Co-culture system and method for synthesizing target compound

Abstract

A co-culture system for the synthesis of a compound of interest, the co-culture system comprising at least one feed strain and at least one production strain wherein the feed strain provides a precursor compound and the production strain produces the compound of interest using the precursor compound, the co-culture system further comprises an antibiotic, and wherein one of the producing and feeding strains is resistant to the antibiotic and the other is not resistant to the antibiotic. The invention also discloses a method for synthesizing a target compound through the co-culture system.

Description

Technical Field

[0001] The present invention relates to a co - culture system and method for synthesizing a target compound, and in particular, to controlling the kinetics of strains in a co - culture system for synthesizing a target compound. Background Art

[0002] Terpenoids are widely used in different industrial applications, such as fragrances, flavors, biofuels, drugs, rubbers, and pesticides. These compounds are produced by plants, but usually in low amounts, insufficient to support industrial demand.

[0003] Terpenoids are compounds and their oxygen - containing derivatives derived from mevalonic acid or deoxy - D - xylulose 5 - phosphate, with a molecular backbone based on isoprene units (C5 units). These oxygen - containing derivatives can be alcohols, aldehydes, ketones, carboxylic acids, esters, etc. Most of these metabolites produced during the terpenoid molecule production process are complex, with many steps in the chemical production process, involving complex chemical reactions, resulting in problems such as low yield, incorrect stereochemistry, and high cost.

[0004] In a method for synthesizing a terpenoid compound, according to the isoprene unit biosynthesis pathway, two strains, such as a feeder strain and a producer strain, are cultured in a culture medium to obtain the terpenoid compound. However, the population of the strains may change during the growth stage, leading to a change in the total terpenoid production. Under different conditions and metabolic loads, the faster - growing strain will dominate the culture. This makes it currently impossible to control the ratio of the feeder strain and the producer strain within the desired range throughout the culture process.

[0005] There are some methods in the existing technology for regulating the growth rate of strains (such as mutant strains) in a co-culture system ((Aulakh, Simran Kaur et al., Nature Chemical Biology (2023): 1 - 11. https: / / doi.org / 10.1038 / s41589-023-01341-2), toxin-antitoxins (US10188114B2)). In addition, there are also some techniques that use quorum sensing (Scott et al. Nature Microbiology 2017, 2, 17083; DOI: 10.1038 / nmicrobiol.2017.83) or optogenetic methods (Lalwani, Makoto A., et al. ACS Synthetic Biology 10.8 (2021): 2015 - 2029. doi.org / 10.1021 / acssynbio.1c00182) for strain growth control. These methods control strain growth by adjusting the expression of antibiotic resistance or toxic proteins (Gutiérrez Mena, Joaquín, Sant Kumar, and Mustafa Khammash. Nature Communications 13.1 (2022): 4808. https: / / doi.org / 10.1038 / s41467-022-32392-z, Yurtsev, Eugene Anatoly, Arolyn Conwill, and Jeff Gore. Proceedings of the National Academy of Sciences 113.22 (2016): 6236 - 6241. www.pnas.org / cgi / doi / 10.1073 / pnas.1523317113, Liu, Feng, et al. ACS synthetic biology 8.8 (2019): 1713 - 1722. DOI: 10.1021 / acssynbio.9b00110; Blanchard, Andrew E., Chen Liao, and Ting Lu. Cellular and Molecular Bioengineering 9 (2016): 443 - 454. https: / / doi.org / 10.1007 / s12195-016-0447-6, Fedorec, Alex JH, et al. Nature communications 12.1 (2021): 1977.https: / / doi.org / 10.1038 / s41467-021-22240-x). Most of these systems require knockout of essential genes or expression of enzymes to obtain response elements and growth regulators. However, expression of the control system accompanying the heterologous pathway exacerbates the stress on the microorganism. Summary of the Invention

[0006] In order to overcome the deficiencies of the prior art, the object of the present invention is to provide a co-culture system for synthesizing a target compound. The co-culture system includes at least one feeder strain and at least one producer strain. Among them, the feeder strain provides a precursor compound, and the producer strain uses the precursor compound to produce the target compound. The co-culture system also includes an antibiotic, and among them, one of the producer strain and the feeder strain is resistant to the antibiotic, and the other is not resistant to the antibiotic.

[0007] With the co-culture system according to the present invention, the ratio of the producer strain and the feeder strain can be dynamically adjusted simply and accurately, while controlling the dynamic growth of the microorganism and reducing the stress on the expression of heterologous enzymes in the microorganism.

