPad Prism 8.0 software was used for data processing and significance analysis. Two-tailed, unpaired t-test was used to compare two groups of data; one-way ANOVA was used and corrected by Tukey test to compare multiple groups of univariate data. * / #P<0.05, ** / ##P<0.01, *** / P<0.001 indicate increasing significant differences.

[0075] In the APAP-induced acute liver failure mouse model, after the administration of exosomes derived from 293T cells loaded with hIL-10, the survival rate of the administration group was significantly improved compared with that of the mice in the PBS group (P<0.001), as Figure 8 shown. The 24-hour blood biochemical indexes ALT and AST of the mice in the administration group were significantly improved compared with those in the PBS group (P<0.001), as Figure 9 shown. At the same time, the primary hepatocyte RNA of each group of mice was extracted, and the results of fluorescence quantitative PCR experiments showed that the exosomes loaded with hIL-10 could be well expressed in hepatocytes, and played a good role in preventing and treating APAP-induced acute liver failure in mice ( Figure 10 ).

[0076] Example 7 Treatment of Chronic Liver Fibrosis in Mice by Delivery of Human hIL-10 Gene by a Drug Composition of Exosomes Derived from 293T Cells

[0077] (1) After the adaptive cultivation of C57 / BL6 mice, a mouse chronic liver fibrosis model was constructed by intraperitoneal injection of 50 μl of 30% CCL4 (Sinopharm) twice a week for 8 weeks. Starting from the fourth week, 200 μl of the drug prepared according to Example 1 was injected through the tail vein. The specific preparation system: 10 μg of hIL-10 plasmid (injection concentration is 0.05 μg / μl) + 10 μl lipofectamine (1 mg / ml) (injection concentration is 0.05 μg / μl) + 1×10 10 exosomes derived from 293T cells (injection concentration is 0.5×10 8 / μl). Once a week for 4 weeks. The positive drug was obeticholic acid (OCA, Absin Shanghai Biotechnology Co., Ltd.). After the treatment, blood was collected to obtain serum and sent to Qianmai Medical Biochemical Company to detect the levels of ALT, AST, and TBIL in each group of mice by HPLC analysis.

[0078] (2) Liver tissues of each group of mice were taken for pathological staining to analyze the liver lesions.

[0079] (3) Liver tissues of each group of mice were taken to extract RNA for reverse transcription, and the expression level of α-SMA was analyzed by the results of fluorescence quantitative PCR, with β-ACTIN as the internal reference. α-SMA primer F: TCAAGGAGAAGCTGTGCTATGT (SEQ ID NO:5); R: TTCGTGGATGCCCGCTGA (SEQ ID NO:6); The β-ACTIN primer was the same as in Example 5.

[0080] In the CCL4-induced acute liver failure mouse model, after the injection of exosomes loaded with hIL-10, ALT ( Figure 11 ) and AST (Figure 12 ) and TBIL( Figure 13 ) were lower than those in the PBS control group, with a significant difference in ALT (P<0.05) and a highly significant difference in TBIL (P<0.001).

[0081] The degree of liver fibrosis in the mice of the administration group was lower than that in the PBS control group( Figure 14 ).

[0082] In the CCL4-induced acute liver failure mouse model, after injection of exosomes loaded with hIL-10, α-SMA in the mice of the administration group was significantly lower than that in the model group (P<0.05)( Figure 15 ).

Claims

1. A pharmaceutical composition, characterized in that, the pharmaceutical composition comprises a carrier complex, which is formed by exosomes and a lipid substance or a cationic polymer through positive and negative charge attraction, the carrier complex further comprises an active pharmaceutical ingredient nucleic acid, and the pharmaceutical composition further optionally comprises a pharmaceutically acceptable carrier.

2. The pharmaceutical composition according to claim 1, characterized in that, the lipid substance comprises liposomes or cationic lipids, the cationic lipids contain one or more polar regions, and the polar regions can bind negatively charged components. The cationic lipids are preferably DOTAP, DLin-MC3-DMA, DOTAM or DOSPA; the cationic polymer contains protonatable amino groups, and the amino groups form the carrier complex with the exosomes by the way of positive and negative charge contact and attraction. The cationic polymer is preferably polyethyleneimine, polyurethane, chitosan or diethylaminoethyl dextran.

3. The pharmaceutical composition according to any one of claims 1-2, characterized in that, the exosomes are derived from mammalian cells, and the mammalian cells include but are not limited to 293 series cells and stem cells. The 293 series cells include 293T cells, 293F cells, 293FT and 293, and the stem cells include mesenchymal stem cells, adult stem cells and embryonic stem cells.

4. The pharmaceutical composition according to any one of claims 1-3, characterized in that, the amount of the exosomes in the carrier complex is not less than 1E5 / μl.

5. The pharmaceutical composition according to any one of claims 1-4, characterized in that, the amount of the lipid substance or the cationic polymer is not less than 0.3 μg / μl.

6. The pharmaceutical composition according to any one of claims 1-5, characterized in that, the active pharmaceutical ingredient nucleic acid is selected from plasmids, mRNAs and small RNAs.

7. The pharmaceutical composition according to any one of claims 1-6, characterized in that, the active pharmaceutical ingredient nucleic acid is selected from plasmids containing the coding sequence of hIL-10.

8. Use of the pharmaceutical composition according to any one of claims 1-7 in the preparation of a medicament for treating liver diseases.

9. The use according to claim 8, characterized in that, the liver diseases are liver diseases with gene mutations, deletions or functional abnormalities; preferably, the liver diseases are liver failure or liver fibrosis; more preferably, the liver failure is exogenous drug-induced liver failure or liver fibrosis.

10. A preparation method of the pharmaceutical composition according to any one of claims 1-7, characterized in that, the preparation method comprises the following steps: physically mixing the carrier complex in a buffer system to obtain the carrier complex.

Images