Application of OsSAUR23 protein or coding gene thereof in changing grain shapes of gramineous crop grains

Abstract

The invention relates to the technical field of biological breeding, and particularly discloses application of OsSAUR23 protein or a coding gene thereof in changing grain shapes of gramineous crop grains. Research finds that the length, the width, the thickness and the thousand seed weight of grains can be increased by reducing the activity and / or the content of the OsSAUR23 protein, and then the yield is increased, so that the application of the OsSAUR23 protein or the coding gene thereof or a biological material containing the coding gene thereof in changing the grain shape of gramineous crop grains is provided, and a new way is provided for creating a new rice variety.

Description

Technical Field

[0001] The present invention relates to the technical field of biological breeding, and specifically, to the application of OsSAUR23 protein or its coding gene in changing the grain shape of gramineous crops. Background Art

[0002] Rice is one of the important food crops. Plant height is an important agronomic trait affecting its yield. The application of dwarfing genes can greatly increase rice yield. Grain shape includes grain size, length, width and their ratios, which are not only important traits affecting rice yield, but also one of the important traits affecting rice quality.

[0003] The genes that have been cloned and affect plant height mainly involve the synthesis, metabolism and signal pathways of gibberellin, brassinolide and strigolactone. Auxin signaling often participates in regulating plant height by interacting with these hormone signals. Similarly, most of the reported genes affecting plant grain size, length, width and thickness are also related to hormone signals such as cytokinin. There are few reports on auxin-related genes that participate in all aspects of plant development. Genes regulating auxin synthesis, transport, balance and signal transduction are all large gene families. Due to a large amount of gene redundancy, it is difficult to identify auxin-related genes regulating quantitative traits such as plant height and grain weight through traditional reverse genetics means. For example, the SAURs gene family has 58 members in the rice genome, and less than 10 genes with reported functions have been reported so far. Further exploration of plant growth regulatory genes is still needed. Summary of the Invention

[0004] One object of the present invention is to provide a new method for adjusting the plant grain phenotype.

[0005] The present invention provides any one of the following applications: 1. The application of OsSAUR23 protein or its coding gene, or a biological material containing its coding gene in changing the grain shape of gramineous crops.

[0006] 2. The application of OsSAUR23 protein or its coding gene, or a biological material containing its coding gene in changing the grain length of gramineous crops.

[0007] 3. The application of OsSAUR23 protein or its coding gene, or a biological material containing its coding gene in changing the grain width of gramineous crops.

[0008] 4. The application of OsSAUR23 protein or its coding gene, or a biological material containing its coding gene in changing the grain thickness of gramineous crops.

[0009] 5. Use of the OsSAUR23 protein, its coding gene, or a biological material containing its coding gene in altering the 1000-grain weight of gramineous crops.

[0010] 6. Use of the OsSAUR23 protein, its coding gene, or a biological material containing its coding gene in altering the yield of gramineous crops.

[0011] In the present invention, through phenotypic analysis of rice small organ mutants spos1 and preliminary mapping of the target gene, the protein OsSAUR23 related to rice grain shape was finally discovered. A decrease in the activity and / or content of the OsSAUR23 protein can significantly increase the length, width, thickness, and 1000-grain weight of gramineous crop grains, thereby increasing crop yield.

[0012] In the application of the present invention, the OsSAUR23 protein has any one of the following amino acid sequences: 1) The amino acid sequence shown in SEQ ID NO.1; or 2) An amino acid sequence of a protein with the same function obtained by substitution, deletion, or insertion of one or more amino acid residues in the amino acid sequence shown in SEQ ID NO.1.

[0013] The OsSAUR23 protein is derived from Oryza sativa var. ZH8 of the genus Oryza and consists of 153 amino acid residues.

[0014] The above-mentioned OsSAUR23 protein can be artificially synthesized, or its coding gene can be synthesized first and then obtained through biological expression. The coding gene of the amino acid sequence in the above 2) can be obtained by deleting the codons of one or several amino acid residues in the CDS sequence (the coding gene of OsSAUR23) shown in SEQ ID NO.2, and / or performing missense mutations of one or several base pairs, and / or connecting the coding sequences of protein tags at its 5′ end and / or 3′ end. The above-mentioned protein tags can be His tag, MBP tag, HA tag, myc tag, and / or GST tag, etc.