[0008] According to some advantageous embodiments of the present invention, in the co-culture system, the faster-growing one of the producer strain and the feeder strain is susceptible to the antibiotic, and the slower-growing one is resistant to the antibiotic. In some preferred embodiments, the faster-growing strain is the feeder strain, and the slower-growing strain is the producer strain.

[0009] According to some embodiments of the present invention, the feeder strain is susceptible to the antibiotic, and the producer strain is resistant to the antibiotic.

[0010] According to some embodiments of the present invention, the target compound is a synthetic terpene compound.

[0011] According to some embodiments of the present invention, the precursor compound is mevalonic acid.

[0012] According to some embodiments of the present invention, the feeder strain is used to provide mevalonic acid, and the producer strain uses the mevalonic acid to synthesize terpene compounds.

[0013] According to some embodiments of the present invention, the feeder strain contains an overexpressed gene for synthesizing mevalonic acid and does not contain a gene for synthesizing farnesyl pyrophosphate.

[0014] According to some embodiments of the present invention, the producer strain contains a first plasmid and a second plasmid. The first plasmid contains a gene for synthesizing farnesyl pyrophosphate and does not contain a gene for synthesizing mevalonic acid. The second plasmid contains the gene for the terpene compound synthase.

[0015] According to some embodiments of the present invention, the target compound includes at least one of monoterpenoids, sesquiterpenes, and diterpenoids.

[0016] According to some embodiments of the present invention, the monoterpenoids include at least one of linalool, geraniol, and 2,6-dimethyloctane, the sesquiterpenes include at least one of bisabolene, bicyclogermacrene, isolongifolene, bulnesene, valencene, β-patchoulene, aristolene, guaiene, cedrene, bulnesene oxide, and valencene oxide, and / or the diterpenoid is taxadiene.

[0017] According to some embodiments of the present invention, the terpenoids include at least one of linalool, geraniol, 2,6-dimethyloctane, bisabolene, bicyclogermacrene, isolongifolene, taxadiene, bulnesene, valencene, β-patchoulene, and aristolene.

[0018] According to some embodiments of the present invention, the terpenoids include at least one of the oxidation products of bulnesene or valencene.

[0019] According to some embodiments of the present invention, the antibiotic acts externally by inhibiting cell wall synthesis and internally by inhibiting gene translation. In some embodiments, the antibiotic in the co-culture system includes at least one of chloramphenicol, streptomycin, kanamycin, and tetracycline.

[0020] According to some preferred embodiments of the present invention, the antibiotic is an intracellular antibiotic, preferably streptomycin.

[0021] According to some embodiments of the present invention, the concentration of the antibiotic is set such that the cells of the strain that is not resistant to the antibiotic, i.e., susceptible to the antibiotic, are not killed but only have their growth rate restricted, while the cells of the strain that is resistant to the antibiotic are not affected by the antibiotic.

[0022] According to some embodiments of the present invention, the initial concentration of the antibiotic is set such that the growth rate of the feeder cells that are not resistant to the antibiotic is inhibited by the antibiotic.

[0023] According to some embodiments of the present invention, since the strain resistant to the antibiotic in the co-culture system degrades the antibiotic, the strain susceptible to the antibiotic is gradually protected from the antibiotic. For example, the production strain can gradually degrade the antibiotic during incubation to weaken the effect of the antibiotic on the feeder strain. In this case, the growth rate of the feeder strain depends on the initial concentration of the antibiotic and the degradation rate of the antibiotic, and the degradation rate of the antibiotic depends on the growth rate of the production strain. Thus, the growth rate of the production strain indirectly controls the growth rate of the feeder strain.

[0024] According to some embodiments of the present invention, based on the co-culture system, the concentration of the antibiotic is not less than 5 μg / ml and / or not more than 20 μg / ml.

[0025] According to some embodiments of the present invention, based on the co-culture system, the concentration of the antibiotic is from 5 μg / ml to 20 μg / ml, such as 5 μg / ml, 6 μg / ml, 7 μg / ml, 8 μg / ml, 9 μg / ml, 10 μg / ml, 11 μg / ml, 12 μg / ml, 13 μg / ml, 14 μg / ml, 15 μg / ml, 16 μg / ml, 17 μg / ml, 18 μg / ml, 19 μg / ml, 20 μg / ml or any interval composed of them.

[0026] According to some embodiments of the present invention, based on the co-culture system, the concentration of the antibiotic is from 5 μg / ml to 12.5 μg / ml.

[0027] According to some embodiments of the present invention, based on the co-culture system, the concentration of the antibiotic is from 5 μg / ml to 10 μg / ml.

[0028] According to some embodiments of the present invention, the production strain is transformed by pMBIS and pTRC-BS plasmids. Thus, the production strain can produce bulnesene.

[0029] According to some embodiments of the present invention, the production strain is transformed by at least one of pCDF-FIAMAV and pCDF-FIAMAV-V1 plasmids. Thus, the production strain is resistant to the antibiotic in the co-culture system and oxidizes bulnesene to bulnesene-15-ol and bulnesene-15-al.

[0030] According to some embodiments of the present invention, the antibiotic resistance plasmid is removed from the feeder strain, making the feeder strain more susceptible to the antibiotic, so that the initial concentration of the antibiotic in the co-culture system can be reduced, and thereby the biological stress imposed on the two strains can be reduced.

[0031] Another object of the present invention is to provide a method for synthesizing a target compound, which synthesizes the target compound through the co-culture system according to the present invention.

[0032] According to some embodiments of the present invention, the concentration of the antibiotic is set such that the ratio of the number of feeder strains to the number of producer strains matches the concentration of the antibiotic. For example, an appropriate initial concentration of the antibiotic is set to obtain a desired ratio of the number of feeder strains to the number of producer strains during incubation.

[0033] According to some embodiments of the present invention, when the inoculation ratio of the feeder strain to the producer strain exceeds 25%:75%, the concentration of the antibiotic can also be gradually increased, for example, the concentration of the antibiotic is increased to 5 μg / ml to 20 μg / ml or any value therebetween. The total terpene production level can be used to determine the antibiotic concentration required for a specific ratio of feeder strains and producer strains. Thereby, the growth of the feeder strain can be appropriately controlled.

[0034] According to some embodiments of the present invention, the feeder strain and / or the producer strain is selected from one or more of bacteria, fungi, or yeasts. According to some specific embodiments of the present invention, the feeder strain and / or the producer strain is Escherichia coli.

[0035] According to some embodiments of the present invention, the ratio of the feeder strain to the producer strain is (10 - 90):(90 - 10). According to some preferred embodiments of the present invention, the ratio of the feeder strain to the producer strain is (12.5 - 75):(87.5 - 25). In the present invention, the ratio range of the producer strain to the feeder strain can also be controlled by changing the inoculation ratio, thereby further increasing the yield of terpenoids.

[0036] According to some embodiments of the present invention, based on the total inoculation volume of the feeder strain and the producer strain, the content of the feeder strain is 10% to 90%. According to a preferred embodiment of the present invention, based on the inoculation volume of the feeder strain and the producer strain, the content of the feeder strain is 12.5% - 75%, for example, it can be 12.5%, 25%, 37.5%, 50%, 62.5%, 75% and any value therebetween.

[0037] The co - culture system according to the present invention can increase the total production of terpenoids. When the co - culture system according to the present invention is carried out in a shake flask, it can produce about 500 mg / L to 2500 mg / L of terpenoids, and when the co - culture system is transferred to a fermenter, the yield will increase significantly.

[0038] With the co - culture system according to the present invention, any terpene compound can be produced by expressing the corresponding terpene synthase, and these terpene compounds include but are not limited to monoterpenes (linalool, geraniol, and 2,6 - dimethyloctane) for biofuels and other sesquiterpenes (bisabolene, cyclocolorenone, and isolongifolene), and diterpenes (taxadiene) for medicine and other applications.

[0039] According to some embodiments of the present invention, the feeder strain can be further modified to express hydrolases to degrade polymers such as cellulose, lignin, hemicellulose, etc.; in some embodiments, a variety of feeder strains can be developed and controlled through an antibiotic system that produces terpene compounds by utilizing or degrading complex biomaterials; in some embodiments, the principle of antibiotic - controlled co - culture can be combined with other pathways to enhance the interaction, flux, and product formation of the microbial community; in some embodiments, different microorganisms such as yeast, fungi, and bacteria can be used to create a co - culture of multiple strains, and their numbers can be controlled by antibiotics during growth and expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Schematically shows the yields of single - strain and co - culture systems for the biosynthesis of buniene and its oxidation products using pCDF - FIAMAV.