[0015] In the application of the present invention, the coding gene of the OsSAUR23 protein has any one of the following nucleotide sequences: 1) The nucleotide sequence shown in SEQ ID NO.2 or 3, or 2) A nucleotide sequence encoding a protein with the same function obtained by substitution, deletion, or insertion of one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.2 or 3; 3) A nucleotide sequence that can hybridize with the nucleotide sequence shown in SEQ ID NO.2 or 3 under stringent conditions.

[0016] SEQ ID NO. 2 is a CDS sequence, consisting of 462 nucleotides.

[0017] The stringent conditions may be hybridization and washing the membrane at 65°C in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS.

[0018] In the application of the present invention, the biological material is an expression cassette, a vector or a host cell.

[0019] In the application of the present invention, the gramineous crop is rice.

[0020] The present invention also provides a method for regulating rice yield, which changes the activity and / or content of OsSAUR23 protein in rice or changes the expression level of the coding gene of OsSAUR23 protein in rice.

[0021] If you want to increase rice yield, then reduce the activity and / or content of OsSAUR23 protein in rice or reduce the expression level of the coding gene of OsSAUR23 protein in rice.

[0022] In the above method, regulating the gene expression level or protein content or activity acts through a biological material having at least one of the six regulations of 1) transcriptional level, 2) post-transcriptional level, 3) mRNA transport, 4) mRNA degradation, 5) translational level, and 6) post-translational level.

[0023] The biological material described above may be a recombinant expression vector, an expression cassette, and the corresponding recombinant microorganism, transgenic plant cell line, transgenic plant tissue or organ.

[0024] As an optional implementation manner, in the present invention, the transgenic plant cell line, transgenic plant tissue or organ will not develop into a plant individual.

[0025] In the above method, regulating the gene expression may be enhancing the gene expression.

[0026] The enhanced gene expression mentioned above refers to that when constructing a recombinant plant expression vector, any enhancer promoter or constitutive promoter can be added before the transcription start nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin promoter (Ubiquitin) of maize, etc. They can be used alone or in combination with other plant promoters. In addition, when using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be the ATG start codon or the start codon in the adjacent region, etc., but must be in the same reading frame as the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene.

[0027] In the above method, regulating the gene expression can also be to inhibit or reduce the gene expression, and the inhibition or reduction of the gene expression can be achieved by gene knockout or gene silencing.

[0028] The so-called gene knockout refers to the phenomenon that the target gene is inactivated by changing a specific DNA sequence through homologous recombination.

[0029] The so-called gene silencing refers to the phenomenon that the gene is not expressed or is expressed at a low level without damaging the original DNA. Gene silencing can occur at two levels. One is transcriptional gene silencing caused by DNA methylation, heterochromatinization, and position effects, etc. The other is post-transcriptional gene silencing, that is, at the post-transcriptional level of the gene, the gene is inactivated by specifically inhibiting the target RNA, including antisense RNA, co-suppression, quelling, RNA interference (RNAi), and translation inhibition mediated by microRNA (miRNA), etc.

[0030] Furthermore, the method can introduce biomaterials into the recipient plant to inhibit, reduce or down-regulate the gene expression, or the protein activity or content, so as to obtain a target plant with changed grain type and increased grain weight.

[0031] As a specific embodiment, the biomaterial is the recombinant vector BGK03-sgRNA1. The target sequence of the sgRNA1 is the DNA fragment at positions 121 to 143 of SEQ ID No. 2; the BGK03 is a CRISPR / Cas9 backbone vector for guiding gene editing, purchased from Baige Gene Technology Co., Ltd. The recombinant vector BGK03-sgRNA1 is transformed into Agrobacterium tumefaciens EHA105 to obtain the recombinant microorganism EHA / BGK03-sgRNA1.

[0032] Furthermore, the method can introduce biomaterials into recipient plants to up-regulate the gene expression or the protein activity or content, and obtain target plants with changed grain shape and reduced grain weight.