[0041] Figure 2 Schematically shows the yields of single - strain and co - culture systems for the biosynthesis of buniene and its oxidation products using pCDF - FIAMAV - V1.

[0042] Figure 3 Schematically shows the yield of the co - culture system of Example 1.

[0043] Figure 4 Schematically shows the yield of the co - culture system of Example 2.

[0044] Figure 5 Schematically shows the yield of the co - culture system of Example 3.

[0045] Figure 6 Schematically shows the yield of the co - culture system of Example 4. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0046] The following further elaborates on the present application in conjunction with specific embodiments. It should be understood that these specific embodiments are only used to illustrate the present application and not to limit the scope of the present application.

[0047] For the sake of brevity, only some numerical ranges are specifically disclosed herein. However, any lower limit can be combined with any upper limit to form a range not explicitly recited; and any lower limit can be combined with other lower limits to form a range not explicitly recited, and similarly any upper limit can be combined with any other upper limit to form a range not explicitly recited. In addition, each individually disclosed point or single numerical value itself can be used as a lower limit or an upper limit and combined with any other point or single numerical value or combined with other lower limits or upper limits to form a range not explicitly recited.

[0048] Unless otherwise specified, the terms used in this application have the well-known meanings commonly understood by those skilled in the art. Unless otherwise specified, the numerical values of the various parameters mentioned in this application can be measured by various common measurement methods in the art (for example, they can be tested according to the methods given in the embodiments of this application).

[0049] The list of items connected by the terms "at least one of", "at least one kind of" or other similar terms can mean any combination of the listed items. For example, if items A and B are listed, then the phrase "at least one of A and B" means only A; only B; or A and B. In another example, if items A, B, and C are listed, then the phrase "at least one of A, B, and C" means only A; or only B; only C; A and B (excluding C); A and C (excluding B); B and C (excluding A); or all of A, B, and C. Item A can include a single component or multiple components. Item B can include a single component or multiple components. Item C can include a single component or multiple components.

[0050] The pMVA, pMBIS, and pMeVT plasmids are resistant to chloramphenicol and are generated by a method similar to that disclosed in Chinese Patent Application No. 2022105905014 (International Application No. PCT / CN2023 / 096509).

[0051] In the embodiments of the present invention, the codon-optimized bulnesene synthase gene (NCBI-KF800046) is cloned into pTRC-HisA to generate the plasmid pTRC-BS, which is resistant to carbenicillin.

[0052] In an embodiment of the present invention, wild-type P450BM3 (with a nucleotide sequence of SEQ ID No.1 and an amino acid sequence of SEQ ID No.2) is provided. Then, the gene encoding the P450BM3 variant F87I / A82M / A330V is cloned into the pCDF-duet vector to create pCDF-FIAMAV. In an embodiment of the present invention, the T7 promoter (TAATACGACTCACTATAGGGGAA) of pCDF-FIAMAV is mutated (TAATACGACTCACTATCAAGGAA) to generate pCDF-FIAMAV-V1. pCDF-duet is resistant to streptomycin.

[0053] Comparative Example 1 Single-Strain System

[0054] Production strains are obtained by transforming pMVA, pTRC-BS, and the pCDF-FIAMAV or pCDF-FIAMAV-V1 plasmid into E. coli BL21(DE3). The single strain is resistant to ampicillin, chloramphenicol, and streptomycin. The production strain is inoculated into separate 5 ml of LB (Luria-Bertani) medium supplemented with 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, and 100 μg / ml streptomycin and incubated at 37 °C for 12 hours to obtain an overnight seed culture. The overnight seed culture is inoculated into 25 ml of TB (Terrific Broth) medium supplemented with 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, and 100 μg / ml streptomycin and incubated at 37 °C and 200 rpm. Once the OD at 600 nm reaches 0.6, the culture is induced with 0.1 mM IPTG and incubated at 30 °C. 2% w / v glucose is added as a carbon source, and 15% v / v decane is added as a second organic phase to extract terpenoids. The culture is induced twice with 0.1 mM IPTG every 24 hours, and 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, 100 μg / ml streptomycin, 2% glucose, and 2% tryptone are supplemented. The decane phase is collected by centrifugation after 72 hours and analyzed by GC.

[0055] The single-strain system using pCDF-FIAMAV produces 1400 mg / L of total terpenes and 53% oxidized bulnesene (bulnesene-15-ol and bulnesene-15-al) ( Figure 1 ). The single-strain system using pCDF-FIAMAV-V1 produces 885 mg / L of total terpenes and 36% oxidized bulnesene ( Figure 2 ).

[0056] Comparative Example 2 Co-Culture System

[0057] Feeder strains were generated by transforming pMevt, pUC-19, and pCDF-dual plasmids into E. coli BL21(DE3). Production strains were obtained by transforming pMBIS, pTRC-BS, and pCDF-FIAMAV or pCDF-FIAMAV-V1 plasmids into E. coli BL21(DE3). Both feeder and production strains were resistant to ampicillin, chloramphenicol, and streptomycin. Colonies of feeder and production strains were inoculated into separate 5 ml LB (Luria-Bertani) medium supplemented with 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, and 100 μg / ml streptomycin and incubated at 37 °C for 12 h to obtain overnight seed cultures. Overnight cultures of feeder and production strains at different ratios (25%:75% to 50%:50%) were inoculated into 25 ml TB (Terrific Broth) medium supplemented with 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, and 100 μg / ml streptomycin and incubated at 37 °C and 200 rpm. Once the OD at 600 nm reached 0.6, the cultures were induced with 0.1 mM IPTG and incubated at 30 °C. 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, 100 μg / ml streptomycin, and 2% w / v glucose were added as a carbon source, and 15% v / v decane was added as a second organic phase to extract terpenoids.

[0058] The co-culture system with pCDF-FIAMAV and 37.5% feeder strain produced 2234 mg / L total terpenes and 59% oxidized bulnesene ( Figure 1 ). The co-culture system with pCDF-FIAMAV and 25% feeder strain produced 1667 mg / L total terpenes and 66% oxidized bulnesene ( Figure 1 ). The co-culture system with pCDF-FIAMAV-V1 and 37.5% feeder strain produced 1600 mg / L total terpenes and 60% oxidized bulnesene ( Figure 2 ).

[0059] Example 1 Antibiotic control was carried out on 25% feeder strain and 75% production strain

[0060] Feeder strains were generated by transforming pMevt, pUC-19, and the plasmid into E. coli BL21(DE3). Compared with the comparative example, the feeder strains do not include the pCDF-duet plasmid and are thus sensitive to streptomycin. Production strains were generated by transforming pMBIS, pTRC-BS, and pCDF-FIAMAV plasmids into E. coli BL21(DE3). The feeder strains are sensitive to streptomycin, but due to the presence of pCDF-FIAMAV, the production strains are resistant to it. Colonies of the feeder and production strains were inoculated into 5 ml of LB (Luria-Bertani) medium supplemented with 100 μg / ml ampicillin and 36 μg / ml chloramphenicol, and colonies of the production strains were inoculated into 5 ml of LB (Luria Bertani) medium containing 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, and 100 μg / ml streptomycin. The feeder and production strains were incubated at 37 °C for 12 h to obtain an overnight seed culture. The feeder and production strains in a volume ratio of 25%:75% were inoculated into 25 ml of TB (Terrific Broth) medium supplemented with 100 μg / ml ampicillin and 36 μg / ml chloramphenicol and incubated at 37 °C and 200 rpm, with the streptomycin concentration maintained at 10 μg / ml or 12.5 μg / ml. Once the OD at 600 nm reached 0.6, the culture was induced with 0.1 mM IPTG and incubated at 30 °C. 2% w / v glucose was added as a carbon source, and 15% v / v decane was added as a second organic phase to extract terpenoids. The culture was induced twice with 0.1 mM IPTG every 24 h, and streptomycin (10 μg / ml or 12.5 μg / ml), 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, as well as 2% glucose and 2% tryptone were supplemented. The decane phase was harvested by centrifugation after 72 h and analyzed by GC.

[0061] The antibiotic-controlled co-culture system with 12.5 μg / ml streptomycin produced 2224 mg / L of total terpenes and 70% oxidized buniene ( Figure 3 ). Compared with the co-culture system with the same inoculation ratio, the total terpene production increased by 33% ( Figure 3 ).