[0033] As a specific embodiment, the biomaterial is the recombinant expression vector pCAMBIA1301-OsSAUR23. The pCAMBIA13001-OsSAUR23 can express the protein shown in SEQ ID NO.1, and the expression of this protein is driven by the constitutive promoter Pubi of maize. The recombinant vector pCAMBIA13001-OsSAUR23 is transformed into Agrobacterium tumefaciens EHA105 to obtain the recombinant microorganism EHA / pCAMBIA13001-OsSAUR23.

[0034] In the above method, the yield-related phenotype of recipient plants can be changed by introducing biomaterials. Specifically, plant cells or tissues can be transformed by conventional biological methods such as using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated transformation, etc., and the transformed plant tissues are cultivated into plants. The transformed cells, tissues or plants are understood to include not only the final products of the transformation process, but also the materials obtained by their asexual reproduction and transgenic progeny.

[0035] The recipient plant is a monocotyledonous plant or a dicotyledonous plant, preferably a gramineous plant, and more preferably rice.

[0036] The beneficial effects of the present invention are at least as follows: The present invention provides the application of OsSAUR23 protein in regulating the grain shape of plants; inhibiting the OsSAUR23 protein by gene knockout technology can increase the length, width and thickness of grains, and thus increase the grain weight; it provides a new target for rice grain shape regulation breeding. Description of the Drawings

[0037] Figure 1 For the plant height and grain appearance phenotypes and statistics of the wild type ZH8 and the small organ mutant in the examples of the present invention spos1 In the figure, A is the plant phenotype, B is the statistical result of plant height, C is the grain phenotype, D is the statistical result of grain size, E is the cell morphology on the surface of the glume (the scale represents 100 μm), F is the statistical result of the cell size on the surface of the glume, G is the cell morphology of the culm, and H is the statistical result of the cell size of the culm.

[0038] Figure 2This is the gene mapping diagram and trait statistical results of the mutant gene in the embodiments of the present invention. Among them, A is a schematic diagram of the T-DNA insertion site, B is a verification diagram of the candidate gene expression level, C is a thousand-grain weight change diagram, D is a plant height change diagram, and E is an IAA content change diagram.

[0039] Figure 3 This is the phenotypic photo and data analysis results of the transgenic knockout OsSAUR23 grains in the embodiments of the present invention. Among them, A is the phenotypic photo of the grains, B is the thousand-grain weight statistical result, C is the phenotypic photo of the grain length, grain width and grain thickness, D is the statistical result of the grain length, grain width and grain thickness, and E is the plant height statistical result.

[0040] In each figure (if any), represents P < 0.05, represents P < 0.01, represents P < 0.001. Detailed implementation manners

[0041] The preferred implementation manners of the present invention will be described in detail below in conjunction with the embodiments. It should be understood that the following embodiments are given only for the purpose of illustration and are not used to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0042] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels or prepared by conventional methods in the art unless otherwise specified.

[0043] The japonica rice variety ZH11 is a common rice variety; the public can obtain it from the Institute of Crop Science, Chinese Academy of Agricultural Sciences. The vector BGK03-gRNA vector for CRISPR / Cas9 gene knockout was purchased from Baige Gene Technology Co., Ltd.

[0044] In the following quantitative tests, three repeated experiments were set, and the results were averaged.

[0045] In the following embodiments, the Excel statistical software was used to process the data. The experimental results were expressed as mean ± standard deviation and were tested by Two-way t-test. indicating a significant difference (P < 0.05), indicating a highly significant difference (P < 0.01), indicating a highly significant difference (P < 0.001).

[0046] Example 1 Discovery of OsSAUR23, a protein related to regulating plant height and grain weight in rice, and its encoding gene 1. Rice small organ mutants spos1 Phenotypic analysis A mutant strain with smaller leaves, grains and other organs was found in the T-DNA insertion strain of japonica rice variety ZH8 spos1 Compared with the wild type, spos1 The main feature of Figure 1 The grains became smaller, including the length, width and thickness of the grains were significantly reduced (see Figure 1 C and D in the figure). Cytological observation revealed that the cells on the surface of the husk became shorter longitudinally and narrower transversely ( Figure 1 E and F). The longitudinal length of cells in the elongated stems was significantly reduced, while the width of cells was extremely reduced ( Figure 1 G and H in Figure 3). This suggests that the overall reduction in cell size may be the main reason for the reduction in size of organs such as grains and stems.

[0047] 2. Target gene identification Genome-walking was used to identify the flanking sequences of the T-DNA insertion sites. After two rounds of nested PCR, multiple DNA fragments of different sizes were obtained from four DNA libraries. After cloning into the pGEM-T vector, the DNA fragments were sequenced. Then, Blast analysis was performed in NCBI. It was found that the ZH8 genome had two T-DNA insertion sites. One of the T-DNAs was inserted into the 3' non-coding region of the OsSAUR23 (LOC_Os04g56690) gene on chromosome 4 (see Figure 2 Semi-quantitative RT-PCR revealed OsSAUR23 The expression level of the gene was significantly increased (see Figure 2 B). Further, the mutant spos1 By backcrossing with the wild type ZH8, the homozygous strain F containing the T-DNA inserted in the 3'UTR region of the OsSAUR23 gene was selected in the BCF2 generation. 2 -135 and F 2 -182, phenotypic analysis revealed that the plant height and grain weight of the two strains were significantly lower than those of the wild-type ZH8, but higher than those of the small-organ mutant spos1 (see Figure 2 C and D in the figure). OsSAURs The gene family is a class of proteins that respond rapidly to auxin. spos1 Hormone analysis of seedlings also revealed a significant increase in the auxin IAA content (see Figure 2 E in. OsSAUR23The gene encodes a protein as shown in SEQ ID NO. 1, and its gene sequence is as shown in SEQ ID NO. 2 (CDS) and SEQ ID NO. 3 (gDNA).

[0048] Example 2 Functional verification of OsSAUR23 protein I. Construction of gene knockout vector Synthetic primers The following two primers are used for editing OsSAUR23 gene: sgSAUR1-F: TGTGTGGCACGGCCACGTGACCCGCCGG (SEQ ID NO.4); sgSAUR1-R: AAACCCGGCGGGTCACGTGGCCCGTGCCCA (SEQ ID NO.5).

[0049] 10 μM of F and R primers are mixed in equal ratio, annealed at 95 °C for 3 minutes, and then slowly cooled to 20 °C at 0.2 °C / second. The double-stranded primers are mixed with Bsa the CRISPR / Cas9 vector BGK03 recovered by I enzyme digestion. After mixing with T4-DNA ligase, the reaction is carried out at room temperature (25 °C) for 1 h. The ligated recombinant vector is transformed into Escherichia coli competent DH5α, and sequenced with the primer TCCCAGTCACGTTGTAA (SEQ ID NO.6) to screen positive clones, and the recombinant vector BGK03-sgSAUR23 for gene knockout is obtained.

[0050] II. OsSAUR23 Obtaining of gene knockout transgenic plants 1. The recombinant vector BGK03-sgSAUR23 obtained in step I is introduced into Agrobacterium tumefaciens strain EHA105 (Invitrogen, USA) to obtain recombinant Agrobacterium EHA / BGK03-sgSAUR23.

[0051] 2. The recombinant Agrobacterium obtained in step 1 is used to transform japonica rice variety ZH11 (wild type). The specific steps are as follows: (1) Take the recombinant Agrobacterium cells obtained in step 1, resuspend them with AAM liquid medium and adjust the OD600nm of the bacterial liquid to 0.5.

[0052] (2) Infect the mature embryo embryogenic callus of japonica rice variety ZH11 (wild type) cultured for one month in the bacterial liquid obtained in step (1) for 30 min. After blotting the bacterial liquid with filter paper, transfer it to solid N6B medium containing 10 g / L agar and co-culture at 24 °C for 3 days; (3) Inoculate the callus cultured in step (2) onto a solid screening N6B medium containing 10 g / L agar and 100 mg / L hygromycin, and culture for 16 days (the first screening); (4) Inoculate the healthy callus after culturing in step (3) onto a solid screening N6B medium containing 10 g / L agar and 100 mg / L hygromycin, and culture for 15 days (the second screening); (5) Inoculate the healthy callus after culturing in step (4) onto a solid screening N6B medium containing 10 g / L agar and 100 mg / L hygromycin, and culture for 15 days (the third screening); (6) Inoculate the healthy callus after culturing in step (4) onto a differentiation medium for differentiation to obtain T0 generation plants.