[0062] Example 2 performed antibiotic control on 37.5% of the feeder strains and 62.5% of the production strains

[0063] Feeder strains were generated by transforming pMevt, pUC-19, and plasmids into E. coli BL21(DE3). Compared with the comparative example, the feeder strains did not contain the pCDF-duet plasmid, so they were sensitive to streptomycin. Production strains were generated by transforming pMBIS, pTRC-BS, and pCDF-FIAMAV plasmids into E. coli BL21(DE3). The feeder strains were sensitive to streptomycin, but due to the presence of pCDF-FIAMAV, the production strains were resistant to it. Colonies of the feeder strains were inoculated into 5 ml of LB (Luria Bertani) medium containing 100 μg / ml ampicillin and 36 μg / ml chloramphenicol. Colonies of the production strains were inoculated into 5 ml of LB (Luria Bertani) medium containing 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, and 100 μg / ml streptomycin. The feeder strains and production strains were incubated at 37 °C for 12 h to obtain overnight seed cultures. The feeder strains and production strains with a volume ratio of 37.5%:62.5% were inoculated into 25 ml of TB medium and incubated at 37 °C and 200 rpm, with the streptomycin concentration maintained at 10 μg / ml to 15 μg / ml. Once the OD at 600 nm reached 0.6, the cultures were induced with 0.1 mM IPTG and incubated at 30 °C. 2% w / v glucose was added as a carbon source, and 15% v / v decane was added as a second organic phase to extract terpenoids. The cultures were induced twice with 0.1 mM IPTG every 24 h and supplemented with 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, streptomycin (10 μg / ml to 15 μg / ml), 2% glucose, and 2% tryptone. The decane phase was harvested by centrifugation after 72 h and analyzed by GC.

[0064] The antibiotic-controlled co-culture system using 12.5 μg / ml streptomycin produced 2673 mg / L of total terpenes and 65% oxidized bulnesene ( Figure 4 ). Compared with the co-culture system with the same inoculation ratio, the total terpene production increased by 15% ( Figure 4 ).

[0065] Example 3 controlled 50% of the feeder strains and 50% of the production strains by antibiotics

[0066] Feeder strains were generated by transforming pMevt, pUC-19, and plasmids into E. coli BL21(DE3). Compared with the comparative example, the feeder strains did not contain the pCDF-duet plasmid, so they were sensitive to streptomycin. Production strains were generated by transforming pMBIS, pTRC-BS, and pCDF-FIAMAV plasmids into E. coli BL21(DE3). The feeder strains were sensitive to streptomycin, but due to the presence of pCDF-FIAMAV, the production strains were resistant to it. Colonies of the feeder strains were inoculated into 5 ml of LB (Luria Bertani) medium containing 100 μg / ml ampicillin and 36 μg / ml chloramphenicol. Colonies of the production strains were inoculated into 5 ml of LB (Luria Bertani) medium containing 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, and 100 μg / ml streptomycin. The feeder strains and production strains were incubated at 37 °C for 12 h to obtain overnight seed cultures. The feeder strains and production strains in a volume ratio of 50%:50% were inoculated into 25 ml of TB medium, supplemented with 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, and incubated at 37 °C and 200 rpm. The streptomycin concentration was maintained at 10 μg / ml to 15 μg / ml. Once the OD at 600 nm reached 0.6, the culture was induced with 0.1 mM IPTG and incubated at 30 °C. 2% w / v glucose was added as a carbon source, and 15% v / v decane was added as a second organic phase to extract terpenoids. The culture was induced twice with 0.1 mM IPTG every 24 h, and streptomycin (10 μg / ml to 15 μg / ml), 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, as well as 2% glucose and 2% tryptone were supplemented. The decane phase was harvested by centrifugation after 72 h and analyzed by GC.

[0067] The antibiotic-controlled co-culture system using 15 μg / ml streptomycin produced 2627 mg / L of total terpenes and 59% oxidized buniene ( Figure 5 ). Compared with the co-culture system strains with the same inoculation ratio, the total terpene production increased by 2.5-fold ( Figure 5 ).

[0068] Example 4 increased the antibiotic concentration for 25% feeder strains and 75% production strains