[0053] 3. Identify the T0 generation plants obtained in step 2. Extract the total DNA from the leaves of the plants to be tested, perform PCR amplification using primers primer1 and primer2, and detect OsSAUR23 the mutation; sequence the amplification product, and the plants with double peaks after the substitution site are transgenic positive plants.

[0054] primer1: 5'-ATTCTCGCCGTCAACCATGT-3' (SEQ ID NO.7); primer2: 5'-TGCTTTTGCTTATCGGTGGC-3' (SEQ ID NO.8).

[0055] III. Phenotypic identification The T0 generation transgenic BGK03-sgSAUR23 plants were continuously planted for 2 generations, and the above-mentioned step two was continued to screen for positive homozygous plants by PCR, and 2 homozygous OsSAUR23-KO1 lines were obtained; compared with the wild-type ZH11 genome, OsSAUR23-KO1 OsSAUR23 at the 126th bp position of the gene sequence shown in SEQ ID NO.2, 1 G base was deleted at the target site, and OsSAUR23-KO2 OsSAUR23 at the 126th bp and 127th bp positions of the gene sequence shown in SEQ ID NO.2, 1 T base was inserted between the two G bases; the former caused the translated protein to terminate prematurely, and the latter caused a frameshift mutation, and the translated protein was longer. The mutations in these 2 lines both resulted in the loss of OsSAUR23 protein function. The phenotypes of these 2 loss-of-function mutant lines were observed and measured, and the results showed that the 1000-grain weight of the OsSAUR23 gene knockout lines increased extremely significantly (see Figure 3 A and B in); while after the OsSAUR23 gene was knocked out, the grain length, grain width and grain thickness (see Figure 3Both C and D) increased extremely significantly. However, plant height (see Figure 3 E) in it was not affected by the knockout of the OsSAUR23 gene. Thus, it was verified that the grain size phenotype was controlled by OsSAUR23, that is, this gene was a gene related to grain shape.

[0056] Although the present invention has been described in detail with general descriptions and specific embodiments above, based on the present invention, some modifications or improvements can be made to it, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention.

Claims

1. Application of OsSAUR23 protein or its encoding gene, or biological materials containing its encoding gene, in changing the grain shape of gramineous crops.

2. Application of OsSAUR23 protein or its encoding gene, or biological materials containing its encoding gene, in changing the grain length of Gramineae crops.

3. Application of OsSAUR23 protein or its encoding gene, or biological materials containing its encoding gene, in changing the grain width of gramineous crops.

4. Application of OsSAUR23 protein or its encoding gene, or biological materials containing its encoding gene, in changing the grain thickness of gramineous crops.

5. Application of OsSAUR23 protein or its encoding gene, or biological materials containing its encoding gene, in changing the thousand-grain weight of Gramineae crops.

6. Use of OsSAUR23 protein or its encoding gene, or biological materials containing its encoding gene, in changing the yield of gramineous crops.

7. The use according to any one of claims 1 to 6, characterized in that: The OsSAUR23 protein has any of the following amino acid sequences: 1) the amino acid sequence shown in SEQ ID NO.1; or 2) The amino acid sequence of the amino acid sequence shown in SEQ ID NO.1 obtained by replacing, deleting or inserting one or more amino acid residues, and having the same functional protein; The gene encoding the OsSAUR23 protein has any of the following nucleotide sequences: 1) the nucleotide sequence shown in SEQ ID NO. 2 or 3, or 2) A nucleotide sequence encoding a protein with the same function obtained by replacing, deleting or inserting one or more nucleotides of the nucleotide sequence shown in SEQ ID NO. 2 or 3; 3) A nucleotide sequence that can hybridize with the nucleotide sequence shown in SEQ ID NO. 2 or 3 under stringent conditions.

8. The use according to any one of claims 1 to 7, characterized in that: The biological material is an expression cassette, a vector or a host cell.

9. The use according to any one of claims 1 to 8, characterized in that: The gramineous crop is rice.

10. A method for regulating rice yield, characterized in that: The activity and / or content of the OsSAUR23 protein in rice is changed, or the expression level of the gene encoding the OsSAUR23 protein in rice is changed.

Images