[0069] The feeder strain was generated by transforming pMevt, pUC-19 plasmids into BL21(DE3). Compared with the comparative example, the feeder strain does not contain the pCDF-duet plasmid, so it is sensitive to streptomycin. The production strain was generated by transforming pMBIS, pTRC-BS, and pCDF-FIAMAV-V1 plasmids into BL21(DE3). The pCDF-FIAMAV-V1 plasmid was created by mutating the T7 promoter to regulate FIAMAV expression. The feeder strain is sensitive to streptomycin, but the production strain is resistant to it due to the presence of pCDF-FIAMAV-V1. The colonies of the feeder strain were inoculated into 5 ml of LB (Luria Bertani) medium containing 100 μg / ml ampicillin and 36 μg / ml chloramphenicol. The colonies of the production strain were inoculated into 5 ml of LB (Luria Bertani) medium containing 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, and 100 μg / ml streptomycin. The feeder strain and the production strain were incubated at 37 °C for 12 hours to obtain an overnight seed culture. The feeder strain and the production strain with a volume ratio of 25%:75% were inoculated into 25 ml of TB medium supplemented with 100 μg / ml ampicillin and 36 μg / ml chloramphenicol and incubated at 37 °C and 200 rpm. The streptomycin concentration was maintained at 5 μg / ml or 10 μg / ml. Once the OD at 600 nm reached 0.6, the culture was induced with 0.1 mM IPTG and incubated at 30 °C. 2% w / v glucose was added as a carbon source, and 15% v / v decane was added as a second organic phase to extract terpenoids. The culture was induced twice with 0.1 mM IPTG every 24 hours and supplemented with 100 μg / ml ampicillin, 36 μg / ml chloramphenicol, 2% glucose, and 2% tryptone. After 24 hours, 10 μg / ml or 15 μg / ml streptomycin was added to the culture. After 48 hours, 15 μg / ml to 25 μg / ml streptomycin was added to the culture. The decane phase was centrifuged and harvested after 72 h and analyzed by GC.

[0070] The antibiotic control co-culture system with a gradually increasing streptomycin concentration (5 μg / ml at inoculation, 12.5 μg / ml at 24 h, and 20 μg / ml at 48 h) produced 1636 mg / L of total terpenes and 61% oxidized bulnesene ( Figure 6 ). Compared with the co-culture system with the same inoculation ratio, the total terpene production increased by 70% ( Figure 6 ).

[0071] Although some exemplary embodiments of the present application have been illustrated and described, the present application is not limited to the disclosed embodiments. On the contrary, those of ordinary skill in the art will recognize that some modifications and changes can be made to the described embodiments without departing from the spirit and scope of the present application as described in the appended claims.

Claims

1. A co-culture system for synthesizing a target compound, characterized in that, the co-culture system comprises at least one feeder strain and at least one producer strain, wherein the feeder strain provides a precursor compound, and the producer strain uses the precursor compound to produce the target compound, the co-culture system further comprises an antibiotic, and wherein one of the producer strain and the feeder strain is resistant to the antibiotic, and the other is not resistant to the antibiotic.

2. The co-culture system according to claim 1, characterized in that, the target compound is a terpene compound, preferably the precursor compound is mevalonic acid, the feeder bacterium is used to provide mevalonic acid, and the producer strain is used to synthesize the terpene compound by using the mevalonic acid.

3. The co-culture system according to claim 1, characterized in that, the target compound comprises at least one of monoterpene compounds, sesquiterpenes and diterpene compounds.

4. The co-culture system according to claim 3, characterized in that, the monoterpene compounds comprise at least one of linalool, geraniol and 2,6-dimethyloctane, the sesquiterpenes comprise at least one of bisabolene, bicyclogermacrene, isolongifolene, bungeene, valencene, β-patchoulene, aristolene, guaiene, cedrene, bungeene oxide and valencene oxide, and the diterpene compound is taxadiene.

5. The co-culture system according to claim 1 or 2, characterized in that, the antibiotic is an intracellular antibiotic, preferably streptomycin.

6. The co-culture system according to claim 1, characterized in that, based on the co-culture system, the concentration of the antibiotic is not less than 5 μg / ml and / or not more than 20 μg / ml.

7. The co-culture system according to claim 1, characterized in that, based on the co-culture system, the concentration of the antibiotic is 5 μg / ml to 20 μg / ml, preferably 5 μg / ml to 12.5 μg / ml, particularly preferably 5 μg / ml to 10 μg / ml.

8. The co-culture system according to claim 1, characterized in that, an antibiotic resistance plasmid has been removed from the feeder strain.

9. A method for synthesizing a target compound, characterized in that, the method synthesizes the target compound by means of the co-culture system according to any one of claims 1 to 8.

10. The method according to claim 9, characterized in that, the concentration of the antibiotic is set such that the ratio of the feeder strain to the producer strain matches the concentration of the antibiotic.

11. The method according to claim 9, characterized in that, when the inoculation ratio of the feeder strain to the producer strain exceeds 25%:75%, the concentration of the antibiotic can also be gradually increased.

Images